ID: 1081236592

View in Genome Browser
Species Human (GRCh38)
Location 11:40654266-40654288
Sequence GACATTTTGCACTGTGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 953
Summary {0: 1, 1: 0, 2: 21, 3: 246, 4: 685}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081236583_1081236592 10 Left 1081236583 11:40654233-40654255 CCATCCTCCAGACCCCAGAATGG 0: 840
1: 1321
2: 1065
3: 761
4: 712
Right 1081236592 11:40654266-40654288 GACATTTTGCACTGTGTGCTGGG 0: 1
1: 0
2: 21
3: 246
4: 685
1081236582_1081236592 13 Left 1081236582 11:40654230-40654252 CCACCATCCTCCAGACCCCAGAA 0: 757
1: 1362
2: 1656
3: 1468
4: 1416
Right 1081236592 11:40654266-40654288 GACATTTTGCACTGTGTGCTGGG 0: 1
1: 0
2: 21
3: 246
4: 685
1081236587_1081236592 -2 Left 1081236587 11:40654245-40654267 CCCCAGAATGGTAGATCCACTGA 0: 788
1: 1110
2: 1492
3: 1250
4: 917
Right 1081236592 11:40654266-40654288 GACATTTTGCACTGTGTGCTGGG 0: 1
1: 0
2: 21
3: 246
4: 685
1081236588_1081236592 -3 Left 1081236588 11:40654246-40654268 CCCAGAATGGTAGATCCACTGAC 0: 823
1: 1178
2: 1629
3: 1350
4: 1090
Right 1081236592 11:40654266-40654288 GACATTTTGCACTGTGTGCTGGG 0: 1
1: 0
2: 21
3: 246
4: 685
1081236585_1081236592 6 Left 1081236585 11:40654237-40654259 CCTCCAGACCCCAGAATGGTAGA 0: 1319
1: 1995
2: 1612
3: 1012
4: 675
Right 1081236592 11:40654266-40654288 GACATTTTGCACTGTGTGCTGGG 0: 1
1: 0
2: 21
3: 246
4: 685
1081236586_1081236592 3 Left 1081236586 11:40654240-40654262 CCAGACCCCAGAATGGTAGATCC 0: 1268
1: 1929
2: 1766
3: 1012
4: 639
Right 1081236592 11:40654266-40654288 GACATTTTGCACTGTGTGCTGGG 0: 1
1: 0
2: 21
3: 246
4: 685
1081236589_1081236592 -4 Left 1081236589 11:40654247-40654269 CCAGAATGGTAGATCCACTGACA 0: 857
1: 1226
2: 1663
3: 1355
4: 1012
Right 1081236592 11:40654266-40654288 GACATTTTGCACTGTGTGCTGGG 0: 1
1: 0
2: 21
3: 246
4: 685

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081236592 Original CRISPR GACATTTTGCACTGTGTGCT GGG Intronic
900031392 1:375431-375453 GAAGTGTTGCGCTGTGTGCTCGG - Intergenic
900040985 1:464297-464319 GACAGCTTGCACTGTGTGCCTGG - Intergenic
900051943 1:603631-603653 GAAGTGTTGCGCTGTGTGCTCGG - Intergenic
900062414 1:699273-699295 GACAGCTTGCACTGTGTGCCTGG - Intergenic
900080103 1:850228-850250 GACATTTGGCAGTGTTTTCTCGG + Intergenic
900817387 1:4858889-4858911 GACAGGTTGCACTGTGTGCCTGG + Intergenic
900822730 1:4901717-4901739 GACAGCTTGCACTGTGTGCCTGG - Intergenic
901885843 1:12222473-12222495 GACATCTTGCACTGTGCACCTGG - Intergenic
902302937 1:15515672-15515694 GACATTTTTTCCTGTGTGATGGG - Intronic
902570633 1:17344969-17344991 GACAGCTTGCACCGTGTGCCTGG + Intronic
903594185 1:24481400-24481422 TTCATTTTGCACTGGGTCCTGGG - Intergenic
906636737 1:47415436-47415458 TACATTTTGTACTGTGTGTGTGG + Intergenic
907259452 1:53206424-53206446 GACAGTTTGCACCATGTGCCTGG + Intronic
908019963 1:59889211-59889233 GACAGCTTGCACCGTGTGCCTGG - Intergenic
909057999 1:70845348-70845370 GACAGCTTGCACTGTGTGCCTGG + Intergenic
909373436 1:74913754-74913776 GACAGTTTGCACCATGTGCCTGG - Intergenic
909488429 1:76199701-76199723 GAAATTCTGTGCTGTGTGCTTGG + Intronic
909751407 1:79165825-79165847 GACACCTTGCACTGTGTGCCTGG + Intergenic
909810274 1:79924413-79924435 GACAGCTTGCACTGTGTACCTGG + Intergenic
910013751 1:82496262-82496284 GACATCTTGCACTGTGCACCTGG - Intergenic
910722173 1:90298513-90298535 AAGATTTTGCACTGTGGCCTTGG - Intergenic
911023177 1:93408824-93408846 TACAACTTGCACTGTGTGCCTGG + Intergenic
911309525 1:96275904-96275926 GACAGCTTGCACTGTGTGCCTGG + Intergenic
911376425 1:97056999-97057021 GACAGCTTGCACTGTGCACTTGG + Intergenic
911503524 1:98719175-98719197 CACATTTAGCACTATGAGCTAGG - Intronic
911511170 1:98809157-98809179 GACAGCTTGCACTGTGAGCCTGG - Intergenic
911535026 1:99089657-99089679 AACAGCTTGCACTGTGTGCCTGG + Intergenic
911855672 1:102872214-102872236 GACAGCTTGCACTGTGTGCTTGG - Intergenic
911880856 1:103236647-103236669 GACAGCTTGCACTGTGTGCCTGG + Intergenic
911907062 1:103583226-103583248 GACATTCTGCTCTTTCTGCTTGG + Intergenic
912009993 1:104947602-104947624 AACAGCTTGCACTGTGTGCCTGG + Intergenic
912610177 1:111034591-111034613 GACAGCTTGCACTGTGTGCCTGG + Intergenic
913039982 1:115012584-115012606 GACAGCTTGCACTTTGTGCCTGG + Intergenic
913101767 1:115573973-115573995 GACAGTTTGCACTGTGCACCTGG + Intergenic
913383953 1:118239433-118239455 GACAGTTTGCACTGTGCTCCTGG + Intergenic
913396324 1:118376283-118376305 GACAGCTTGCACAGTGTGCCTGG - Intergenic
915654815 1:157350715-157350737 AACAGCTTGCACTGTGTGCCTGG - Intergenic
916829293 1:168474674-168474696 GACAGCTTGCACTGTATGCCTGG + Intergenic
917018865 1:170564264-170564286 GAGGTTTTGCACTGTGTTCATGG + Intergenic
917035412 1:170742847-170742869 GACAGCTTGCACTGTGTACATGG - Intergenic
917140088 1:171826993-171827015 AACATCTTGCACTGTGGGCCTGG - Intergenic
917396574 1:174600787-174600809 GACAGTTTGCACCATGTGCCTGG - Intronic
917681877 1:177375688-177375710 GACATTTTACCCATTGTGCTGGG + Intergenic
918267956 1:182864397-182864419 GATATTTTGATATGTGTGCTGGG + Intronic
918488451 1:185054402-185054424 GACACTGTGCTCTGTGTCCTGGG + Intronic
918591361 1:186245075-186245097 GACAGCTTGCACTGTGTGCCTGG - Intergenic
918619296 1:186583964-186583986 AAGAGTTTGCACTGTGTGCCTGG + Intergenic
918990725 1:191694694-191694716 GACAGCTTGCACTGTGTGCCTGG - Intergenic
919011713 1:191973814-191973836 GACAGCTTGTACTGTGTGCCTGG - Intergenic
919065981 1:192693381-192693403 GACAGCTTGCACTATGTGCCTGG - Intergenic
919291887 1:195643457-195643479 AACAGCTTGCACTGTGTGCCTGG - Intergenic
919333376 1:196200899-196200921 GAAATTTTGTATTGTTTGCTGGG + Intergenic
919460508 1:197871830-197871852 GACAGCTTGCACTGTGCGCCTGG - Intergenic
920209094 1:204315157-204315179 GACATTTAGGACTCTGTCCTTGG + Intronic
921386739 1:214577409-214577431 TACAGCTTGCACTGTGTGCCTGG + Intergenic
921434054 1:215096414-215096436 ATCATTATGCACTGTATGCTTGG - Intronic
921452336 1:215323754-215323776 GACAGCTTGCACTGTGCACTCGG - Intergenic
922357198 1:224787591-224787613 AACATTGTGCACTCTGTGATTGG + Intergenic
922666173 1:227471313-227471335 GACAGCTTGCACTGTGTACCTGG + Intergenic
923396334 1:233568780-233568802 CACATTTTGCATTGTCTGATTGG - Intergenic
923461251 1:234211379-234211401 GACAGCTTGCACTCTGTGCCTGG + Intronic
923878329 1:238075234-238075256 GACAGCTTGCACTGTGTGCCTGG - Intergenic
924134368 1:240948235-240948257 GACATTTTTGTCTGTTTGCTTGG + Intronic
924759192 1:246968473-246968495 AACAGTTTGCACTGTGTGCTTGG - Intronic
1062907710 10:1189957-1189979 GACATTTTGTGCTGTGAACTGGG - Intronic
1063397192 10:5700187-5700209 GATATTTGTCTCTGTGTGCTTGG + Intronic
1063626189 10:7692137-7692159 TACAGCTTGCACTGTGTGCCTGG - Intergenic
1064354967 10:14608232-14608254 TAAATTTTGCACTGTGTACGTGG + Intronic
1064902657 10:20311781-20311803 AACAGCTTGCACTGTGTGCCTGG - Intergenic
1065173898 10:23058606-23058628 GGAATTTTGCACTATGGGCTGGG - Intergenic
1065194675 10:23252162-23252184 GCCATTTTGCACTATGTTCTAGG + Intergenic
1066218483 10:33311978-33312000 GACATTTTCCAATGAATGCTGGG + Intronic
1066364624 10:34764857-34764879 TACTTTGAGCACTGTGTGCTGGG - Intronic
1067433620 10:46262521-46262543 GACACTGTGCCCTGGGTGCTGGG - Intergenic
1067440063 10:46303784-46303806 GACACTGTGCCCTGGGTGCTGGG + Intronic
1067666059 10:48280249-48280271 GATAGCTTGCACTGTGTGCATGG - Intergenic
1068018826 10:51554711-51554733 TACATTCCTCACTGTGTGCTAGG + Intronic
1068215543 10:53978050-53978072 GACAGTTTGCTGTGTGTGCCTGG - Intronic
1068289979 10:54989367-54989389 GACAGCTTGCACTGTGTGCCTGG + Intronic
1068314559 10:55323385-55323407 GACAGCTTCTACTGTGTGCTTGG + Intronic
1068908297 10:62351574-62351596 AACAGCTTGCACTGTGTGCCTGG - Intergenic
1069175702 10:65286174-65286196 GACAGTTTGAACCGTGTGCCTGG - Intergenic
1071043058 10:81337405-81337427 GACAGCTTGCACTGTGTGGCTGG + Intergenic
1073628029 10:105119497-105119519 AACAACTTGCACTGTGTGCCTGG + Intronic
1073846945 10:107567763-107567785 GACAGCTTGCACTGTGTGCCTGG - Intergenic
1073942424 10:108713796-108713818 GACAGATTGCACTGTGTGCCTGG + Intergenic
1074025205 10:109626984-109627006 GACAACTTGCACTGTGTGCCTGG - Intergenic
1074069190 10:110049407-110049429 GACAGCTTGCACCGTGTGCCTGG + Intronic
1074286215 10:112100531-112100553 GACGGCTTGCACTGTGTGCACGG - Intergenic
1074774397 10:116756400-116756422 AACACATTACACTGTGTGCTGGG + Intergenic
1074955680 10:118386522-118386544 AGCATTTTACACTTTGTGCTTGG + Intergenic
1075089339 10:119434700-119434722 GACAGCTTGCACTGTTTGCCTGG - Intronic
1075550398 10:123388516-123388538 GACAGTTTGCACCATGTGCCTGG + Intergenic
1075952388 10:126492225-126492247 GACATTTTTGGTTGTGTGCTAGG + Intronic
1076760040 10:132599539-132599561 AACAGCTTGCACTGTGTGCCTGG - Intronic
