ID: 1081237859

View in Genome Browser
Species Human (GRCh38)
Location 11:40667664-40667686
Sequence TGCCCTCTAGGAGCCCAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 331}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081237854_1081237859 30 Left 1081237854 11:40667611-40667633 CCATATGGTAAGAGAGTCTAAGA 0: 1
1: 0
2: 0
3: 9
4: 117
Right 1081237859 11:40667664-40667686 TGCCCTCTAGGAGCCCAGAGTGG 0: 1
1: 0
2: 4
3: 41
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081237859 Original CRISPR TGCCCTCTAGGAGCCCAGAG TGG Intronic
900403612 1:2482960-2482982 GGCCTGCGAGGAGCCCAGAGTGG - Intronic
900478907 1:2888923-2888945 GGGCCCCTAGGAGCCAAGAGTGG - Intergenic
900946033 1:5831925-5831947 TGCCCACTGGAAGCCCAGACGGG + Intergenic
901880221 1:12189359-12189381 TGCCCTAGAGGAGCACACAGTGG - Intronic
902618248 1:17635494-17635516 GCCCATCCAGGAGCCCAGAGGGG - Intronic
903209883 1:21812011-21812033 TGCTCTCTAGGCCCTCAGAGAGG + Intergenic
903576360 1:24341981-24342003 TGCCTTCTAGGGGCCTAGTGAGG + Intronic
903771284 1:25766021-25766043 TGCCCTGGAGCAGCTCAGAGGGG - Intronic
903868560 1:26415758-26415780 TCACCACTCGGAGCCCAGAGAGG + Intronic
904470635 1:30733861-30733883 TGCCATCGAAGACCCCAGAGGGG - Exonic
904493474 1:30874203-30874225 TTGCCTCTAGGAACCCAGAAAGG - Intronic
904583682 1:31566738-31566760 TGTCCTCCGGGAGCCCAGGGAGG + Intergenic
904833418 1:33320137-33320159 AGCCCTCCAGGAGCTCAGACAGG - Intronic
904933097 1:34106145-34106167 TGCCCTCAAGGAGTTCACAGTGG + Intronic
905301018 1:36986140-36986162 TTCCCTCTGGAAGCTCAGAGAGG - Intronic
905626098 1:39491511-39491533 CGCCCGCTAGGAGCCCCGGGCGG - Intergenic
905827516 1:41037279-41037301 TGAGCTCTGGGAGGCCAGAGAGG - Intronic
906510105 1:46405855-46405877 TCCCCGCCTGGAGCCCAGAGAGG - Intronic
907713337 1:56904792-56904814 TGCCATCTAAGACCCCAAAGAGG - Intronic
908248138 1:62244016-62244038 TGACATCTAGGAGCACACAGGGG - Intronic
908293061 1:62687793-62687815 CACCCTCTAGGGGCCAAGAGGGG + Intronic
908364032 1:63399151-63399173 TGAGCTCTAGGAGCCAAGAGTGG - Intronic
910365587 1:86461578-86461600 TGCACACTAGGAGGACAGAGCGG - Intergenic
911275292 1:95852729-95852751 TGCACTTTGGGGGCCCAGAGTGG + Intergenic
911659533 1:100485690-100485712 AGCCCACAAGGAGCCCAGAATGG + Intronic
911804047 1:102182672-102182694 TGTCTTTTAGGAGTCCAGAGAGG - Intergenic
912352396 1:109026614-109026636 TGCCCTCTAAGAACCTACAGAGG - Intronic
913172197 1:116243115-116243137 TGCCCTCTGGGAGCTCAGAGAGG - Intergenic
913670341 1:121092463-121092485 GGGCCTCTAGGAGCTGAGAGTGG - Intronic
