ID: 1081236255

View in Genome Browser
Species Human (GRCh38)
Location 11:40650803-40650825
Sequence CTGGCCAAAGAGAACTACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 133}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081236255 Original CRISPR CTGGCCAAAGAGAACTACCA TGG (reversed) Intronic
901241339 1:7695547-7695569 ATGTCCAAAGTGAAATACCATGG - Intronic
905480606 1:38259362-38259384 TTGGTCAATGGGAACTACCATGG - Intergenic
906302406 1:44692676-44692698 CAGGCCAAAGGGAATAACCATGG + Intronic
909503622 1:76362830-76362852 CTGGCCCAAGAGAGCAGCCATGG - Intronic
911613330 1:99981201-99981223 CTGGTCAGAGACAACTACTAGGG - Intronic
914200501 1:145480518-145480540 CTGGGCTAAGAGATCTATCATGG + Intergenic
914479616 1:148053645-148053667 CTGGGCTAAGAGATCTATCATGG + Intergenic
919550464 1:198979331-198979353 CTGGCAAAAGATAACTAGTAAGG - Intergenic
923703112 1:236318631-236318653 CAGGCCAATGAGGACTACGAGGG + Intergenic
1063869311 10:10400986-10401008 GTGGTCAGAGAGAACTCCCAGGG - Intergenic
1064071187 10:12229370-12229392 CTGGACAAAGAGAAGTATCCAGG - Intronic
1069583368 10:69579915-69579937 CTGCCTAAAGAGAATCACCATGG - Intergenic
1069911131 10:71760606-71760628 CTGGCCAAAGGTCACTGCCAAGG + Intronic
1071561294 10:86648784-86648806 CTGGCCAAAGGAAACCAGCAGGG - Intergenic
1078502546 11:11895727-11895749 CTGGCCAAAGACAGGTATCATGG - Intronic
1080040818 11:27757653-27757675 ATGGCCAAAGGGAACAAACATGG + Intergenic
1081236255 11:40650803-40650825 CTGGCCAAAGAGAACTACCATGG - Intronic
1081875741 11:46407359-46407381 CAGGCAAAAGGGAACCACCACGG - Intronic
1083303333 11:61750091-61750113 CTGGCCACTGAGAACTGACAGGG + Intergenic
1084031604 11:66484541-66484563 CTGGCATAAGAGAGCTACCCAGG - Intronic
1084151613 11:67290183-67290205 GTGGGCAAAGAGAACCGCCAGGG + Exonic
1088461465 11:110087947-110087969 CTGGGCAAGGCGAACTACAATGG + Intergenic
1089697509 11:120225181-120225203 CTGGCCAATCAGAAGCACCAAGG + Intronic
1090737024 11:129618913-129618935 CTGGAAATAGAGAGCTACCAGGG + Intergenic
1091129090 11:133128888-133128910 CTGGCCAAAGTGCAGTAACAGGG + Intronic
1091620184 12:2081634-2081656 CTGTGCTGAGAGAACTACCAAGG + Intronic
1091888824 12:4036614-4036636 CTGGCCATAGAGAATGGCCAGGG - Intergenic
1094001586 12:25700945-25700967 TTGGCCAAAACGAAGTACCAGGG + Intergenic
1097379329 12:58876313-58876335 CTGGCCCAAGATCACTAGCAAGG - Intronic
1099920001 12:88945765-88945787 CTGGACAAAGACATCTACCTTGG + Intergenic
1105580767 13:21693594-21693616 CTGCCCAAAGAGAACTTACTGGG - Intronic
1106228201 13:27800947-27800969 CTGCCCATGGAGAACTCCCACGG - Intergenic
1112286141 13:98106094-98106116 CTGCACACAGAGAACTTCCATGG + Intergenic
1117034380 14:51713075-51713097 CTGGCAAAAGAGAAATACTTGGG - Intronic
1119222019 14:72916444-72916466 GTGGGCACAGAGAAATACCAGGG + Intergenic
1120329058 14:83065143-83065165 TTGGCATAAAAGAACTACCATGG + Intergenic
1120996800 14:90423605-90423627 CTGGCCAAAGGGAGGCACCATGG + Intergenic
1121982415 14:98466415-98466437 ATGGCCAAAGAGCAGGACCATGG + Intergenic
1122423370 14:101591096-101591118 CTGGCAAAACAGACCTACCTGGG - Intergenic
1124162088 15:27281084-27281106 CAGAGCAAAGAGAATTACCAAGG - Intronic
1126751742 15:51884786-51884808 ATGGCCAAAGAGAAAAACAAAGG + Intronic
1126809598 15:52388200-52388222 CTGGCCAGAGAGCTCTTCCAAGG + Intronic
1127341852 15:58054188-58054210 CTGTCCTAAGAGAAACACCAAGG + Intronic