1076926769 10:133494647-133494669 GATAGCTTGCACTGTGTGCCTGG - Intergenic
1076967257 11:100527-100549 GACAGCTTGCACTGTGTGCCTGG - Intergenic
1077596589 11:3537368-3537390 GACAGCTTGCACTGTGTGCCTGG - Intergenic
1078201707 11:9189468-9189490 GACAGCTTGCACTGTGTGCCTGG + Intronic
1078301415 11:10134832-10134854 GACAGCTTGCACTGTGTGCCTGG - Intronic
1078431451 11:11291616-11291638 GACACTTTGCAGGGTGAGCTGGG + Intronic
1078687469 11:13546718-13546740 AACAACTTGCACTGTGTGCCTGG + Intergenic
1078747415 11:14128569-14128591 GACAGCTTGCACTGTGTACCTGG - Intronic
1078959484 11:16248256-16248278 GACAGCTTGCACTGTGTGCCTGG - Intronic
1079143887 11:17833563-17833585 GACAGCTTGCACTGTGTGCTTGG + Intronic
1079181909 11:18201312-18201334 GACAGTTTGCACCGTGTGTCTGG - Intronic
1079511535 11:21216433-21216455 GACAGCTTGCACTGTGTGCCTGG + Intronic
1079655036 11:22976216-22976238 CACAGCTTGCACTGTGTGCCTGG + Intergenic
1079945241 11:26733269-26733291 GACAGCTTGCACTGTGTGCCTGG + Intergenic
1079962408 11:26940760-26940782 GACAGCTTGCACTGTGTGCCTGG - Intergenic
1080204863 11:29716981-29717003 GACAGCTTGCACTGTGTGCCTGG - Intergenic
1080715712 11:34797868-34797890 GACAGCTTGCACTGTGTGCCTGG + Intergenic
1080717541 11:34818707-34818729 AACAGCTTGCACTGTGTGCCTGG - Intergenic
1080904039 11:36522665-36522687 GACAGCTTGCACTGTTTGCCTGG + Intronic
1080959820 11:37145572-37145594 GACAGCTTGCACTGTGTACCTGG - Intergenic
1081077640 11:38696303-38696325 GACAGCTTGCACTGTGAGCCTGG - Intergenic
1081101365 11:39006735-39006757 TACAGCTTGCACTGTGTGCCTGG - Intergenic
1081120007 11:39255104-39255126 GACAGCTTGCACTGTGTGCTTGG - Intergenic
1081183836 11:40018201-40018223 CACATTTTGCAGTGTGTCCAAGG - Intergenic
1081224264 11:40501255-40501277 GACAGGTTGCATTGTGTGCCTGG - Intronic
1081236592 11:40654266-40654288 GACATTTTGCACTGTGTGCTGGG + Intronic
1081598761 11:44477310-44477332 GACAGCTTGCACTGTGTGGCTGG + Intergenic
1081939479 11:46928553-46928575 GGCAGCTTGCACTGTGTGCTTGG + Intergenic
1082037319 11:47655740-47655762 AACATTTTGCACTGAGATCTTGG - Intergenic
1082734235 11:56838668-56838690 GACAGCTTGCACTGTGTGCCTGG - Intergenic
1082789898 11:57339878-57339900 GATTTTTTGCTCTGTGTGCTGGG + Intronic
1083085090 11:60134502-60134524 GACAGCTTGCACTGTATGCCTGG + Intergenic
1083121826 11:60520723-60520745 GACAGCTTGCACCGTGTGCCTGG - Intronic
1083283941 11:61645666-61645688 GACATTGTGTACGGAGTGCTCGG - Intergenic
1084252505 11:67911342-67911364 GACAGCTTGCACTGTGTGCCTGG - Intergenic
1084820349 11:71684689-71684711 GACAGATTGCACTGTGTGTCTGG + Intergenic
1084880774 11:72169972-72169994 GACAGCTTGCACTGTTTGCCTGG + Intergenic
1085588256 11:77732018-77732040 GATAGCTTGCACCGTGTGCTTGG + Intronic
1085651579 11:78273241-78273263 GACAGCTTGCACTGTGTGCCTGG + Intronic
1085881542 11:80473249-80473271 GACATTTTTTTCTTTGTGCTTGG + Intergenic
1086084848 11:82943964-82943986 AACAGCTTGCACTGTGTGCCTGG - Intronic
1086176808 11:83900849-83900871 GACAGCTTGCACTGTGTGCCTGG + Intronic
1086592673 11:88534259-88534281 GACGACTTGCACTGTGTGCCTGG + Intronic
1086933782 11:92722482-92722504 GACAGCTTGCACTGTGTGTCTGG - Intronic
1087708442 11:101521630-101521652 GACAGTTTGCACTGTGAACCTGG + Intronic
1087731154 11:101779791-101779813 GACAGCTTGCACTGTGTGTCTGG + Intronic
1087831685 11:102825971-102825993 GACAGTTTGCACTGTGCACCTGG - Intergenic
1088048418 11:105480816-105480838 GATAGTTTGCACTGTGTGCCTGG + Intergenic
1088175870 11:107051945-107051967 GACAGCTTGCACTGTGTACCTGG + Intergenic
1088443821 11:109901765-109901787 GACAGCTTGCACTGTGTGCCTGG - Intergenic
1088447669 11:109949814-109949836 GACAGTTTGCACCGTGTGCCAGG - Intergenic
1088869574 11:113879427-113879449 GACAGCTTGCACTGTGTGCCCGG - Intergenic
1089429296 11:118408216-118408238 GGCTTTTTGTACTCTGTGCTTGG - Intronic
1090756305 11:129794838-129794860 AACAGCTTGCACTGTGTGCCTGG - Intergenic
1090842814 11:130507585-130507607 GAGAGCTTGCACTGTGTGCCTGG + Intergenic
1091065737 11:132509935-132509957 AACAGCTTGCACTGTGTGCATGG + Intronic
1091552936 12:1550514-1550536 GACAGCTTGTACTGTGTGCCTGG + Intronic
1092093564 12:5823632-5823654 GACAGCTTGCGCTGTGTGCCTGG - Intronic
1092422758 12:8346141-8346163 GACAGCTTGCACTGTGTGCCTGG - Intergenic
1092584698 12:9886989-9887011 GACATTTTGCTCTGTGCTCCGGG - Intronic
1092618142 12:10234307-10234329 GACAGTTTGCAACATGTGCTTGG - Intergenic
1093038013 12:14351556-14351578 GACAGCTTTCACTGTGTGCCTGG - Intergenic
1093207103 12:16264085-16264107 GACAGCTTGCACCGTGTGCCTGG + Intronic
1093363649 12:18264828-18264850 GACACTATGCACTGTGAGCCAGG - Intronic
1093591215 12:20904550-20904572 AACAGCTTGCACTGTGTGCCTGG - Intronic
1093682946 12:22023834-22023856 AACAGCTTGCACTGTGTGCCTGG + Intergenic
1094036932 12:26081797-26081819 AACAGCTTGCACTGTGTGCTTGG - Intergenic
1094130441 12:27069042-27069064 GACATTTGTCACTGTGTCCTTGG + Intergenic
1094421123 12:30272531-30272553 GACAGCTTGCACAGTGTGCCTGG - Intergenic
1095345833 12:41147991-41148013 GACGGTTTGCACTGTGTGCCTGG - Intergenic
1095476571 12:42591862-42591884 GCCTCTTTGGACTGTGTGCTGGG + Intergenic
1096904967 12:54926887-54926909 GACAGCTTGCACTGTGTGCCTGG + Intergenic
1097480389 12:60116901-60116923 GACAATTTGCACTGTGCACCTGG - Intergenic
1098294513 12:68990843-68990865 GACAGCTTGTACTGTGTGCCTGG + Intergenic
1098630962 12:72720971-72720993 GACAGCTTGCACTGTGTGTCTGG + Intergenic
1098774928 12:74600571-74600593 GACAGCTTGCACTGTGGACTTGG + Intergenic
1098836415 12:75429120-75429142 GACAACTTGCACTATGTGCCTGG + Intronic
1099845039 12:88018590-88018612 GACAGCTTGCACCGTGTGCCTGG + Intronic
1100147712 12:91698227-91698249 AACAGTTTGCACCGTGTGCCTGG - Intergenic
1100929082 12:99585453-99585475 GACAGGTTGCACTGTGTGCCTGG - Intronic
1101117781 12:101549038-101549060 TACAGCTTGCACTGTGTGCCTGG - Intergenic
1102211680 12:111131888-111131910 GACAGCTTGCACTGTGAGCCTGG - Intronic
1102248839 12:111372090-111372112 GACAGCTTGCACTGTGTGCCTGG - Intergenic
1102659008 12:114508750-114508772 GACATTTTTCACCATGAGCTGGG + Intergenic
1102758809 12:115367274-115367296 GACAGCTTGCACTGTGTGTCTGG + Intergenic
1103588477 12:121973509-121973531 GACAGCTTGCACTGTTTGCCTGG + Intronic
1104079805 12:125420099-125420121 GACGGCTTGCACTGTGTGCCTGG - Intronic
1104777227 12:131397527-131397549 GACAGCTTGCACTGTGCACTTGG - Intergenic
1105608159 13:21944411-21944433 GACAGTTTGCACTGTGTACCTGG - Intergenic
1105647764 13:22339323-22339345 AACAGCTTGCACTGTGTGCCTGG + Intergenic
1107105322 13:36636759-36636781 GACAGCTTGCACCCTGTGCTTGG - Intergenic
1107234573 13:38153248-38153270 GACAGTTTGCACTGTGCACCTGG - Intergenic
1107290684 13:38849830-38849852 GACATTTTGCTCTGCCTGTTTGG - Intronic
1108421034 13:50249720-50249742 GAAATTTTGCACTGAGTTCAAGG + Intronic
1108603744 13:52016907-52016929 GACAGCTTGCACCGTGTGCCTGG + Intronic
1109076729 13:57845661-57845683 GACAGCTTGCACCGTGTGCCTGG - Intergenic
1109169242 13:59075523-59075545 GACAGTTTGCACTGTGTACCTGG - Intergenic
1110028309 13:70571049-70571071 GACAGCTTGCACCGTGTGCCTGG + Intergenic
1110038461 13:70718431-70718453 GACAGCTTGCACAGTGTGCCTGG + Intergenic
1110250640 13:73377112-73377134 GACAGCTTGCACTGTGTGCCTGG - Intergenic
1110649403 13:77925814-77925836 GACATCTTGCACCGTGCGCCTGG + Intergenic
1111081887 13:83321957-83321979 CACAGCTTGCACTGTGTGCCTGG - Intergenic
1111227071 13:85288396-85288418 AACAACTTGCACTGTGTGCCAGG - Intergenic
1111241617 13:85482242-85482264 GACAGCTTGCACTGTGTACCTGG - Intergenic
1111441364 13:88285907-88285929 GACAGCTTGCACTGTGTACCTGG - Intergenic
1111539294 13:89650294-89650316 AACAGCTTGCACTGTGTGCCTGG - Intergenic
1111737825 13:92164619-92164641 GACAGCTTGCACTGTGTGCCTGG - Intronic
1112163007 13:96888881-96888903 GACAGCTTGCACTGTGTGCCTGG - Intergenic
1112252190 13:97792632-97792654 GACAGCTTGCACCGTGTGCCTGG - Intergenic
1112623669 13:101078324-101078346 GACAGCTTGCACTGTGTGCCTGG + Intronic
1112796597 13:103063648-103063670 GACATTATGCATTGTGTGTTAGG - Intronic
1112855787 13:103768234-103768256 GACAGGTTGCACTGTGTGTCTGG - Intergenic
1113166955 13:107453108-107453130 GACAGATTGGACTGTGTGCCTGG - Intronic
1113645336 13:111990979-111991001 GACAGCTTGCACCATGTGCTTGG + Intergenic
1113892155 13:113742148-113742170 TCCAATATGCACTGTGTGCTTGG + Intergenic
1114081384 14:19203892-19203914 GGCATCTTGCACTCTGTGCCTGG + Intergenic
1114687527 14:24548189-24548211 GACAGCTTGCACTGTGTGCCTGG - Intergenic
1114706979 14:24737443-24737465 GACAGCTTGCACTGTGTGCCTGG - Intergenic
1114871577 14:26665612-26665634 GACAGCTTGCACCGTGTGCCTGG - Intergenic
1114909027 14:27168023-27168045 GACAGCTTGCACTGTTTGCCTGG - Intergenic
1115085750 14:29513042-29513064 GACGGCTTGCACTGTGTGCCTGG - Intergenic