914022108 1:143879904-143879926 GGGCCTCTAGGAGCTGAGAGTGG - Intergenic
914660593 1:149787833-149787855 GGGCCTCTAGGAGCTGAGAGTGG - Intronic
916322793 1:163523291-163523313 TTCCCTCTCGGGACCCAGAGAGG - Intergenic
916480911 1:165213559-165213581 TGCCCACTGAGATCCCAGAGGGG + Intronic
916742865 1:167661600-167661622 TGGCCTCCAGGAGCCCAGGATGG - Intronic
917536321 1:175877108-175877130 TTCCCTCAAGGAGGCCTGAGTGG + Intergenic
918239378 1:182608437-182608459 TGCCCTCCAGGAGTGCACAGAGG - Intergenic
919940185 1:202281061-202281083 TGCCCTCTGGGAGTTCAGAATGG + Intronic
920216554 1:204365192-204365214 TGCCCTTTACGTGCCCAGATAGG + Intronic
920379121 1:205525752-205525774 TTCCCTCCAGGAGCCCAAAGAGG + Intronic
920397940 1:205660166-205660188 TGGCATCTGGGACCCCAGAGAGG - Intronic
921112846 1:212055587-212055609 TGCCCTGCAGCAGCCCAGAGTGG - Intronic
921748397 1:218764514-218764536 TGCCATGTAGGAGCCCACTGAGG + Intergenic
922933887 1:229409525-229409547 TGCCCCCTAGGAGCCCATGCAGG - Intergenic
923406106 1:233662489-233662511 TACTCTATAGGAGCCCAGAAAGG + Intronic
924429579 1:243985445-243985467 GGCCCATTAGGAGCCCACAGAGG - Intergenic
1062868426 10:877112-877134 TGCCCTCTAGGAGGGCAGAAGGG - Intronic
1063238730 10:4146309-4146331 TGCCTTTTAGGAAGCCAGAGTGG - Intergenic
1064494935 10:15899332-15899354 TGGCCTCTAGGAGCTGGGAGTGG - Intergenic
1064494944 10:15899366-15899388 TGGCCTCTAGGAGCTGAGAGTGG + Intergenic
1064683395 10:17834440-17834462 TTCCCTCTTGTAGCCCAGACTGG + Intronic
1065378973 10:25069764-25069786 TGCCCTCAAGGAGCTAACAGTGG - Intergenic
1065510578 10:26474365-26474387 TAACTTCCAGGAGCCCAGAGGGG - Intronic
1066267612 10:33791581-33791603 TGCCCACTAGGAGCTCATTGTGG + Intergenic
1067686784 10:48470562-48470584 TGCCCTCTATGAGCCTGGACAGG + Intronic
1067792391 10:49298160-49298182 TGCCCTTGAAGAGCCCACAGGGG + Intergenic
1068941929 10:62689058-62689080 TGGCCTCTAGGACCTGAGAGTGG + Intergenic
1070472790 10:76800725-76800747 TGCCCTCTGGCTGCCCAGGGAGG - Intergenic
1070590671 10:77798487-77798509 TACCTTCAAGGAGCCCAGTGGGG - Intronic
1070946421 10:80395664-80395686 TCCCCACTAGGAGCCCTGGGTGG + Intergenic
1071553541 10:86585462-86585484 TGCCTTCCAGGAGCCCACAGTGG - Intergenic
1073769903 10:106724890-106724912 AGCCCTTTAGGAGGCCAGCGTGG + Intronic
1074304843 10:112267672-112267694 TGGCCTCTATGAGCCCAGACTGG + Intergenic
1075489831 10:122857048-122857070 TGGCCTGTAGGAGCTGAGAGTGG - Intronic
1075747977 10:124741506-124741528 TCCCCTTTTGGAGGCCAGAGAGG - Intronic
1076293503 10:129366060-129366082 TGTCTTCTAGAAGCCCAGTGGGG - Intergenic
1077901645 11:6494849-6494871 TGGCCTCTAGGACCTGAGAGTGG + Intronic