1127388808 15:58488767-58488789 CATGCCAAAGGGAAATACCAAGG - Intronic
1129455030 15:75672223-75672245 CTGACCAATGAGAACTGCCAGGG - Intergenic
1132622962 16:876331-876353 CGGGGCACAGAGAACTTCCAGGG + Intronic
1137368136 16:47878638-47878660 CTGTCCAAAGAAACCTCCCAGGG - Intergenic
1137373775 16:47933098-47933120 CTTGGTAAAGAGAACAACCATGG - Intergenic
1141032293 16:80599860-80599882 ATGGCCAAAGACAATCACCAAGG + Exonic
1141289814 16:82707381-82707403 CTGGCCAATGAGAATGAGCAGGG + Intronic
1141743097 16:85907377-85907399 CTGGCTAAAGACAGCTACCTGGG + Intronic
1142863966 17:2779332-2779354 CTGGCCACACAGAAATACCCCGG - Intronic
1144599203 17:16598145-16598167 CTGGCCAAACTGATCTACCTTGG + Intergenic
1145825067 17:27870782-27870804 CTGGCCCCAGACAACTGCCAGGG + Intronic
1147213718 17:38887058-38887080 CTGGCCAATGAGAAACCCCAGGG + Intronic
1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG + Intronic
1149235559 17:54586587-54586609 CTGACCAAAAAGAACAACCCTGG + Intergenic
1154135679 18:11775606-11775628 GGGGACAAAGAGAAGTACCACGG + Intronic
1156196804 18:34783502-34783524 CTTAGCAAAGAGAACTACCTTGG + Intronic
1156292259 18:35757887-35757909 CAGAACAAAGAAAACTACCAGGG + Intergenic
1156521902 18:37728979-37729001 CTGGCCAAAGAGGTCAGCCAAGG + Intergenic
1156558533 18:38094724-38094746 CTGGCCAAAGTGATCTTCCTTGG - Intergenic
1157566296 18:48681124-48681146 CTGGCCCAAGAACAATACCAGGG + Intronic
1157670170 18:49521524-49521546 CTGGCCCAAGAGCCCTACCAGGG - Intergenic
1161218792 19:3108276-3108298 CTGTGCAAAGATATCTACCATGG + Intronic
1164083714 19:21882617-21882639 CTGTCCAAAGAAACCTACAAAGG - Intergenic
1165038827 19:33054530-33054552 CTGGCCATAGGGAACTCCGAGGG + Intronic
926198284 2:10776580-10776602 CTGGCTGAAGAGAACAGCCAGGG - Intronic
927250411 2:20991184-20991206 CTGGCCTAAGGGAACCACCGTGG - Intergenic
932698887 2:73979734-73979756 CTGGCCAAAGAAAGTTACAAGGG - Intergenic
936005213 2:108880800-108880822 GTGACCAAAGAGCTCTACCATGG + Intronic
936659874 2:114530862-114530884 CTGGCCAGTGAGAACTTCTAGGG + Intronic
937327407 2:120999369-120999391 CTGGCCTATGAGAACTGACAAGG + Intergenic
941671505 2:168298768-168298790 CCAGGCAAAGAGAACTACCGGGG - Intergenic
942521573 2:176809499-176809521 CTGGCCAAAGTCAAAGACCAGGG - Intergenic
944869303 2:203893733-203893755 CTAGCCAGGGAGAACTGCCAAGG + Intergenic
946484762 2:220090316-220090338 CTGGCCAAAGCAAACTATGAGGG + Intergenic
1172883710 20:38217707-38217729 CTAGGCAAAGTGAACTGCCATGG - Intronic
1178275265 21:31231032-31231054 CTGGCCAAAGCCAAGTGCCATGG - Intronic
1178275996 21:31237371-31237393 CAGGCTCAAGAGAACTACCTTGG - Intronic
1178625975 21:34219168-34219190 CTTTTCAAAAAGAACTACCAAGG - Intergenic
1183098814 22:35570850-35570872 CTAGCCAAAGAGACCTGTCAGGG + Intergenic
1185307044 22:50125005-50125027 CTGGCCAAGGTGGACTAACAAGG - Intronic
951673865 3:25215211-25215233 CTGGCTACAGAGAACCACCTGGG - Intronic
952686588 3:36156880-36156902 CTGGACAAAGAAAACTATAATGG + Intergenic
953820533 3:46204167-46204189 CAGGCCAATGACAAATACCAAGG + Exonic
954494237 3:50938164-50938186 CAGAGCAAAGAAAACTACCAGGG + Intronic
958891989 3:99794278-99794300 CTGGCCCAAGAGGACCACCTGGG + Exonic
959648787 3:108731577-108731599 AAGGCCAAAGAGGACCACCAGGG - Intergenic
961521634 3:127470417-127470439 CTGGCTAGAGAGAACTGCCTTGG - Intergenic
963424357 3:145107155-145107177 CTGATCAAATAGAACTACCTTGG + Intergenic