1115277342 14:31622949-31622971 AACAGCTTGCACCGTGTGCTTGG + Intronic
1115944464 14:38644025-38644047 GAAAGCTTGCACTGTGTGCCTGG + Intergenic
1116590076 14:46760998-46761020 GACAGCTTGTACTGTGTGCCTGG - Intergenic
1117385132 14:55204277-55204299 TACATTTTGCATTGTTTGCCAGG - Intergenic
1117758279 14:58998995-58999017 GACAGCTTGCATTGTGTGCCTGG + Intergenic
1117958909 14:61144152-61144174 GATAGTTTGCACCGTGTGCCTGG - Intergenic
1118365023 14:65087345-65087367 GACATCTTGCACTGTGCACCTGG + Intronic
1120123051 14:80705675-80705697 GAGATTTTGCACTGTTACCTGGG + Intronic
1120247874 14:82027501-82027523 GACAGCTTGCACTGTGTGCCTGG - Intergenic
1120417909 14:84243357-84243379 GACAGTTTGCACTGTGCACCTGG - Intergenic
1120590996 14:86373018-86373040 GACAGCTTGCACTGTGTGCCTGG + Intergenic
1120621965 14:86775552-86775574 GACAATTTGCACCCTGTGCCTGG + Intergenic
1122105893 14:99454614-99454636 TACAATGAGCACTGTGTGCTAGG + Intronic
1122266608 14:100549706-100549728 GACATTGTCCACTGTGTGGAGGG - Intronic
1123195883 14:106616135-106616157 GACAGCTTGCACAGTGTGCCTGG - Intergenic
1123197380 14:106629553-106629575 GACAGTTTGCACTTTGTGCCTGG + Intergenic
1123198719 14:106641429-106641451 GACAGTTTGCACTTTGTGCCTGG + Intergenic
1124882014 15:33651646-33651668 TACATTTGGCACTGTGGGGTGGG - Intronic
1125881432 15:43199198-43199220 GACAACTTGCACTGTCTGCCTGG + Intronic
1126399780 15:48257289-48257311 GACAGTTTGCACTGTGCACCTGG - Intronic
1126721922 15:51590781-51590803 CACATTATGCCCTGTGTGCCTGG - Intronic
1127451017 15:59116505-59116527 GTAATTGAGCACTGTGTGCTAGG - Intronic
1127704150 15:61530732-61530754 GGCATTCCTCACTGTGTGCTGGG - Intergenic
1127955247 15:63847468-63847490 GACAGCTTGCACCGTGTGCCTGG + Intergenic
1128478230 15:68015601-68015623 GACATTTTGCAATGAATGATGGG - Intergenic
1130324210 15:82866063-82866085 GACAGTTTGCACCGTGTGCCTGG + Intronic
1130739013 15:86578067-86578089 GACAGCTTGCACCGTGTGCCTGG + Intronic
1131743608 15:95421162-95421184 GACAGCTTGCATTGTGTGCCTGG - Intergenic
1131921484 15:97333101-97333123 GACAGCTTGCACTGTGTGCCTGG + Intergenic
1132122842 15:99192788-99192810 GACAGTTTGCACCGTGTGCCTGG + Intronic
1132399755 15:101498061-101498083 GACAGCCTCCACTGTGTGCTTGG - Intronic
1132440919 15:101863308-101863330 GACAGCTTGCACTGTGTGCCTGG + Intergenic
1133375493 16:5283395-5283417 GACAGCTTGTACTGTGTGCCTGG + Intergenic
1135649827 16:24196434-24196456 GTGGTTTTGCAGTGTGTGCTGGG + Intronic
1135925981 16:26694585-26694607 AACACTTTGCACTGTGTGCTTGG - Intergenic
1136346353 16:29678833-29678855 GGCATTTTGGATGGTGTGCTGGG - Intronic
1136573827 16:31111787-31111809 CAGACTTTGCACTGTCTGCTTGG + Intronic
1137993745 16:53186109-53186131 GACATTTTGCACTGTACGCCTGG + Intronic
1138011150 16:53381497-53381519 GACATTTTTTTCTGTGTGCATGG + Intergenic
1138355863 16:56379915-56379937 GACAGCTTGCACTGTGTGCCTGG - Intronic
1138800072 16:60016461-60016483 GACAGTTTTCATTGTGTGCATGG - Intergenic
1139188259 16:64832805-64832827 AACAGCTTGCACTGTGTGCCTGG + Intergenic
1139926988 16:70494342-70494364 GACATCATGCACTGTGGGCAGGG - Intronic
1141272733 16:82555861-82555883 GACAGCTTGCACTATGTGCTTGG - Intergenic
1142407291 16:89897513-89897535 GATTGTCTGCACTGTGTGCTGGG + Intronic
1143897464 17:10147234-10147256 CACATATTCCACTGTGTGCCTGG + Intronic
1144324753 17:14168363-14168385 GACAGCTTGCACTATGTGCCTGG - Intronic
1144496763 17:15751111-15751133 GAGATTTTATACTATGTGCTTGG + Intergenic
1144538482 17:16114838-16114860 TACAGTTTGCACTGTGTGCCTGG - Intronic
1144606329 17:16668492-16668514 GAGATTTTATACTATGTGCTTGG + Intergenic
1144721791 17:17476267-17476289 GATGTCTTGCACTGTGGGCTGGG + Intergenic
1144904877 17:18633787-18633809 GAGATTTTATACTATGTGCTTGG - Intergenic
1149052662 17:52325402-52325424 GACAGCTTGCACTGTGTGCCTGG - Intergenic
1149216161 17:54357297-54357319 GACAGCTTGCACTGGGTGCCTGG - Intergenic
1149339632 17:55672262-55672284 AACAGCTTGCACTGTGTGCCTGG - Intergenic
1149369398 17:55978233-55978255 GACAGTTTGCACTGTGTGCCTGG - Intergenic
1150350131 17:64437956-64437978 GACAACTTGCACTATGTGCCTGG - Intergenic
1151045715 17:70917531-70917553 GACAATTTGCACCCTGTGCCTGG + Intergenic
1151813093 17:76456573-76456595 GTCATTTGGCATTGTGTTCTGGG - Intronic
1152064011 17:78100150-78100172 GACAGCTTGCACCGTGTGCCTGG - Intronic
1152948261 17:83210282-83210304 GAAGTATTGCGCTGTGTGCTCGG + Intergenic
1152967417 18:129767-129789 GACAGCTTGCACTGTGTGCCTGG - Intergenic
1153011905 18:547119-547141 GACAGTTTGCACCATGTGCCTGG - Intergenic
1153127812 18:1817311-1817333 GAGTCTTTACACTGTGTGCTGGG - Intergenic
1153262939 18:3241712-3241734 GACAACTTGCACTGTGTGCCTGG + Intergenic
1153454979 18:5271102-5271124 GACAGCTTGCACCGTGTGCCTGG - Intergenic
1154926565 18:20942282-20942304 GACAGCTTGCACTGTGTGCCTGG + Intergenic
1155665811 18:28307212-28307234 GACAGCTTGCACCGTGTGCCTGG + Intergenic
1155818597 18:30347459-30347481 CACATCTTGCACTGTGGGCCTGG - Intergenic
1155842847 18:30667940-30667962 AACAGCTTGCACTGTGTGCCTGG - Intergenic
1156784449 18:40893255-40893277 GACAGCTTGCACAGTGTGCCTGG + Intergenic
1156799497 18:41091974-41091996 GAAATGTTGCAATGTGTGATAGG - Intergenic
1156817559 18:41328922-41328944 GTCTGTTTGCACTGTGTGCCTGG + Intergenic
1156941030 18:42767176-42767198 AACATCTTGCACCGTGTGCCTGG + Intronic
1157843030 18:50977129-50977151 GACAGCTTACACTGTGTGCATGG - Intronic
1158177234 18:54670386-54670408 GATGGTTTGCACTGGGTGCTGGG - Intergenic
1159196492 18:65122679-65122701 GACAGCTTGCACTGTCTGCCTGG + Intergenic
1159246148 18:65807925-65807947 GAATTGTTGCCCTGTGTGCTAGG - Intronic
1159261283 18:66016180-66016202 GACAGCTTGCACTATGTGCCTGG - Intergenic
1159481497 18:68995836-68995858 GACAGCTTGAACCGTGTGCTTGG + Intronic
1159617578 18:70598953-70598975 GACAGCTTGCACCGTGTGCCTGG + Intergenic
1159697301 18:71575774-71575796 GACAGTTTGCACTGTGTGCCTGG - Intergenic
1159805804 18:72957294-72957316 GACAGCTTGCCCTGTGTGCCTGG - Intergenic
1160396294 18:78574683-78574705 GACAGCTTGCACTGTGTGCCTGG + Intergenic
1160627146 18:80218594-80218616 GACAGCTTGCACTGTGCGCCTGG - Intronic
1160644060 19:170150-170172 GACAGCTTGCACTGTGTGCCTGG - Intergenic
1161977387 19:7613902-7613924 GCCATTTTGCACTGAGTGGTCGG + Intronic
1162002786 19:7757991-7758013 GACAGCTTGCACCGTGTGCCTGG + Intergenic
1162143996 19:8602016-8602038 TGCAATTTGAACTGTGTGCTTGG + Intronic
1163221901 19:15927697-15927719 GAGATATGTCACTGTGTGCTGGG - Intronic
1164128853 19:22343569-22343591 GACAATTCTCACTGTTTGCTGGG - Intergenic
1165067783 19:33239150-33239172 CAGATCTTGCAGTGTGTGCTGGG - Intergenic
925264085 2:2552453-2552475 GACAGCTTGCACTTTGTGCCTGG - Intergenic
925354452 2:3228113-3228135 AACAGCTTGCACTGTGTGCCTGG + Intronic
925524774 2:4787675-4787697 GACAGCTTGCACAGTGTGCCAGG - Intergenic
925769057 2:7264846-7264868 GACATTTTAGAATATGTGCTAGG + Intergenic
927030537 2:19116689-19116711 AACAGCTTGCACTGTGTGCCTGG - Intergenic
927415407 2:22874226-22874248 TACATTTTGCAAAGTGTGTTTGG - Intergenic
927438175 2:23088445-23088467 GACAGCTTGCACCGTGTGCCTGG - Intergenic
927684649 2:25161855-25161877 GACACTGTGCCCTGTGTCCTCGG - Intronic
928313510 2:30229831-30229853 GACATTTTCCTCTGAGTGCCTGG + Intergenic
928582780 2:32725642-32725664 GACATCTTGCACCGTGTGCCTGG - Intronic
928680096 2:33692825-33692847 GACAGCTTGCACTGTATGCCTGG - Intergenic
929211215 2:39359454-39359476 GACAGCTTGCACTGTGTGCCTGG - Intronic
929612873 2:43284730-43284752 GACAGCTTGCACTGTGTGCCTGG + Intronic
929770984 2:44891859-44891881 GACAGCTTGCACTGTGTTCCTGG - Intergenic
930263155 2:49170481-49170503 GACAGCTTGCACTGTGCGCCTGG + Intergenic
930310329 2:49732030-49732052 GACAACTTGCACTGTATGCCTGG - Intergenic
930427807 2:51233974-51233996 GACAGCTTGCACCGTGTGCCTGG - Intergenic
932317975 2:70798828-70798850 TACACCTTGCACTGTGTGCCTGG - Intergenic
932552437 2:72785276-72785298 GACAGCTTGCACTGTGTGCCTGG - Intronic
932904365 2:75733654-75733676 AACAGCTTGCACTGTGTGCCTGG - Intergenic
932912233 2:75818121-75818143 AACATCTTGCACTGTGTGCCTGG - Intergenic
932923342 2:75942205-75942227 GACAGCTTGCACTGTGTGCCCGG + Intergenic
932956532 2:76357428-76357450 GACAGCTTGCACGGTGTGCCTGG + Intergenic
932960679 2:76409115-76409137 GACAACTTGCACTTTGTGCCTGG + Intergenic
932970229 2:76532177-76532199 GACATTTTGAAATGTGTTCAAGG - Intergenic
933396259 2:81735331-81735353 AACATTTTCCAGTGTGTGCATGG + Intergenic
933487651 2:82943824-82943846 GACATGTTTCATTGTGTGTTGGG + Intergenic
934524299 2:95042166-95042188 GACATTTTGCACTGAGAGGCTGG + Intronic
935324986 2:101927746-101927768 GGCAGCTTGCACTCTGTGCTTGG + Intergenic
935448904 2:103187503-103187525 GACAGTTTGCACTGCATGCCTGG + Intergenic
935858951 2:107306166-107306188 GCCACTTTGCGGTGTGTGCTCGG - Intergenic