1078765414 11:14292215-14292237 TGCCCACTAGAACCCCAAAGAGG - Intronic
1079312475 11:19378841-19378863 TGCCCTCAGGGAGCTCAGAGCGG - Intronic
1080323656 11:31044569-31044591 TACCCTCTAGGAACTGAGAGTGG + Intronic
1081237859 11:40667664-40667686 TGCCCTCTAGGAGCCCAGAGTGG + Intronic
1081531149 11:43960054-43960076 TGCCCCCTAGAAGACCAGAAGGG - Intergenic
1081829376 11:46094633-46094655 TGCACTCTGGGAGGCCAAAGTGG + Intronic
1083272245 11:61578440-61578462 TGGCCCCTGGGAGACCAGAGGGG + Intronic
1083774130 11:64884923-64884945 TGACCTCTAGGAGCTGAGAGGGG + Intronic
1084330454 11:68426939-68426961 TGGCCTCTAGGAGCTGAGAGTGG - Intronic
1084969052 11:72759700-72759722 TGCCCACGAGGAGCTCACAGGGG - Intronic
1085183744 11:74558043-74558065 TGGCCTATAGGAGCTGAGAGTGG + Intronic
1086170999 11:83836404-83836426 TGGCCTATAGGAGCTGAGAGAGG - Intronic
1086429825 11:86725854-86725876 TGTCCTCTGGGAGTCCAAAGTGG + Intergenic
1086479152 11:87215554-87215576 TGCCCTCAAGGTTCCAAGAGAGG + Intronic
1086749049 11:90467153-90467175 AGCACTCTAGGAGGCCAAAGTGG - Intergenic
1089692873 11:120197710-120197732 TGGCCTCTAGAAGCCCAGCAGGG + Intergenic
1091233253 11:134001942-134001964 TGCCCTCATGGAGTCTAGAGGGG - Intergenic
1091367260 11:135032675-135032697 TGCCCTCAAGGAGATCAGGGTGG - Intergenic
1093250199 12:16793507-16793529 TGGCCTCTAGGAGCTGAAAGTGG + Intergenic
1096186828 12:49587059-49587081 TGACATCTACAAGCCCAGAGAGG + Intronic
1096796097 12:54078439-54078461 TGCCCTCTAGGAAACCAGCTAGG - Intergenic
1097924281 12:65110496-65110518 AGAGCTCTAGGAGCACAGAGGGG - Intronic
1099389806 12:82066449-82066471 TGTCCTCTTGGAGCTCATAGTGG + Intergenic
1100442478 12:94629449-94629471 TGCCCTCAAGGAGCTCAGGCTGG - Intronic
1100877993 12:98983318-98983340 TGGCCTCCAGGAGCTGAGAGTGG - Intronic
1101957357 12:109222994-109223016 TGCCCTCCAGGTGCTCAGTGGGG + Intronic
1102432382 12:112893774-112893796 TGCACTTTAGGAGGCCAAAGCGG - Intronic
1103687607 12:122744418-122744440 TGCCCTCTGGGAGGCCAAGGTGG + Intergenic
1106316686 13:28600499-28600521 TGCCCTCTAGGAGGCTAGCTTGG - Intergenic
1109201453 13:59436079-59436101 AGGCCTCTAGGAGCCAAGGGTGG - Intergenic
1111445954 13:88345852-88345874 TGGCCTCGACCAGCCCAGAGAGG + Intergenic
1112906250 13:104425909-104425931 AGCACTCTGGGAGGCCAGAGCGG + Intergenic
1113552044 13:111200134-111200156 TCCCATCTAGGGGCCGAGAGAGG - Intronic
1113983559 13:114295986-114296008 TGCCCTCTCGGAGGCTAGGGTGG - Intronic
1115935263 14:38544964-38544986 CAGCCTCTAGGAGCTCAGAGCGG + Intergenic
1116856426 14:49956244-49956266 TGCCCCCCAGGAGCTCATAGAGG + Intergenic