964520935 3:157565502-157565524 CAGGCAAAAAACAACTACCAGGG - Intronic
966518737 3:180849505-180849527 CTGGCCAATGTGAAGTACCAGGG + Intronic
967711170 3:192710038-192710060 CTGGCTTAAGAAAATTACCAAGG - Intronic
970929329 4:21491252-21491274 CTGGCCCATGAAAACTTCCAGGG + Intronic
971237815 4:24858732-24858754 CTGTCCAGAGAGAATTTCCAGGG - Intronic
975378012 4:73667793-73667815 CTGCCCAAAGAAACCTACAAAGG - Intergenic
979442870 4:120772697-120772719 CTGGCCAATGATAAATACCTAGG - Intronic
979607187 4:122651049-122651071 CTGGAGAAAGAGAATTTCCAGGG - Intergenic
979924415 4:126542745-126542767 CTTGGTAAATAGAACTACCAGGG - Intergenic
983411456 4:167403512-167403534 CTGGCCAATGCTAACTGCCATGG + Intergenic
991371696 5:65926011-65926033 CTGGCGAAGGAGAACAAGCAGGG + Intergenic
991954996 5:71985521-71985543 CTGGGGAAAGAGGACTACCCAGG + Intergenic
992237832 5:74730509-74730531 CGGGCCAAAAAGAATTACAAAGG - Intronic
992673914 5:79086169-79086191 CTGGCCCAAGAGAATTACCGGGG - Intronic
997782966 5:136678331-136678353 ATGAACAAAGTGAACTACCAGGG - Intergenic
998334235 5:141356671-141356693 CTGGCCGAAGACACCTTCCAGGG + Exonic
1000287605 5:159840247-159840269 CTGGGCAAAGAGAACTGCTGAGG - Intergenic
1000299238 5:159940416-159940438 CTGGCTAAACCGAACTAACAGGG - Intronic
1001252311 5:170155927-170155949 CTGCCCATGGAGAAATACCACGG - Intergenic
1001667270 5:173443655-173443677 CTGTCACAAGAGAACTAACAGGG - Intergenic
1002448366 5:179303859-179303881 CTGGCCAGAGAGATTTAACAAGG + Intronic
1002925471 6:1603626-1603648 CGGACTAAAAAGAACTACCAGGG + Intergenic
1006734885 6:36266541-36266563 CTGGACAATGAGAAGTAACAGGG - Intronic
1007368658 6:41412165-41412187 CTGGCCAGAAAGAACACCCAGGG - Intergenic
1007700754 6:43765126-43765148 CTGCGCAAAGAGAACAAGCAAGG - Intergenic
1009312368 6:62170639-62170661 CTGGCACATGAGAACAACCATGG + Intronic
1009493518 6:64322470-64322492 CAGGCTATAGGGAACTACCACGG + Intronic
1021479004 7:21094849-21094871 CTGCCCAATGATAACTACCAAGG - Intergenic
1021956720 7:25832553-25832575 CCGGGCAATGAGAACTACCCGGG + Intergenic
1027863495 7:83615845-83615867 CAAGCCAAAGCGAAATACCAAGG + Intronic
1032086638 7:128887154-128887176 CTGGCCAGAGAGGAGTATCAAGG + Intronic
1039966876 8:42290235-42290257 CTGGCCATGGAGTACTGCCAAGG + Exonic
1046774845 8:118153033-118153055 CTGGCTAAAGAGAGCTGGCAAGG + Intergenic
1047609886 8:126510494-126510516 CTGGCCCATGAAAACTTCCATGG - Intergenic
1049932309 9:469364-469386 CTGGCGAGAGCCAACTACCAGGG + Intergenic
1050778961 9:9306122-9306144 TTGGCCAAAGGCAACTGCCAAGG - Intronic
1055383971 9:75741160-75741182 AAGGCCAAGGATAACTACCATGG + Intergenic
1057504365 9:95620401-95620423 CTGCCCAAAGAGAGCCACCTTGG - Intergenic
1057841298 9:98487449-98487471 CTGGCATAAGACAACTACAAAGG - Intronic
1059060682 9:111032644-111032666 TTGGTCAAAGAGAACCACCTAGG + Intronic
1061989676 9:134152234-134152256 CTGGCCCAAGAGAAAGGCCATGG - Intronic
1189400040 X:40658935-40658957 CTGGCCAACCAGAGTTACCATGG - Intronic
1192097105 X:68223822-68223844 CAGAACAAAGAAAACTACCAAGG + Intronic
1192750545 X:73986041-73986063 CTGAACAAAGAATACTACCATGG - Intergenic
1192917886 X:75673475-75673497 CTGGCCCTAGATAACTGCCAGGG + Intergenic
1194734376 X:97494807-97494829 CTGGCCTCAGTGAACCACCAGGG - Intronic
1195005980 X:100686398-100686420 TTGTCCAAAAAGAACTGCCAAGG + Intronic
1196505998 X:116442777-116442799 CTTTTCAAAGTGAACTACCATGG + Exonic