936543870 2:113373735-113373757 GACAGCTTGCACCGTGTGCCTGG - Intergenic
936890654 2:117366187-117366209 GACAGCTTGCACTATGTGCCTGG - Intergenic
936969672 2:118165008-118165030 GACAGCTTGCACTGTGTGCCTGG + Intergenic
937008956 2:118544379-118544401 GACAGCTTGCACCGTGTGCCTGG + Intergenic
937380792 2:121374527-121374549 AACAGCTTGCACTGTGTGCCTGG + Intronic
937427695 2:121813708-121813730 GACAGCTTGCACCGTGTGCCTGG + Intergenic
937546333 2:123025633-123025655 AACATTCTGAACTGTGTTCTGGG + Intergenic
937547102 2:123036101-123036123 GACAGCTTGCACTATGTGCCTGG - Intergenic
937620594 2:123980626-123980648 GACAACCTGCACTGTGTGCCTGG + Intergenic
937761103 2:125604338-125604360 GACAACTTGCACTCTGTGCCTGG + Intergenic
938010986 2:127828761-127828783 GACAGCTTGCACTGTGTGCCTGG + Intergenic
938544456 2:132315129-132315151 GACAGCTTGCACCGTGTGCCTGG - Intergenic
938686338 2:133741973-133741995 GACAGCTTGCACTGTGTACCTGG - Intergenic
938868813 2:135452831-135452853 GACAGCCTGCACTGTGTGCCTGG - Intronic
939079222 2:137639569-137639591 GACAGCTTGCACCGTGTGCCTGG + Intronic
939092022 2:137790883-137790905 GACAGCTTGCACTGTGCACTTGG - Intergenic
939128385 2:138204863-138204885 GACAGCTTGCACTGTGTGCCTGG - Intergenic
939153025 2:138495288-138495310 GACATTTTCCAGTGTTTGATAGG + Intergenic
939272657 2:139960173-139960195 TACAGCTTGCACTGTGTGCCTGG + Intergenic
939445936 2:142310294-142310316 GACATCTTGCACTGTGCACCTGG - Intergenic
939844429 2:147226072-147226094 GACATTTAGCACTGAGCGTTAGG - Intergenic
939847750 2:147268701-147268723 GACAGCTTGCACTGTGTGCCTGG - Intergenic
940355597 2:152738299-152738321 GACAGCTTGCACTATGTGCCTGG - Intronic
940501994 2:154504722-154504744 GACAGCTTGCAGTGTGTGCCTGG + Intergenic
941227183 2:162864873-162864895 GACTTCTTGCACTGTGTACCTGG - Intergenic
941307730 2:163892071-163892093 GACAGCTTGCACCGTGTGCCTGG - Intergenic
941430584 2:165409235-165409257 GACAGCCTGCACTGTGTGCCTGG + Intergenic
941490664 2:166138794-166138816 GACAGCTTGCACTGTGTTCCTGG + Intergenic
941535943 2:166722639-166722661 GACAACTTGCACTGTGTACCTGG - Intergenic
941560331 2:167036249-167036271 GACAGCTTGCACTGTGTGCCTGG + Intronic
941578788 2:167268853-167268875 GACAGCTTGCACTGTGTTCCTGG + Intergenic
941832557 2:169978346-169978368 GACATTTTGCTCTCTGTTGTAGG + Intronic
942238868 2:173940457-173940479 TACTTTTTGCACTGTGGCCTTGG + Intronic
942281066 2:174364380-174364402 GACAGCTTGCACAGTGTGCCTGG - Intronic
942517974 2:176773389-176773411 GACAGCTTGCACTGTGTGCCTGG + Intergenic
942829749 2:180225485-180225507 GACAGCTTGAACTGTGTGCCTGG + Intergenic
942904698 2:181166697-181166719 GACAGCTTGCACTGTGTGCCTGG - Intergenic
943072152 2:183153717-183153739 GACAGCTTGCACTCTGTGCCTGG - Intronic
943124804 2:183782986-183783008 GACAGCTTGCACTGTGAGCCTGG + Intergenic
943205254 2:184886392-184886414 GACAACTTGCACTGTGTGCCTGG - Intronic
943423361 2:187698002-187698024 GACAGCTTGCACTGTATGCCTGG + Intergenic
944827953 2:203504073-203504095 GACAGCTTGCACTGTGCACTTGG - Intronic
945089663 2:206167035-206167057 GAGATTTTGCAGTGTGTGTTTGG + Intergenic
945457134 2:210063450-210063472 GACAGCTTGCACTGTGTGCCCGG + Intronic
945657207 2:212639423-212639445 GGAATTTTTCACTGTGTGCAAGG - Intergenic
945730286 2:213524466-213524488 GACAGTTTTCCCTGTGTGCCTGG + Intronic
945767002 2:213993310-213993332 AATATTTTGCACTGTGTGACTGG - Intronic
946108209 2:217390746-217390768 GACAGCTTGCACTGTGTGCCTGG - Intronic
946543948 2:220716096-220716118 AACAGCTTGCACTGTGTGCCTGG - Intergenic
946562175 2:220926025-220926047 GACAGTTTGCGCTGTGTGCCTGG - Intergenic
946635857 2:221724739-221724761 AACAGCTTGCACTGTGTGCCTGG + Intergenic
947083708 2:226427404-226427426 CACATTTTACATTGTGTCCTAGG - Intergenic
947276250 2:228395763-228395785 GACAGCTTGAACTGTGTGCCTGG - Intergenic
948104277 2:235400534-235400556 TACAGCTTGCACTGTGTGCCTGG + Intergenic
948148331 2:235725056-235725078 GGGATTTTCCACTGTGTGTTTGG + Intronic
1169143070 20:3236948-3236970 GACATGGGGCTCTGTGTGCTAGG - Intronic
1169999198 20:11596290-11596312 GACAGCTTGCACTGTGTGGCTGG - Intergenic
1170337049 20:15281724-15281746 GACAGCTTGCACTGTGGGCCTGG - Intronic
1170514427 20:17113901-17113923 GACATTCTGCATTGTATCCTGGG + Intergenic
1170741865 20:19065409-19065431 GACAGCATGCACTGTGTGCCTGG + Intergenic
1171873321 20:30547865-30547887 GACAGCTTGCACCGTGTGCCTGG - Intergenic
1172720289 20:36994816-36994838 GATAGCTTGCACTGTGTGCCTGG + Intergenic
1172921515 20:38486885-38486907 GTCAATGTCCACTGTGTGCTAGG + Intronic
1173263924 20:41460869-41460891 GACAGTTCGCACTGTGTGCCTGG + Intronic
1174965354 20:55208035-55208057 GACAGCTTGCACTGTGTGCCTGG + Intergenic
1176696034 21:9978759-9978781 GACAGCTTGCACCGTGTGCATGG + Intergenic
1177067988 21:16464293-16464315 GACAGCTTGCACTGTGTGCCTGG + Intergenic
1177169535 21:17640315-17640337 AACAGCTTGCACTGTGTGCCTGG - Intergenic
1177319148 21:19497639-19497661 GACAATGTGGAGTGTGTGCTGGG - Intergenic
1177478198 21:21651326-21651348 GACAGCTTGCACTGTGAGCCTGG + Intergenic
1177487449 21:21777804-21777826 GACAGCTTGCACTGTGTGCCTGG - Intergenic
1177517697 21:22176725-22176747 GGCAGCTTGCACTATGTGCTTGG + Intergenic
1177577384 21:22976035-22976057 GACAGCTTGCACTGTGCTCTTGG - Intergenic
1177761077 21:25402659-25402681 GATAGTTTGCACTGTTTGCCTGG + Intergenic
1177881644 21:26702160-26702182 GACATCTTGCACTGTGTGCCTGG - Intergenic
1178013743 21:28318134-28318156 GACAGCTTGCACTGTGAGCTTGG + Intergenic
1178207523 21:30486813-30486835 GACAGCTTCCACTGTGTGCCAGG + Intronic
1179376618 21:40854750-40854772 GATCTTTTGCTCTGCGTGCTGGG - Intergenic
1180251436 21:46592692-46592714 GACAGCTTGCACTGTGGGCCTGG + Intergenic
1180499390 22:15918794-15918816 GGCATCTTGCACTCTGTGCCTGG - Intergenic
1183674573 22:39292257-39292279 GACAATGGGCACTGTGTGCGGGG - Intergenic
1184934027 22:47705807-47705829 GACAGTTTGCTCTGTGTGGCAGG + Intergenic
1185199693 22:49494147-49494169 GACACCTTGACCTGTGTGCTTGG + Intronic
949436345 3:4033594-4033616 GAGATTTTACTCTGTGTGCTGGG - Intronic
949635928 3:5981469-5981491 TACAGCTTGCACTGTGTGCCTGG - Intergenic
949673262 3:6424388-6424410 AACAACTTGCACTGTGTGCCTGG - Intergenic
949692338 3:6654704-6654726 AACAACTTGCACTGTGTGCCTGG - Intergenic
949721786 3:6998431-6998453 GACAGCTTGCACTGTGTGCCTGG - Intronic
949768423 3:7552341-7552363 AACAGTTTGCATTGTGTGCCTGG - Intronic
950178994 3:10897706-10897728 GACAGTTTGCACCATGTGCCTGG - Intronic
950824218 3:15799647-15799669 GAGATTTTGCTTTGTGGGCTTGG - Intronic
950913251 3:16616676-16616698 GACAGCTTGCACTGTGTTCCTGG + Intronic
950972500 3:17203027-17203049 GACAGCTTGTACTGTGTGCCTGG + Intronic
951192554 3:19786955-19786977 GACAGCTTGTACTGTGTGCCTGG + Intergenic
951324611 3:21286781-21286803 GACAGCTTGTACTGTGTGCCTGG + Intergenic
951452163 3:22852122-22852144 GACAGCTTGCACTGTGCGCCTGG - Intergenic
951773456 3:26283632-26283654 AACAGCTTGCACTGTGTGCCTGG - Intergenic
952504485 3:33995631-33995653 GACAGTTTGCACTGTGCACCTGG - Intergenic
952715032 3:36471858-36471880 GACAGCTTGCACCGTGTGCCTGG - Intronic
952939668 3:38432869-38432891 GACAGCTTGCACCGTGTGCCTGG - Intergenic
953185013 3:40629612-40629634 GACAGCTTGTACTGTGTGCCTGG + Intergenic
954591615 3:51788160-51788182 GGCAACTTGCACTGTTTGCTTGG + Intergenic
955435436 3:58894620-58894642 GACAGCTTGCACTGTGTGCCTGG - Intronic
956474999 3:69610286-69610308 GACACCTCGCACTGTGTGCTTGG + Intergenic
956714136 3:72063431-72063453 GACAGCTTGCACCGTGTGCCTGG - Intergenic
957066569 3:75527780-75527802 GACAACTTGCACTGTGTGCCTGG - Intergenic
957557484 3:81780574-81780596 GACAGCTTGCACTGTGTGCCTGG - Intergenic
957693026 3:83596505-83596527 GACAGCTTGCATTGTGTGCTTGG + Intergenic
957868065 3:86050397-86050419 GACAGCTTGTACTGTGTGCCTGG - Intronic
957870829 3:86089159-86089181 GACAGCTTGCACTGTGTGCCTGG - Intergenic
958006086 3:87813151-87813173 AACAACTTGCACTGTGTGCCTGG + Intergenic
958042647 3:88244985-88245007 GACCGCTTGCACTGTGTGCCTGG + Intergenic
958083797 3:88780420-88780442 GACAGCTTGCACTGTGCACTCGG - Intergenic
958160099 3:89808390-89808412 GACAGCTTGCACTGTGTACCTGG - Intergenic
958550543 3:95607033-95607055 AACAGCTTGCACTGTGTGCCTGG - Intergenic
958685380 3:97386630-97386652 GACAGTTTGTACTGTGTGCCTGG - Intronic
958754564 3:98234968-98234990 GACAGCTTGCACTGTGTGCCTGG + Intergenic
958836278 3:99148533-99148555 GACAGCTTGCACTGAGTGCCTGG + Intergenic
958956427 3:100469758-100469780 GACAGCTTGCACTGTGTGCCTGG - Intergenic
959299385 3:104578555-104578577 GACATTTAGCACTGTGTACCTGG - Intergenic
959381002 3:105641440-105641462 GACAGCTTGCACCGTGTGCCTGG - Intergenic
959406925 3:105971761-105971783 GACAGCTTGCACTGTGCACTTGG - Intergenic