1117743857 14:58847268-58847290 TGACCTCAGGGAGGCCAGAGAGG - Intergenic
1119074521 14:71622812-71622834 TGACCTGTAGGAGCCCAGTGAGG + Intronic
1121521392 14:94588393-94588415 TGGCCTCTATGAGGGCAGAGGGG - Intronic
1121557748 14:94851113-94851135 TGGCCTCTGGGAGCTGAGAGTGG - Intergenic
1123029558 14:105445278-105445300 TGCCCTCCTGGAGTCCCGAGGGG + Intronic
1123469741 15:20541258-20541280 TGAGCTCAAGGAGCCCAGGGAGG + Intronic
1123648322 15:22459441-22459463 TGAGCTCAAGGAGCCCAGGGAGG - Intronic
1123730019 15:23136244-23136266 TGAGCTCAAGGAGCCCAGGGAGG + Intronic
1123748189 15:23333726-23333748 TGAGCTCAAGGAGCCCAGGGAGG + Intergenic
1124280553 15:28357578-28357600 TGAGCTCAAGGAGCCCAGGGAGG + Intergenic
1124302145 15:28554034-28554056 TGAGCTCAAGGAGCCCAGGGAGG - Intergenic
1124438694 15:29671754-29671776 AGCCCACAAGGACCCCAGAGAGG - Intergenic
1124882665 15:33656756-33656778 TGCCCTCTGGGAGCTGAGAGTGG - Intronic
1125716430 15:41822328-41822350 TGCCCTCCTGTAGCCCATAGGGG - Exonic
1126760758 15:51968293-51968315 AGCACTCTAGGAGCCCAAGGTGG + Intronic
1129226406 15:74172952-74172974 TGCCCACTGGGCACCCAGAGGGG - Intergenic
1129586900 15:76876231-76876253 TGGCCTCAACCAGCCCAGAGAGG + Intronic
1129698965 15:77756793-77756815 TGCCCTCTAGGGAGGCAGAGTGG - Intronic
1129760253 15:78125109-78125131 TCCTCTGTAGGAGCCCAGAAAGG + Intronic
1129975714 15:79819695-79819717 GGTCCTGTAGAAGCCCAGAGAGG - Intergenic
1130197040 15:81789579-81789601 TGCCCTTGTGGAGCCCAGAATGG + Intergenic
1130526890 15:84715490-84715512 TTCCAACTCGGAGCCCAGAGTGG + Intronic
1130969684 15:88722104-88722126 AGCCCTGGAGGGGCCCAGAGAGG + Intergenic
1132146578 15:99433076-99433098 TGCCCTCCAGCTGCCCAGAGAGG + Intergenic
1132163339 15:99563497-99563519 TGCCTTTAAGGAGGCCAGAGGGG + Intergenic
1132880992 16:2161639-2161661 TGCCCTCTGGGAGCAGGGAGGGG - Intronic
1133237111 16:4392539-4392561 TGCTATCCCGGAGCCCAGAGTGG - Intronic
1133696219 16:8265382-8265404 TCCCCTCTACGAGGCCACAGAGG - Intergenic
1134110534 16:11512864-11512886 TGCCTTCTAGGATCCCAGCTTGG - Intronic
1134375711 16:13671015-13671037 TGACCTCTGGGAGCTGAGAGTGG + Intergenic
1136112228 16:28070902-28070924 TGCCTCCTAGGGGCCAAGAGTGG + Intergenic
1137252943 16:46753178-46753200 TTCCCTGTAGGACCCCAGAGAGG + Intronic
1137610149 16:49812444-49812466 AGCACTCTAGGAGGCCAAAGTGG + Intronic
1138165995 16:54802262-54802284 TGCACTCGTGGGGCCCAGAGTGG + Intergenic
1138324428 16:56152123-56152145 TGCCCTCCTGGAGCTCAGAAAGG - Intergenic
1138393734 16:56688946-56688968 AGTCCTCTAGGGACCCAGAGAGG + Intronic
1140467770 16:75196163-75196185 TGCCCTGTGGGAGCACACAGGGG + Intergenic
1141440023 16:84024186-84024208 TGCCTTCTAGCACCACAGAGTGG - Intronic
1142148982 16:88504465-88504487 AGCCTTCCAGAAGCCCAGAGAGG + Intronic
1142657923 17:1406544-1406566 AGCACTCTAGGAGGCCAAAGTGG + Intergenic
1143165838 17:4896923-4896945 TGCCCTCTGAGCTCCCAGAGGGG - Intronic
1143374795 17:6461215-6461237 GGCCCTCTAGCAGCCCTGTGAGG - Intronic
1145799251 17:27672665-27672687 GGCTCCCTAGGAGCACAGAGCGG - Intergenic
1145881988 17:28358929-28358951 TGCCTTCTAGGAGCTCATGGAGG - Exonic
1146487069 17:33251573-33251595 CGCACTTTAGGAGCCCACAGCGG - Intronic
1146517721 17:33502275-33502297 TGCCCTCTAGGAAGGCAGTGGGG + Intronic
1147456585 17:40541952-40541974 GGCCCTCAAGGACCCCAGAAGGG - Intergenic
1147677762 17:42219487-42219509 TGTTCTCTGGGAGCCCAGAAGGG - Intronic
1147688274 17:42300084-42300106 TGTTCTCTGGGAGCCCAGAAGGG + Intronic
1149575501 17:57708762-57708784 TGCCCTCCAGGAGCTCAGGCAGG - Intergenic
1150857236 17:68764883-68764905 TGCCCTCTAGGAGAAGAGAGGGG - Intergenic
1151568760 17:74915636-74915658 GGCCCTCCAGAGGCCCAGAGGGG - Intergenic
1151976728 17:77487677-77487699 TGCCTTCCTGGAGCACAGAGTGG + Intronic
1152407951 17:80108167-80108189 TCCCCACGAGGAGCTCAGAGTGG - Intergenic
1154943004 18:21132874-21132896 TGGCCTCAACCAGCCCAGAGGGG + Intergenic
1155003363 18:21706807-21706829 TGCCCCGCAGGAGCCCACAGTGG - Intronic
1155231992 18:23783133-23783155 TGTCCTCAAGGAGGCCAGACTGG + Intronic
1155460641 18:26078636-26078658 AGCCCTTTAGGAGCCCAAGGTGG + Intronic
1155561425 18:27081458-27081480 TGCTGTCTAGCAGCTCAGAGAGG - Intronic
1157694116 18:49707333-49707355 TGCCTTCTGGGAACCCAAAGGGG - Intergenic
1158725387 18:59967425-59967447 TGTGTTCAAGGAGCCCAGAGGGG + Intergenic
1159957599 18:74530669-74530691 TGCCCTCTGGGAGCCCTGTCCGG - Intergenic
1161328022 19:3672769-3672791 TGCCCTGCAGGTGCCCACAGGGG - Intronic
1161533240 19:4802993-4803015 AGCCCAATTGGAGCCCAGAGGGG - Intergenic
1162300509 19:9842306-9842328 AGCCCTGTACGAGCCCAGGGTGG - Intronic
1162320639 19:9969286-9969308 TGGTCACTAGGTGCCCAGAGTGG + Intronic
1162506992 19:11091313-11091335 TTTCCTCTGGGAGGCCAGAGAGG + Intronic
1163517742 19:17775133-17775155 GGGACTCTAGGAGCCAAGAGTGG - Intronic
1163654884 19:18539808-18539830 TGCCCACTAGCTGTCCAGAGGGG + Intronic
1164499965 19:28810475-28810497 AGCCCTCTGGGAGGCCAGGGAGG + Intergenic
1164791852 19:30992868-30992890 AGCACACTAGGAGGCCAGAGTGG - Intergenic
1165197519 19:34116551-34116573 TGCCCTCCAGCAGCACTGAGGGG - Intergenic