959439857 3:106361653-106361675 GACAGCTTGCACTGTGTGCCTGG + Intergenic
959575690 3:107930851-107930873 CAAATTTTGTACAGTGTGCTTGG - Intergenic
959790345 3:110353586-110353608 GAAATTGTGTACTCTGTGCTGGG - Intergenic
959894061 3:111587303-111587325 AACAGCTTGCACTGTGTGCCTGG - Intronic
959894085 3:111587488-111587510 GACAGCTTGCACTGTGTGCCTGG - Intronic
960285651 3:115825580-115825602 GATATTATGTACTGTGTGGTAGG - Intronic
960341413 3:116479320-116479342 GACAGCTTGCACCGTGTGCCTGG + Intronic
960405571 3:117254904-117254926 GCCACTTTGTGCTGTGTGCTGGG + Intergenic
960494182 3:118355175-118355197 GACAGTTTGCACTGTGCACTTGG + Intergenic
960706359 3:120485846-120485868 GACCTATTGCACTGTATGATAGG - Intergenic
961286583 3:125810268-125810290 GACAGCTTGCACTGTGTGCCTGG + Intergenic
961441008 3:126953141-126953163 GTCACTTTCCACTGTGTGGTCGG - Intronic
961900190 3:130202697-130202719 GACAGCTTGCGCTGTGTGCCTGG - Intergenic
962170749 3:133098888-133098910 GACAGCTTGCACTGTGTGCCTGG - Intronic
963379248 3:144507244-144507266 GACAGCTTGCACCATGTGCTTGG - Intergenic
963404379 3:144843991-144844013 GACAGCTTGCACTGTGAGCCTGG - Intergenic
963418389 3:145027875-145027897 GACAGCTTGCACTGTGTACCTGG + Intergenic
964098551 3:152962453-152962475 GACAGCGTGCACTGTGTGCCTGG - Intergenic
964275535 3:155005032-155005054 GACAGCTTGCACTGTGTGCCTGG + Intergenic
964324777 3:155534137-155534159 GACAGCTTGCACTGTGTGCCTGG + Intronic
964978459 3:162647907-162647929 AACAGCTTGCACTGTGTGCCTGG + Intergenic
965025062 3:163291515-163291537 GACAGCTTGCACTATGTGCCTGG - Intergenic
965052050 3:163663481-163663503 AACATCTTGCACTGTGTGCCTGG + Intergenic
965066673 3:163858301-163858323 GACAGCTTGCACAGTGTGCCTGG + Intergenic
965067808 3:163874915-163874937 GACAGCTTGCACGGTGTGCCTGG + Intergenic
965363093 3:167765067-167765089 GATAGCTTGCACTGTGTGCCTGG - Intronic
965931059 3:174043729-174043751 AACAGCTTGCACTGTGTGCCTGG - Intronic
966323762 3:178731427-178731449 GACATTTGGCAGTGTCTGATAGG - Intronic
966446529 3:180007415-180007437 GACAGCTTGCACTGTGTGCCTGG - Intronic
966733311 3:183168516-183168538 GACAGCTTGCACTGGGTGCCTGG - Intergenic
966742026 3:183242789-183242811 AACAGTTTGCACCATGTGCTTGG + Intronic
967406234 3:189118994-189119016 TACAGCTTGCACTGTGTGCCTGG + Intronic
967462254 3:189760623-189760645 GACTGCTTGCACTGTGTGCCTGG - Intronic
967564696 3:190959753-190959775 GACAGCTTGCACTGTGTACCTGG + Intergenic
967567445 3:190988716-190988738 GACAGTTTGCATTGTGTGCCTGG + Intergenic
967609200 3:191483496-191483518 GACAGCTTGCACTGTGTGCCTGG + Intergenic
967689580 3:192458308-192458330 GACAGCTTGCACTGTGTGCCTGG + Intronic
967776975 3:193395098-193395120 GACAACTTGCACTGTGAGCCTGG - Intergenic
968354530 3:198093983-198094005 GACAGCTTGCACTGTGTTCCTGG - Intergenic
968669585 4:1841938-1841960 GACGTTTTGCACTGCCCGCTGGG + Intronic
969011162 4:4063847-4063869 GACAGCTTGCACTGTGTGCCTGG - Intergenic
969108017 4:4822603-4822625 GACAGCTTGCACCGTGTGCCTGG + Intergenic
969163168 4:5279524-5279546 GACAGCTTGCACTGTGTACCTGG - Intronic
969167114 4:5325376-5325398 CTCTTTTTGCTCTGTGTGCTGGG + Intronic
969742907 4:9046051-9046073 GACAGCTTGCACTGTGTGACTGG + Intergenic
969802284 4:9578130-9578152 GACAGCTTGCACTGTGTGCCTGG + Intergenic
969960541 4:10940496-10940518 GACAGCTTGCACTGTGTGCCTGG + Intergenic
970036219 4:11738589-11738611 GACAGCTTGCACCATGTGCTTGG + Intergenic
970100413 4:12515000-12515022 AACAGCTTGCACTGTGTGCCTGG + Intergenic
970312648 4:14798643-14798665 AACAGCTTGCACTGTGTGCCTGG - Intergenic
970357450 4:15269798-15269820 GACAGTTTGCACTGTGCACCTGG + Intergenic
970382081 4:15518448-15518470 GACAGCTTGCACTGTGTACCTGG - Intronic
970554180 4:17214939-17214961 AACAGTTTGCACCGTGTGCCTGG - Intergenic
970577685 4:17443974-17443996 GACAGCTTGCACAGTGTGCCTGG - Intergenic
970663543 4:18312156-18312178 GACAGTTTGCACTGTGCACCTGG - Intergenic
970763316 4:19517296-19517318 GACAGCTTGCACTGTGTGCCTGG + Intergenic
970987596 4:22176528-22176550 TACCTCTTGCACTGTGTGCCTGG - Intergenic
971010714 4:22431245-22431267 AACAGCTTGCACTGTGTGCCTGG + Intronic
971288868 4:25317074-25317096 GACATTGTACAGTATGTGCTGGG + Intronic
971440496 4:26679651-26679673 AACAGCTTGCACTGTGTGCCTGG + Intronic
971687414 4:29787257-29787279 GACAGCTTGCACTGTGTGCCTGG - Intergenic
971744875 4:30566658-30566680 GACAGCTTGCACTGTGTGCCTGG + Intergenic
971832329 4:31711903-31711925 TACATTTTGCTCTGTGTCCGTGG + Intergenic
971912307 4:32810083-32810105 GACAGCTTCCACTGTGTGCCTGG - Intergenic
972200005 4:36702986-36703008 GACAGCTTGCACTGTGTGCCTGG + Intergenic
972301873 4:37792364-37792386 TACAGTTTGCACCATGTGCTTGG + Intergenic
972485230 4:39534167-39534189 GACAGCTTGCACCGTGTGCCTGG + Intergenic
972792823 4:42389354-42389376 TACATTGTGAACTGTGTGCTTGG - Intergenic
973032556 4:45361954-45361976 GACAGCTTGCACTGTGTACCTGG + Intergenic
973035164 4:45397024-45397046 GACAGCTTGCACCGTGTGCCTGG - Intergenic
974037279 4:56827937-56827959 GACAGCTTGCACTGTGTGCCTGG + Intergenic
974086708 4:57269106-57269128 GACATTTAAAACTGTATGCTGGG - Intergenic
974394980 4:61322798-61322820 GACAGCTTGCACCGTGTGCCTGG - Intronic
974563425 4:63552872-63552894 GACAGCTTGCACTGTATGCTTGG - Intergenic
974606297 4:64156527-64156549 GACAGCTTGCACTGTGTACCTGG - Intergenic
974679820 4:65146708-65146730 GACAGCTTGCACTGTTTGCCTGG - Intergenic
974716913 4:65679258-65679280 GACAGCTTGCACTGTGTTCCTGG + Intergenic
974725561 4:65794484-65794506 GACAGCTTGCACTGTGCACTTGG - Intergenic
974915540 4:68173864-68173886 GACAGCTTGCACCGTGTGCCTGG + Intergenic
975186561 4:71410245-71410267 CACAGCTTGCACTGTGTGCCTGG + Intronic
975204015 4:71623855-71623877 GACATCTTGCATTGTGTGACTGG - Intergenic
975627038 4:76360423-76360445 GACAGCTTGCACTATGTGCCTGG + Intronic
976243036 4:82978600-82978622 TACAGTGTTCACTGTGTGCTAGG - Intronic
976287521 4:83384835-83384857 GACAGTTTGCACTGTGTGCCTGG - Intergenic
976412831 4:84736264-84736286 GATAATTTGGACTGTGTGGTGGG + Exonic
976801081 4:88992617-88992639 GACATTTTGGGGTGTATGCTGGG - Intronic
977050169 4:92119540-92119562 GACAGCTTGCACTGTGTGCCTGG + Intergenic
977592521 4:98842392-98842414 AACAGCTTGCACTGTGTGCATGG + Intergenic
978402528 4:108345869-108345891 GTACTTTTGCAGTGTGTGCTTGG + Intergenic
978591553 4:110329740-110329762 GACATATGGCACTATGTCCTGGG - Intergenic
978774305 4:112490574-112490596 AACAGCTTGCACTGTGTGCCTGG - Intergenic
978809791 4:112837531-112837553 AACAGCTTGCACTGTGTGCCTGG + Intronic
978928013 4:114273921-114273943 GGGATTTTGCACTGTGCACTGGG + Intergenic
979006767 4:115308959-115308981 GACAACTTGCACTGTGTTCCTGG + Intergenic
979078436 4:116303918-116303940 AACAGCTTGCACTGTGTGCCTGG + Intergenic
979367974 4:119848088-119848110 GGCAGTTTGCACTGTGAGCCTGG - Intergenic
979721503 4:123905453-123905475 GACAGCTTGCACTGTGTGCCTGG + Intergenic
979862694 4:125714106-125714128 CAGATTTTGCACTTAGTGCTTGG + Intergenic
980057507 4:128093050-128093072 GACATTTTGCTCAGTGTCCTAGG - Intronic
980064979 4:128177061-128177083 GTCATTTTCCACTTTGTTCTTGG - Intronic
980202810 4:129677526-129677548 GGCATTTTGCACCATGTGCCTGG + Intergenic
980242181 4:130191210-130191232 GACAGCTTGCACTGTGTGCCTGG - Intergenic
980346886 4:131633476-131633498 AACAGCTTGCACTGTGTGCCTGG + Intergenic
980368649 4:131838987-131839009 GACAGCTTGCACTGTGTGCATGG + Intergenic
980525657 4:133988658-133988680 GACAACTTGCACTGTGTTCCTGG - Intergenic
980707581 4:136519834-136519856 CACAGCTTGCACTGTGTGCTTGG - Intergenic
980741889 4:136961698-136961720 TATATTTTCTACTGTGTGCTTGG - Intergenic
980767061 4:137320873-137320895 GACAGTTTGTACCGTGTGCTTGG - Intergenic
980846710 4:138333156-138333178 AACAGCTTGCACTGTGTGCCTGG - Intergenic
981370433 4:143952913-143952935 GACAGCTTGCACTGTGTACCTGG + Intergenic
981643080 4:146967504-146967526 TACAGTTTGCACTGTGTGCCTGG + Intergenic
981737652 4:147969933-147969955 CAGATTCTTCACTGTGTGCTTGG + Intronic
981795416 4:148589802-148589824 GACATCTTTCACTGTATGCCTGG + Intergenic
981914109 4:150015348-150015370 GACAGCTTGCACTGTGTGCCTGG - Intergenic
982076054 4:151738098-151738120 GACAGTTTGCACTGTGTGCCTGG + Intronic
982504514 4:156199461-156199483 TACAATTTGAACTGTGTGCTAGG - Intergenic
982524930 4:156466584-156466606 GACAGCTTACACTGTGTGCCTGG - Intergenic
982717117 4:158820695-158820717 GACAGTTATCACTGGGTGCTTGG - Intronic
983132808 4:164043076-164043098 GACAGCTTGCACTATGTGCCTGG - Intronic
983337466 4:166415615-166415637 GACAGCTTGCACTGTTTGCTTGG - Intergenic
983393958 4:167169255-167169277 GACAGCTTGCAATGTGTGCTTGG + Intronic
983478301 4:168242345-168242367 GACAGCTTGCGCTGTGTGCCCGG + Intronic
983665526 4:170177300-170177322 GACAACTTGCACTGTGTACCTGG + Intergenic