1165374196 19:35430057-35430079 TGCCCCCTAGGTGACCAGAGTGG + Intergenic
1165443360 19:35843555-35843577 TGCCCTCCAGGACCCCACTGAGG - Exonic
1166010294 19:39936265-39936287 GGGCCTCTGGGAGGCCAGAGCGG + Intergenic
1166391839 19:42412756-42412778 TGCCCTCTCTGTCCCCAGAGAGG + Intronic
1166513231 19:43425338-43425360 AGCACTCTGGGAGGCCAGAGTGG + Intergenic
1166942170 19:46373790-46373812 GGGCCTTTGGGAGCCCAGAGGGG + Intronic
1167096222 19:47376284-47376306 AGCACTATAGGAGCCCACAGGGG + Intronic
1167696989 19:51020595-51020617 TGAGCAATAGGAGCCCAGAGTGG - Intergenic
1167704195 19:51068924-51068946 TGCCCTCCAGAAGGCAAGAGAGG - Intergenic
1168104449 19:54158106-54158128 TGCCGTCTGGGCGCCCACAGGGG - Intronic
1168366300 19:55790889-55790911 TGCCCTATGGGAGCTCATAGAGG + Intronic
924977527 2:191761-191783 TGGCCTCTGCCAGCCCAGAGAGG + Intergenic
925293069 2:2761343-2761365 TGCCCTCCTGCAGCTCAGAGGGG - Intergenic
925413887 2:3656177-3656199 TGCCTCCTGGGAGCCCAGGGAGG + Intergenic
926055467 2:9771520-9771542 TGCCCTCTCCCAGCCCAGACAGG - Intergenic
926321190 2:11749366-11749388 TGCCCCCTAGGAGGCCACACTGG + Intronic
928205202 2:29278927-29278949 TACCTTCCAGGAGGCCAGAGGGG + Intronic
928325323 2:30315065-30315087 TACCTCCCAGGAGCCCAGAGAGG + Intronic
928398460 2:30961033-30961055 GGCCCTCAAGGAGCCCCCAGAGG + Intronic
928905184 2:36360211-36360233 TGCCCTTTAACTGCCCAGAGAGG - Intronic
932038696 2:68275625-68275647 TGCCGTTTAGGCGCCCAGTGGGG + Intergenic
935115211 2:100129487-100129509 TACTCTCTAGGAACCCAAAGGGG + Intronic
935333592 2:101995370-101995392 TGGCATGTAGGAGCCGAGAGTGG + Intronic
936289262 2:111207212-111207234 TGCTCTCAAGGAGCTCACAGTGG - Intergenic
937428641 2:121819966-121819988 TGGCCTGTAGCAGACCAGAGCGG - Intergenic
937897895 2:126992258-126992280 TGCCCTCTAGGAGGTGAGAGTGG - Intergenic
938144476 2:128822212-128822234 TGCCCTAGAGGAGACCAGAGAGG + Intergenic
938296384 2:130182067-130182089 GGCGCTCTAGGAGCCGGGAGTGG - Exonic
943114239 2:183646499-183646521 TGGCCTCTAGGAGCTGAGGGTGG + Intergenic
943438361 2:187895803-187895825 TGCACTTTAGGAGGCCAAAGTGG + Intergenic
943736985 2:191366935-191366957 TGCCCTCCAGGAGCTTAGAGTGG - Intronic
944168653 2:196750640-196750662 TGGCCTCTAGCAGCTGAGAGTGG + Intronic
944650452 2:201825065-201825087 AGCCCTTTGGGAGGCCAGAGTGG + Intronic
946224124 2:218253481-218253503 TGCTATCTGGGAGCCCTGAGAGG + Intronic
948341826 2:237259120-237259142 TGGCCTCTAGGACCCCACAATGG + Intergenic
948960096 2:241328185-241328207 AGCACTCTGGGAGGCCAGAGCGG + Intronic
1168754726 20:308393-308415 TGCCCTCAGGGAGCTCAAAGTGG - Intergenic
1168766613 20:385798-385820 GGGCCTCTAGGAACCCAGAGAGG - Intronic
1168797773 20:622953-622975 TGAGCTGTAGGAGCCCAGAAGGG + Intergenic
1168833165 20:858456-858478 TGACCTCTAGGAACTGAGAGTGG + Intergenic
1168860010 20:1039383-1039405 TGCTCTTCAGGAGCCCAGAGAGG + Intergenic
1169698847 20:8424010-8424032 TGCCCTCTGGAAGAACAGAGGGG + Intronic
1169771831 20:9209621-9209643 TGGCCTCTAGGAGCTGAGAGTGG + Intronic
1170550514 20:17472178-17472200 TCCCCTCAGGGTGCCCAGAGGGG - Intronic
1171342672 20:24443049-24443071 TGGTCTCTAGAAGCCAAGAGTGG - Intergenic
1171847601 20:30286477-30286499 TGCCCTCTAGGAAACCAGCTAGG - Intergenic
1173398984 20:42707560-42707582 TGGCCTCTAGGAGCTGAGAGTGG + Intronic
1173484960 20:43434349-43434371 AGCACTCTGGGAGCCCAGTGTGG + Intergenic
1174068335 20:47882064-47882086 AGGCCTCTAGGAGCCGAGAGTGG + Intergenic
1174392144 20:50224320-50224342 TGCTCTCTGGGAGCCCAGGTAGG - Intergenic
1175273745 20:57753543-57753565 TGTCCACAAGGAGCCCAGCGTGG - Intergenic
1175523742 20:59619376-59619398 TGACCTCTAGGAGCTGAGAGTGG + Intronic
1175714798 20:61248140-61248162 AACCCTCTAGGAGCCCCCAGGGG - Intergenic
1176091064 20:63318856-63318878 GGCTCCCTAGGAGCCCAGACTGG - Intronic
1176256298 20:64154843-64154865 TCCCAGCTGGGAGCCCAGAGAGG - Intronic
1176546133 21:8201026-8201048 TATCCTATAGAAGCCCAGAGAGG + Intergenic
1176565084 21:8384072-8384094 TATCCTATAGAAGCCCAGAGAGG + Intergenic
1176663762 21:9664472-9664494 TGGCCTCAGGCAGCCCAGAGAGG + Intergenic
1178870204 21:36367259-36367281 TTCTCTCTTGGAGCCCAGTGAGG - Intronic
1181795391 22:25305090-25305112 TGCTCACTAGGAGCTGAGAGTGG + Intergenic
1181835929 22:25608607-25608629 TGCTCACTAGGAGCTGAGAGTGG + Intronic
1182443664 22:30378089-30378111 CGGCCTCTAGGAGCCGTGAGAGG - Intronic
1183090989 22:35521801-35521823 TGCCCTCTTGCAGCTCTGAGTGG + Intergenic
1183221210 22:36514629-36514651 TGGCCTCTAGGAGCCAAGAGAGG + Intronic
1184059094 22:42071042-42071064 TGCCCTCTTGGTCCCCACAGAGG - Intergenic
1184410250 22:44322158-44322180 TTCTCACTAGGAGCTCAGAGAGG - Intergenic
1184530405 22:45051762-45051784 TGCCCACTGAGAGTCCAGAGAGG - Intergenic
1184703166 22:46191294-46191316 TGCTCTCCAGAAGCCCACAGTGG + Intronic
1185143707 22:49117821-49117843 TTCCCTGTGGGTGCCCAGAGGGG - Intergenic
1185300465 22:50077288-50077310 TGCCCTGGAGCAGCCCAGATCGG + Intronic
1185376166 22:50483524-50483546 TCCCCTGTAGGAGGCCAGGGAGG + Exonic
1185412165 22:50688500-50688522 TGCCCACTGGGGTCCCAGAGTGG + Intergenic
1203251005 22_KI270733v1_random:117263-117285 TATCCTATAGAAGCCCAGAGAGG + Intergenic
949437729 3:4047538-4047560 TGCCCTCAGGCAGCCCAGTGGGG + Intronic