984026365 4:174547848-174547870 GACAGCTTGCACCGTGTGCCTGG + Intergenic
985852985 5:2402336-2402358 GACAGCTTGCACTGTGTGCCTGG + Intergenic
986081077 5:4394861-4394883 GACAGCTTGCACAGTGTGCCTGG - Intergenic
986113888 5:4750385-4750407 GACACCTTGCACCATGTGCTTGG - Intergenic
986983487 5:13475189-13475211 GACAGCTTGCATTGTGTGCCTGG + Intergenic
987260350 5:16196243-16196265 GACATCTTGCACCATGTGCCTGG - Intergenic
987464252 5:18253160-18253182 TACAGCTTGCACTGTGTGCCTGG + Intergenic
987510358 5:18829030-18829052 GACAGTTTGCACTGTGTGCCTGG + Intergenic
987602049 5:20084441-20084463 GACAGCTTGCACTGTATGCCTGG - Intronic
987697773 5:21354773-21354795 GACAGCTTGCACAGTGTGCCTGG - Intergenic
987708993 5:21485756-21485778 GACAGCTTGCACTGTGTGCCTGG - Intergenic
987881279 5:23749433-23749455 GACAGGTTGCACTGGGTGCCTGG - Intergenic
988040894 5:25888024-25888046 GACAGCTTGCATTGTGTGCCTGG - Intergenic
988150008 5:27364926-27364948 GACAGCTTGCACAGTGTGCCTGG + Intergenic
988398216 5:30725072-30725094 TACATTCTGCATTCTGTGCTGGG + Intergenic
988400504 5:30754494-30754516 GACAGCTTGCACTGTGTACCTGG + Intergenic
988471877 5:31547336-31547358 GACAGCTTGTACTGTGTGCCTGG - Intronic
988750620 5:34188390-34188412 GACAGCTTGCACTGTGTGCCTGG + Intergenic
988754462 5:34231921-34231943 GACAGCTTGCACAGTGTGCCTGG + Intergenic
988886444 5:35563456-35563478 GACAGCTTGCACTGTGTGCCTGG + Intergenic
989067753 5:37481164-37481186 GACTGCTTGCACTGTGTGCCTGG - Intronic
989662670 5:43816118-43816140 GACAACTTGCACTGTGTGCCTGG + Intergenic
989753455 5:44922914-44922936 CACAGCTTGCACTGTGTGCCTGG + Intergenic
989767491 5:45104174-45104196 GACAGCTTGCACCGTGTACTTGG + Intergenic
990021169 5:51128867-51128889 GACAGCTTGCACTGTGTGCCTGG + Intergenic
990075701 5:51843680-51843702 GACAGCTTGCACTGTGTGTCTGG - Intergenic
990093369 5:52082993-52083015 AACAGCTTGCACTGTGTGCCTGG - Intergenic
990595603 5:57309643-57309665 TACAACTTGCACTGTGTGCCTGG + Intergenic
990701030 5:58475200-58475222 GACAGTTTGCACCATGTGCCTGG - Intergenic
990883709 5:60568668-60568690 GACAGCTTGCTCTGTGTGCCTGG - Intergenic
991738891 5:69651604-69651626 GACAGCTTGCACTGTGTGCCTGG + Intergenic
991742672 5:69697614-69697636 GACAGCTTGCACAGTGTGCCTGG + Intergenic
991755022 5:69857590-69857612 GACAGCTTGCACAGTGTGCCTGG - Intergenic
991759307 5:69904827-69904849 GACAGCTTGCACTGTGTGCCTGG - Intergenic
991788029 5:70213295-70213317 GACAGCTTGCACTGTGTGCCTGG + Intergenic
991790466 5:70231345-70231367 GACAGCTTGCACTGTGTGCCTGG + Intergenic
991794245 5:70277352-70277374 GACAGCTTGCACAGTGTGCCTGG + Intergenic
991812257 5:70485955-70485977 GACAGCTTGCACTGTGTGCCTGG + Intergenic
991815216 5:70506432-70506454 GACAGCTTGCACTGTGTGCCTGG + Intergenic
991818352 5:70527721-70527743 GACAGCTTGCACTGTGTGCCTGG + Intergenic
991822062 5:70572927-70572949 GACAGCTTGCACAGTGTGCCTGG + Intergenic
991834349 5:70732738-70732760 GACAGCTTGCACAGTGTGCCTGG - Intergenic
991838536 5:70779893-70779915 GACAGCTTGCACTGTGTGCCTGG - Intergenic
991880476 5:71213659-71213681 GACAGCTTGCACTGTGTGCCTGG + Intergenic
991882913 5:71231680-71231702 GACAGCTTGCACTGTGTGCCTGG + Intergenic
991886624 5:71276894-71276916 GACAGCTTGCACGGTGTGCCTGG + Intergenic
992138136 5:73768302-73768324 GACAGCTTGCGCTGTGTGCCTGG + Intronic
992215884 5:74524298-74524320 GACAGCTTGCACTGTGTGCCTGG + Intergenic
992817863 5:80463054-80463076 AACAGCTTGCACTGTGTGCTTGG - Intronic
993037014 5:82769559-82769581 GACAGCTTGCACCGTGTGCCTGG + Intergenic
993098216 5:83505613-83505635 GACAGCTTGCACTGTGTGCCCGG - Intronic
993456261 5:88130971-88130993 AACAGCTTGCACTATGTGCTTGG - Intergenic
993481566 5:88430766-88430788 AACATGTTGCACTGTGTGCCTGG - Intergenic
993590578 5:89790451-89790473 GACAGCTTGCACTATGTGCCTGG - Intergenic
993690759 5:90996678-90996700 GACAGTTTGCACCATGTGCCTGG + Intronic
993743271 5:91565127-91565149 AACAGCTTGCACTGTGTGCCTGG - Intergenic
993945956 5:94116961-94116983 GACAGCTTGCACCGTGTGCCTGG + Intergenic
994421113 5:99527100-99527122 GACAGCTTGCACTGTGTGCCTGG - Intergenic
994485927 5:100387214-100387236 GACAGCCTGCACTGTGTGCCTGG + Intergenic
994553210 5:101262512-101262534 GACAGCTTGCACTGTGTGCCTGG + Intergenic
994592401 5:101789448-101789470 GACAGTTTGCACCGTGAGCCTGG + Intergenic
994808292 5:104479617-104479639 GACAGCTTGCACTGTGTGCCTGG + Intergenic
995147821 5:108806469-108806491 GACAGCCTGCACTGTGTGCCTGG + Intronic
995283228 5:110358197-110358219 GACAGGCTGCACTGTGTGCCTGG + Intronic
995477629 5:112563792-112563814 AACAGCTTGCACTGTGTGCCTGG + Intergenic
995842392 5:116455152-116455174 TTCATTTTTCCCTGTGTGCTGGG + Intronic
995872413 5:116756800-116756822 GACAGCTTGCACTGTGAGCCTGG + Intergenic
996026974 5:118657366-118657388 GACATCTTGCACTATGTGCCTGG - Intergenic
996071533 5:119137009-119137031 GACAGTTTGCACCATGTGCCTGG + Intronic
996180006 5:120407387-120407409 GACAGCTTGCACTGTATGCCTGG + Intergenic
996361392 5:122651002-122651024 GTCATTTTGCACTATACGCTAGG - Intergenic
996499793 5:124203918-124203940 GACAGCTTGCACTGTGCACTTGG + Intergenic
997091526 5:130864339-130864361 GACAGATTGCACTGTATGCCTGG - Intergenic
997102032 5:130980299-130980321 GACAGCTTGCACTGCGTGCCTGG - Intergenic
997491836 5:134284127-134284149 GACTGCTTGCACTGTGTGCCTGG - Intergenic
998758998 5:145411603-145411625 GACAGCTTGCACTGTGTGCCTGG - Intergenic
998889398 5:146729997-146730019 GACAGTTTGCACTATGTGCCTGG + Intronic
998980595 5:147697977-147697999 AACAGCTTGCACTGTGTGCTTGG + Intronic
999201987 5:149823171-149823193 GACAATTTGCCATGTGTCCTTGG + Intronic
999232410 5:150069550-150069572 GGCATTATGCACCGTGTGCCAGG - Intronic
999473739 5:151879004-151879026 GACAACTTGCACTGTGAGCCTGG + Intronic
1000183561 5:158836979-158837001 GACAGTATGGACTTTGTGCTGGG + Intronic
1000777827 5:165441950-165441972 GACAGCTTGCACTGTGTACCTGG - Intergenic
1000947243 5:167437097-167437119 GACAGCTTGTACTGTGTGCCTGG + Intronic
1001181620 5:169525981-169526003 GACAGCTTGCATTGTGTGCCTGG - Intergenic
1001636585 5:173214318-173214340 GTCACTTTCCACTGTGTGCGAGG + Intergenic
1001741409 5:174055905-174055927 GACATTTTACCCTGTGTTCACGG + Intronic
1002732862 5:181354629-181354651 GACAGCTTGCACTGTGTGCCTGG + Intergenic
1002742428 5:181443437-181443459 GAAGTGTTGCGCTGTGTGCTCGG + Intergenic
1002751676 6:119475-119497 GACAGCTTGCACTGTGTGCCTGG - Intergenic
1003259740 6:4506497-4506519 GACAGCTTGCACTGTGCACTTGG - Intergenic
1003644586 6:7904282-7904304 TACATTTTACACAGTGTGCATGG - Intronic
1003720191 6:8693037-8693059 AACAGCTTGCACTGTGTGCCTGG + Intergenic
1004207930 6:13609748-13609770 GACATTTTGCAGCTTGTCCTAGG + Intronic
1004817207 6:19324881-19324903 GACATTTTACATAGTGTGTTTGG - Intergenic
1005548694 6:26894696-26894718 GACAGCTTGCACTGTGTGCCTGG + Intergenic
1005553077 6:26943631-26943653 GACAGTTTGCACAGTGTGCCTGG + Intergenic
1005783450 6:29217873-29217895 GACAGCTTGCACTGTGTGCCTGG + Intergenic
1005984086 6:30859750-30859772 CACAGCTTGCACTGTGTGCCTGG - Intergenic
1006190305 6:32203623-32203645 GACACTTCCCACTGTGAGCTTGG + Intronic
1006240448 6:32673166-32673188 GACAGCTTGCACTGTGGGCCTGG + Intergenic
1006344198 6:33466692-33466714 GACAGCCTGCACTGTGTGCCCGG + Intergenic
1006656172 6:35595141-35595163 TACACTTTGCTCTGTGCGCTTGG - Intronic
1007866152 6:44972490-44972512 GACAGCTTGCACTGTGTTCCTGG - Intronic
1008397959 6:51031344-51031366 GACACTTTCCACTGTCTTCTTGG + Intergenic
1009019449 6:57935808-57935830 GACAGCTTGCACTGTGTGCCTGG + Intergenic
1009607748 6:65896090-65896112 GACAGCTTGCACTGTGCACTTGG - Intergenic
1009620076 6:66063983-66064005 AACAGCTTGCACCGTGTGCTTGG + Intergenic
1009710270 6:67308854-67308876 GGTAGTTTGCACTGTGTGCCTGG + Intergenic
1009759705 6:67988779-67988801 GACATGTTGCATTGGGTGGTAGG - Intergenic
1010248302 6:73682540-73682562 CACAGCTTGCACTGTGTGCCTGG - Intergenic
1010517357 6:76789738-76789760 GACAGCTTGCACTATGTGCCTGG - Intergenic
1010549307 6:77201409-77201431 GACAGTTTGTACTGTGTGCTTGG + Intergenic
1010551079 6:77222893-77222915 AACAGCTTGCACTGTGTGCCTGG + Intergenic
1010555611 6:77275277-77275299 GACACCTTGCACTGTGCACTTGG + Intergenic
1010594545 6:77748096-77748118 AACAGCTTGCACTGTGTGCCTGG - Intronic
1010605989 6:77890176-77890198 GACAGCTTGCACTGTGTGCCTGG + Intronic
1010610823 6:77952218-77952240 GACAGTTTGCACTGTGTGCCTGG + Intergenic
1010630156 6:78189488-78189510 GACAGCTTGCACTGTGTGCCTGG - Intergenic
1010713925 6:79206750-79206772 GTCAGTTTGCACCGTGTGCCTGG + Intronic
1010819459 6:80396195-80396217 GACAGCTTGCACTTTGTGCCTGG + Intergenic
1010835871 6:80586852-80586874 GACGGTTTGCACTGTGGGCCAGG + Intergenic
1011211259 6:84958822-84958844 AACAGCTTGCACTGTGTGCCTGG + Intergenic
1012202491 6:96423953-96423975 GACAGCTTGCACTGTGCGCCTGG - Intergenic
1012473614 6:99597621-99597643 GACATTTTGGACTTTGTTGTAGG - Intergenic
1013077060 6:106780981-106781003 GACAGTTTGCATCGTGTGCTTGG + Intergenic
1013599441 6:111690649-111690671 AACATTTATCACTATGTGCTGGG + Intronic
1014621651 6:123674741-123674763 GACAGCTTGCACTGTGTGCCTGG - Intergenic
1014646605 6:123981584-123981606 GCCATTCTGCAGGGTGTGCTTGG - Intronic
1014670787 6:124301509-124301531 GACAGCTTGCACTGTGTACCTGG + Intronic
1014730916 6:125030755-125030777 GACAGCTTGCACCGTGTGCCTGG - Intronic
1014771837 6:125465921-125465943 TACAGCTTGCACTGTGTGCCTGG + Intergenic
1014863197 6:126496386-126496408 TACAGCTTGCACTGTGTGCCTGG - Intergenic
1015013144 6:128376050-128376072 GACAGCTTGCATTGTGTGCCTGG - Intronic
1016097983 6:140061531-140061553 GACATTTTGCAGTGTCCCCTAGG - Intergenic
1016208950 6:141505210-141505232 GACAGCTTGCACTGTGTGCCTGG - Intergenic
1016242975 6:141953403-141953425 AACAGCTTGCACTGTGTGCCTGG + Intergenic
1016281736 6:142426546-142426568 AACAGCTTGCACTGTGTGCCTGG - Intronic
1016296022 6:142574373-142574395 GACAGCTTGCCCCGTGTGCTTGG + Intergenic
1016512999 6:144864234-144864256 GACAGCTTGCACTGTGTGCTTGG + Intergenic
1016579758 6:145616568-145616590 GACAGCTTGCACTGTGTGCCTGG + Intronic
1016611914 6:145999578-145999600 AACAGCTTGCACTGTGTGCCTGG - Intergenic
1016785934 6:148010861-148010883 AACAGCTTGCACTGTGTGCCTGG + Intergenic
1016987933 6:149909097-149909119 GACAGCTTGCACTGTGTGCCTGG + Intergenic
1017390954 6:153938988-153939010 GACATGTTGCCCTTTTTGCTCGG + Intergenic
1017525344 6:155237392-155237414 GACATCTTGCACCCTGTGCCTGG - Intronic
1018032100 6:159849463-159849485 GACAGATTACACTGTGTGCCTGG + Intergenic
1018075301 6:160207191-160207213 AACAGCTTGCACTGTGTGCCTGG - Intronic
1018080601 6:160256499-160256521 GAGATTGTGGTCTGTGTGCTTGG + Intronic
1018593042 6:165448617-165448639 GGTATTTGGCACTGTGAGCTGGG - Intronic
1018721622 6:166577336-166577358 GACAGCTTGCACTGTGTGCCTGG + Intronic
1018807805 6:167274854-167274876 AGCAATTTGCACTGTGAGCTTGG - Intronic
1018866855 6:167753102-167753124 AACAGCTTGCACTGTGTGCCTGG - Intergenic
1019237116 6:170626947-170626969 GACAGCTTGCACTGTGTGCCTGG + Intergenic
1019247564 6:170719176-170719198 GAAGTGTTGCGCTGTGTGCTCGG + Intergenic
1019383163 7:738890-738912 GACCTCCTGCACTGTGTGCCAGG - Intronic
1019745875 7:2700178-2700200 GACATCGGGCCCTGTGTGCTCGG + Intronic
1020236998 7:6363987-6364009 GACATTTTGCACTGGAAGCATGG - Intergenic
1020631797 7:10649236-10649258 GACGGCTTGCACTGTGTGCCTGG - Intergenic
1020782665 7:12536010-12536032 GACAGCTTGTACTGTGTGCCTGG - Intergenic
1021036798 7:15809728-15809750 GACTGCTTGCACTGTGTGCCTGG - Intergenic
1022331646 7:29384872-29384894 GAAATTTTGCCCTGATTGCTGGG - Intronic
1022512847 7:30952258-30952280 AACAGCTTGCACTGTGTGCCTGG - Intronic
1022817684 7:33929112-33929134 CAGAGTTTGCACTGTGAGCTGGG + Intronic
1022834485 7:34100887-34100909 GACATTACGGAATGTGTGCTGGG - Intronic
1022909112 7:34882964-34882986 GACAGCTTGCACCGTGTGCCTGG - Intergenic
1022964243 7:35457912-35457934 GACAGCTTGCACTGTGTGCCTGG - Intergenic
1023022201 7:36020234-36020256 GACATTGTGCCCTGTTTGCCCGG + Intergenic
1023188501 7:37555241-37555263 GACATCTTGCACTGTGCACCTGG - Intergenic
1023804142 7:43859323-43859345 AACATCTTGCACTGTGTGCTTGG + Intergenic
1024083941 7:45878230-45878252 GACAGTTTGCACTGTGCACCTGG - Intergenic
1025745726 7:64241104-64241126 CACAATTTTCCCTGTGTGCTGGG + Intronic
1025785381 7:64639142-64639164 CACATTTTGAACTGTGGGCCGGG - Intergenic
1027549590 7:79574269-79574291 GACAGCTTGCACTGTGTGCCTGG + Intergenic
1027789100 7:82616322-82616344 GACAGCTTGCACTGTGTGTCTGG - Intergenic
1028301393 7:89205742-89205764 AACAGCTTGCACTGTGTGCCTGG - Intronic
1028844193 7:95461197-95461219 GACAGCTTGCACTGTGTGCCTGG + Intergenic
1028961002 7:96749813-96749835 AACAATTTGCACTGTGTGCCTGG - Intergenic
1029070451 7:97891861-97891883 GACAGCTTGCACTGTGTGCCTGG - Intergenic
1029293636 7:99521490-99521512 GAAATTTTGCATTGTGGGCGGGG - Intronic
1029914941 7:104199247-104199269 AACAGCTTGCACTGTGTGCATGG + Intronic
1030907625 7:115206420-115206442 GACAGCTTGCACTGTGTGCCTGG - Intergenic
1031035656 7:116785226-116785248 GACAGTTTGCACCGTGTGCCTGG - Intronic
1031172461 7:118308930-118308952 AACAGCTTGCACTGTGTGCCTGG - Intergenic
1031396885 7:121284834-121284856 AACAGCTTGCACTGTGTGCCTGG - Intronic
1031608275 7:123794903-123794925 GATAGCTTGCACTGTGTGCCTGG + Intergenic
1031674274 7:124589471-124589493 GACAGCTTGCACTGTGTGCCTGG + Intergenic
1031722500 7:125193973-125193995 GACAGCTTGCACTGTGAGTTTGG + Intergenic
1032053204 7:128662675-128662697 GACAGCTTGCACTGTGTGCCTGG + Intergenic
1033600246 7:142884052-142884074 GCCTTTTTGCACTCTGTGCCTGG + Intronic
1033998696 7:147385732-147385754 TACAGCTTGCACTGTGTGCCTGG - Intronic
1035135388 7:156698279-156698301 GACAGCTTGCACTGTGTGCCTGG - Intronic
1035500573 8:88760-88782 GAAGTATTGCGCTGTGTGCTCGG - Intergenic
1035510654 8:179661-179683 GACAGCTTGCACTGTGTGCCTGG - Intergenic
1035525408 8:308689-308711 GACATTTGGCAGTGTTTGCTCGG - Intergenic
1035915920 8:3622083-3622105 CACAGTCTGCACTATGTGCTGGG + Intronic
1036248114 8:7137865-7137887 GACAGCTTGCACTGTGTGCCTGG + Intergenic
1036252695 8:7176484-7176506 GACAGCTTGCACTGTGTGCCTGG - Intergenic
1036364802 8:8110978-8111000 GACAGCTTGCACTGTGTGCCTGG + Intergenic
1036518535 8:9468724-9468746 GACAACTTGCATTGTGTGCCTGG + Intergenic
1036690621 8:10942538-10942560 GGCTTTTTGCTCTGTGTGCCCGG - Intronic
1036886134 8:12555133-12555155 GACAGCTTGCACTGTGTGCCTGG - Intergenic
1036893750 8:12614221-12614243 GACAGCTTGCACTGTGTGCCTGG - Intergenic
1037108439 8:15137936-15137958 GACAGCTTGCACTGTGTGCCTGG + Intronic
1037391541 8:18398120-18398142 GACAATTTCCCCTGTGTGTTGGG - Intronic
1038280405 8:26159090-26159112 GACAGCTTGCACTGTGTGCCAGG - Intergenic
1038479771 8:27893763-27893785 CTTATTTTACACTGTGTGCTTGG + Intronic
1039100802 8:33940110-33940132 GACAAATTGCACTGTCTGCATGG + Intergenic
1039142328 8:34403742-34403764 CACAGTTTGCTCTGTGAGCTGGG + Intergenic
1039434918 8:37553446-37553468 GACAGTGTGCAGTGTCTGCTGGG - Intergenic
1039511411 8:38094979-38095001 AACAGCTTGCACTGTGTGCCTGG + Intergenic
1039750076 8:40470494-40470516 CACATTCTGTACTGTGGGCTAGG - Intergenic
1040094941 8:43434022-43434044 GACAGCTTGCACTGTTTGCCTGG + Intergenic
1040358486 8:46642393-46642415 TACAATTTCCTCTGTGTGCTAGG - Intergenic
1040381942 8:46881660-46881682 CACAATTTCCTCTGTGTGCTAGG + Intergenic
1040540126 8:48346408-48346430 GACAGCTTGCACTCTGTGCCTGG + Intergenic
1040721410 8:50329217-50329239 GACAGCTTGCACTGTGTACCTGG - Intronic
1040741374 8:50579966-50579988 GACGGCTTGCACCGTGTGCTGGG + Intronic
1041865734 8:62571457-62571479 GACAGCTTGCACTGTGTGCCTGG - Intronic
1041902454 8:62996949-62996971 GACAGCTTGCACCGTGTGCCTGG - Intronic
1042352510 8:67791665-67791687 CACAATTTCCACTGTGTTCTTGG + Intergenic
1042412561 8:68481483-68481505 AACAGCTTGCACTGTGTGCCTGG + Intronic
1042571953 8:70175317-70175339 GACATTCTGCAATGTCTGCCTGG + Intronic
1042605501 8:70541792-70541814 GACAGCTTGCACCGTGTGCTAGG + Intergenic
1042772903 8:72398660-72398682 AACAGCTTGCACTGTGTGCCTGG - Intergenic
1043199141 8:77340622-77340644 GACAACTTGCACTGTGCACTTGG + Intergenic
1043265917 8:78267248-78267270 AACAGCTTGCACTGTGTGCCTGG + Intergenic
1043297426 8:78683134-78683156 GACAGGTTGCATTGTGTGCCTGG - Intronic
1043510559 8:80946319-80946341 GACAGCTTTCACTGTGTGCCTGG + Intergenic
1043779405 8:84312790-84312812 GACAGCTTGCACCATGTGCTTGG - Intronic
1044010150 8:86984467-86984489 AACATCTTGCACTGTGTGTCTGG + Intronic
1044087155 8:87955600-87955622 GACAGCTTGCACTGTGTGCCTGG - Intergenic
1044361758 8:91293779-91293801 AACATTTTGCTCTGTGCTCTAGG + Intronic
1045207464 8:100056930-100056952 AACAGTTTGCACTGTGTGCCCGG + Intronic
1045995613 8:108358634-108358656 GACATCTTGCACCGTGTGCCTGG - Intronic
1046107464 8:109683196-109683218 GACAGCTTGTACTGTGTGCCTGG + Intronic
1046232346 8:111373925-111373947 GACAACTTGTACTGTGTGCCTGG + Intergenic
1046618066 8:116499404-116499426 GACAGCTTGCACTGTGTGCCTGG - Intergenic
1047194962 8:122712894-122712916 GACAGTTTGCACTGTGTGCCTGG + Intergenic
1047535118 8:125712505-125712527 GACAGCTTGCACCGTGTGCCTGG + Intergenic
1047547659 8:125834919-125834941 CAAATGTTGCACTGAGTGCTAGG - Intergenic
1047918009 8:129603639-129603661 GACAGCTTGGACTGTGTGCCTGG - Intergenic
1047941405 8:129830602-129830624 GACAGCTTGCACTGTGCGCCTGG - Intergenic
1048158563 8:131989390-131989412 TTTATTATGCACTGTGTGCTAGG + Intronic
1048213481 8:132476357-132476379 GACAGCTTGCACTGTGTGCCTGG + Intronic
1048724564 8:137368129-137368151 GACACTTTGGACTGTGCGGTTGG - Intergenic
1048783013 8:138022125-138022147 GACAGTTTGCACCGTGAGCCTGG + Intergenic
1050074900 9:1853208-1853230 GACATCTTGCACTCTGATCTTGG + Intergenic
1050086593 9:1972484-1972506 GACAGCTTGCACCATGTGCTTGG + Intergenic
1050156043 9:2667206-2667228 AACAACTTGCACTGTGTGCCTGG + Intergenic
1050976796 9:11949380-11949402 GACAGCTGGCACTGTGTGCCTGG - Intergenic
1051573201 9:18583613-18583635 GACAGCTTGCACTGTGTGCCTGG + Intronic
1051619554 9:19036859-19036881 GACAAATTGCACTGTGTGCCTGG + Intronic
1051925250 9:22317252-22317274 GACATCTTGCACTGTGTACCTGG + Intergenic
1052071012 9:24081301-24081323 GACAGCTTGCACTGTGTGCCTGG + Intergenic
1052168011 9:25357496-25357518 GACAGTTTGCACTGTGCACTTGG - Intergenic
1052594163 9:30537123-30537145 GACAGCTTGCACTGTGAGCCTGG + Intergenic
1052614561 9:30821478-30821500 GACAGCTTGCACTGTATGCCTGG + Intergenic
1052626051 9:30978624-30978646 AACATCTTACACTGTGTGCCTGG + Intergenic
1052767915 9:32660401-32660423 GACAGCTTGCACTGTGTACCTGG - Intergenic
1052782515 9:32795788-32795810 GCCAGCTTGCACTGTGTGCTTGG - Intergenic
1052846364 9:33340004-33340026 GACAGCTTGCACTGTGTGCCTGG - Intronic
1053616349 9:39770356-39770378 GACAGTTTGCACCATGTGCTTGG - Intergenic
1053633015 9:39964711-39964733 GACAGCTTGCACTGTGTGCGTGG + Intergenic
1053772737 9:41498822-41498844 GACAGCTTGCACTGTGTGCATGG - Intergenic
1053874514 9:42529663-42529685 GACATTTTGCACCATGTGCTTGG - Intergenic
1053898100 9:42764924-42764946 GACAGTTTGCACCATGTGCTTGG + Intergenic
1054210873 9:62285986-62286008 GACAGCTTGCACTGTGTGCGTGG - Intergenic
1054237168 9:62572033-62572055 GACAGTTTGCACCATGTGCTTGG + Intergenic
1054267820 9:62937092-62937114 GACATTTTGCACCATGTGCCTGG + Intergenic
1054314111 9:63562868-63562890 GACAGCTTGCACTGTGTGCATGG + Intergenic
1054551305 9:66606544-66606566 GACAGTTTGCACCATGTGCTTGG + Intergenic
1055701315 9:78948404-78948426 GACAGCTTGCACTGTGTGCCTGG + Intergenic
1055878517 9:80970992-80971014 GACAGCTTGCACTGTGTGTCTGG + Intergenic
1056064146 9:82916013-82916035 GACAGCTTGCACCGTGTGCCTGG - Intergenic
1056129168 9:83566884-83566906 AACAGCTTGCACTGTGTGCCTGG - Intergenic
1056915023 9:90738867-90738889 GACAGCTTGCATTGTGTGCCTGG - Intergenic
1058101841 9:100925206-100925228 AACAGCTTGCACTGTGTGCCTGG + Intergenic
1058288526 9:103209761-103209783 AACAGGTTGCACCGTGTGCTTGG - Intergenic
1059437409 9:114284961-114284983 CACATTCAGCACTATGTGCTGGG + Intronic
1059885125 9:118737038-118737060 GGCAGTTTGCACCCTGTGCTTGG + Intergenic
1060021313 9:120133778-120133800 AACAGTTTGTACTGTGTGCCTGG - Intergenic
1061321685 9:129835036-129835058 GACATTGTTAACTGTGAGCTCGG - Intronic
1061581252 9:131538143-131538165 CACATTTTGCACTCTTTGCTTGG - Intergenic
1062157843 9:135063639-135063661 GACAGTTTGCACTGTGTGCCTGG - Intergenic
1062438824 9:136559919-136559941 GACAGCTTGCACTGTGTGCCTGG + Intergenic
1062757268 9:138306955-138306977 GACAGCTTGCACTGTGTGCCTGG + Intergenic
1203608335 Un_KI270748v1:74656-74678 GAAGTATTGCGCTGTGTGCTCGG + Intergenic
1185751112 X:2610006-2610028 GAGTTATTGCACTGTCTGCTTGG + Intergenic
1186117190 X:6317243-6317265 GAGAATTTGCCCTGTGTGCATGG - Intergenic
1186217309 X:7313961-7313983 GACGTTTTGCATTGTTGGCTAGG + Intronic
1186266591 X:7840393-7840415 GACAGTTTGCACCGTGGGCCTGG - Intergenic
1186323954 X:8458770-8458792 GACAGCTTGCACTGTGTACCTGG - Intergenic
1186700346 X:12083596-12083618 GGCAGTTTGTACTGTGTGCCTGG + Intergenic
1187254202 X:17627384-17627406 GACACTCTGCACTGTGGGCTTGG - Intronic
1187598448 X:20800436-20800458 GAAAGCTTGCACTGTGTGCCTGG + Intergenic
1188114956 X:26231692-26231714 GACAGCTTGCACTGTGTGCCAGG - Intergenic
1188305673 X:28557905-28557927 GATAGCTTGCACTGTGTGCCTGG - Intergenic
1188325483 X:28796725-28796747 GACAGCTTGCATTGTGTGCCTGG - Intronic
1188405609 X:29805456-29805478 AACATCTTGCACTGTGGTCTTGG - Intronic
1188804450 X:34570224-34570246 GACAGTTTGCACTGTGTGCCTGG - Intergenic
1188873091 X:35398303-35398325 GACAGTTTGCACTGTGTTCCTGG - Intergenic
1188953023 X:36399915-36399937 GACATTTTACAGTGTTTGGTTGG + Intergenic
1189170385 X:38903770-38903792 CGCATTTTGCCCTGGGTGCTGGG - Intergenic
1189604277 X:42660070-42660092 GACAGCTTGCACTGTGCGCCTGG + Intergenic
1189637153 X:43023374-43023396 GACAGCTTGCACTGTGTGCCTGG - Intergenic
1189746683 X:44175661-44175683 GACATTTTCAGCTGTGTTCTAGG - Intronic
1190936701 X:55004344-55004366 GAGAATTTGCATTGTGTGCATGG + Intronic
1191188616 X:57640460-57640482 AACAGTTTGCACTGTGTGCCTGG + Intergenic
1191595881 X:62943824-62943846 GACAGCTTGCACTGTGGGCCTGG - Intergenic
1191599130 X:62983850-62983872 GACAACTTCCACTGTGTGCCTGG - Intergenic
1192549221 X:72040675-72040697 CTCATTTGGCACTGAGTGCTTGG - Intergenic
1192634429 X:72804300-72804322 GAGATTGGGCACTGTGTGGTGGG + Intronic
1192647281 X:72916501-72916523 GAGATTGGGCACTGTGTGGTGGG - Intronic
1192967555 X:76195389-76195411 GAAAGCTTGCACTGTGTGCCTGG - Intergenic
1193004072 X:76596453-76596475 GACAGCTTGCACTGTTTGCCTGG - Intergenic
1193329688 X:80222544-80222566 AACAGCTTGCACTGTGTGCTTGG + Intergenic
1193460506 X:81786287-81786309 GACAGCTTACACTGTGTGCCTGG - Intergenic
1193564107 X:83056248-83056270 GACAGCTTGCACTCTGTGCCTGG - Intergenic
1193816159 X:86107252-86107274 GACAGTTTGCATAGTGTGCCTGG - Intergenic
1193887905 X:87006301-87006323 GACAGCTTGCACTGTGTGCCTGG - Intergenic
1193943881 X:87708697-87708719 GACAGTTTGCACTGTGTGCCTGG - Intergenic
1193965190 X:87976172-87976194 GTCAGCTTGCACTGTGTGCCTGG + Intergenic
1194084142 X:89505522-89505544 GACAGCTTGCACTGTGTGCCTGG - Intergenic
1194145270 X:90254632-90254654 TACAGCTTGCACTGTGTGCCTGG - Intergenic
1194194145 X:90870873-90870895 GACAGCTTGCACTGTGTGCCTGG + Intergenic
1194264566 X:91738756-91738778 GACAGTTTGCACTGTGTGCCTGG + Intergenic
1194300635 X:92182012-92182034 GACAGCTTGCACTGTGTACCTGG + Intronic
1194320642 X:92441839-92441861 GACAGCTTTCACTGTGTGCCTGG + Intronic
1194321166 X:92447770-92447792 GACAGCTTGCACTGCGTGCCTGG + Intronic
1194495827 X:94615827-94615849 GACAGCTTGCACTGTGTACCTGG - Intergenic
1194503773 X:94708342-94708364 AACAGCTTGCACTGTGTGCCTGG - Intergenic
1194603856 X:95957480-95957502 GACAGCTTGCACTGTGCGCTTGG + Intergenic
1194843657 X:98776321-98776343 GACAGCTTGCACTGTGTCCTTGG + Intergenic
1194864954 X:99054149-99054171 GGCAGTTTGCACTGTGTTCCTGG + Intergenic
1195210043 X:102645914-102645936 GACGGCTTGCACTGTGTGCGTGG - Intergenic
1195457400 X:105084278-105084300 GACAGCTTGCACAGTGTGCCTGG + Intronic
1196113527 X:111972563-111972585 GGGAATTTGCACTGCGTGCTTGG + Intronic
1196168880 X:112565501-112565523 GGCAGTTTGCACTGTATGCCTGG - Intergenic
1196169828 X:112575074-112575096 GACAGCTTGCACCGTGTGCCTGG + Intergenic
1196503380 X:116411498-116411520 GACAGCTTGCACTGTGTGCCTGG + Intergenic
1196582500 X:117393779-117393801 GACAGCTTGCACTGTGTGTCTGG - Intergenic
1196664796 X:118304930-118304952 CACAGCTTGCACTGTGTGCCTGG - Intergenic
1197349745 X:125369664-125369686 GACAGCTTGCACTTTGTGCCTGG - Intergenic
1198775316 X:140173014-140173036 AACAGCTTGCACTGTGTGCCTGG + Intergenic
1198919315 X:141708101-141708123 GACAGCTTGCACCGTGTGCCTGG - Intergenic
1199106626 X:143876044-143876066 GACAGCTTGCACTGTGGGCCTGG + Intergenic
1199157955 X:144572276-144572298 GACATCTTGCACTGTATGCCTGG + Intergenic
1199196155 X:145033027-145033049 GACAGTTTGCACCATGTGCTTGG + Intergenic
1199462693 X:148101499-148101521 GACAGCTTGCACCGTGTGCCTGG + Intergenic
1199802723 X:151267493-151267515 GACCTTTTGGACAGTCTGCTTGG + Intergenic
1199869829 X:151888360-151888382 GACAGCTTGCACTGTGTACCTGG + Intergenic
1200332280 X:155310575-155310597 GACAGTTTGCACCATGTGCCTGG - Intronic
1200361771 X:155613960-155613982 GACATTTTAGACTCTGTGCTTGG - Intronic
1200436785 Y:3161408-3161430 GACAGCTTGCACTGTGTGCCTGG - Intergenic
1200438866 Y:3187885-3187907 GACTTTTTGCACTGTAGCCTTGG + Intergenic
1200491031 Y:3823930-3823952 TACAGCTTGCACTGTGTGCCTGG - Intergenic
1200540753 Y:4453257-4453279 GACAGCTTGCACTGTGTGCCTGG + Intergenic
1200628756 Y:5554975-5554997 GACAGCTTTCACTGTGTGCCTGG + Intronic
1200850273 Y:7876015-7876037 ACTATTTTGCACTGTGTGCAGGG + Intergenic
1200897430 Y:8390515-8390537 CACAATTTCCTCTGTGTGCTAGG + Intergenic
1200900837 Y:8430277-8430299 CACAATTTTCTCTGTGTGCTAGG + Intergenic
1200906933 Y:8493316-8493338 CACAATTTGCTCTTTGTGCTAGG - Intergenic
1202260120 Y:22961569-22961591 GACATGATTCACTGTGAGCTGGG - Intergenic
1202262368 Y:22983137-22983159 GACAATTTTCTCGGTGTGCTAGG - Intronic
1202413107 Y:24595310-24595332 GACATGATTCACTGTGAGCTGGG - Intergenic
1202415358 Y:24616878-24616900 GACAATTTTCTCGGTGTGCTAGG - Intronic
1202455429 Y:25053208-25053230 GACAATTTTCTCGGTGTGCTAGG + Intronic
1202457675 Y:25074758-25074780 GACATGATTCACTGTGAGCTGGG + Intergenic