950183617 3:10931898-10931920 GGCACTCTGGGAGCACAGAGGGG + Intronic
951627923 3:24686765-24686787 AGGACTCCAGGAGCCCAGAGTGG + Intergenic
952409461 3:33034221-33034243 TGGCCTGTAGGAGCTCAGATGGG + Intronic
952646528 3:35665774-35665796 TGCCCTCTAGGAGACTCCAGGGG - Intronic
953090269 3:39717825-39717847 TGGCCTCTAGGAGCTGAGAGTGG - Intergenic
953925182 3:46979154-46979176 TGCCCTCCCAGATCCCAGAGAGG - Intronic
954431161 3:50471518-50471540 TGCCCTCTGGGCATCCAGAGTGG - Intronic
954461130 3:50627677-50627699 TGCCCTCTAGGGGACCAGGGTGG - Intronic
954840807 3:53509669-53509691 GGCCCTGTAGGAGCCCAGCCAGG + Intronic
957552745 3:81728469-81728491 TTTCCTCTAAGAGCCAAGAGAGG + Intronic
958569205 3:95858185-95858207 TGCCATCTAGGAGCATAGATAGG + Intergenic
959444818 3:106426178-106426200 TGACCTCTAGGAGCCAAGCGTGG + Intergenic
960082211 3:113553694-113553716 TGCCTTCCAGGAGCCAAGACTGG + Intronic
961456820 3:127028576-127028598 TGGGCTCTTGGAGCCCTGAGGGG + Intronic
963540562 3:146582400-146582422 TGCACACTAGGAGGACAGAGTGG + Intronic
964221732 3:154354620-154354642 TGCCCTCAAGGAGCCTGTAGAGG - Intronic
964626295 3:158763376-158763398 TGCCCTCTTGGAGCCTGGAGAGG + Intronic
967765794 3:193278049-193278071 TGCACTCTAGGAGGCCAAGGCGG - Intronic
967910299 3:194537235-194537257 AGCCCTCAAGGAGCTCACAGTGG - Intergenic
968568183 4:1326019-1326041 TGCCTTCCAGGGGCTCAGAGGGG - Intronic
969253025 4:5982441-5982463 TGCCCTCCAGGAGCTCAGGCGGG + Intronic
970339472 4:15089600-15089622 TTCCTTCCAGGAGCCCAGCGCGG - Intergenic
971359159 4:25921172-25921194 TGACCTCAGGGAGACCAGAGTGG + Intronic
972476314 4:39453214-39453236 AGCCCTCTGGGAGGCCAAAGAGG + Intergenic
973684307 4:53354157-53354179 GGCCCCATAGGAGCCCACAGGGG + Intronic
975482890 4:74901417-74901439 TGTCCTCTGGGAGCCCAAATAGG - Intergenic
977542350 4:98331729-98331751 TGCTCTCTAGGAGCCCAGTGGGG + Intronic
977883549 4:102234282-102234304 TGGCCTCGACCAGCCCAGAGAGG - Intergenic
978754890 4:112291217-112291239 TGGCATCTAGGAGCTGAGAGTGG + Intronic
979919342 4:126478742-126478764 TGACCTCTGGGGCCCCAGAGAGG - Intergenic
984706336 4:182849783-182849805 AGCACTCTGGGAGCCCAGAGTGG - Intergenic
985195381 4:187423061-187423083 TTCCCTTTTGGAGCACAGAGTGG - Intergenic
985475370 5:75846-75868 GCACCTCTAGGAGCCCAGAGAGG + Intergenic
985885001 5:2670866-2670888 AGCCCTTTAGAGGCCCAGAGGGG + Intergenic
986175389 5:5348064-5348086 GGGCCTCTAGGAGCTCAGGGAGG + Intergenic
986339981 5:6780551-6780573 TGCCCTCTAGTAGCCCAAAGGGG - Intergenic
986702463 5:10424313-10424335 TGCCATCTAGAGGCCCAGAAAGG + Intronic
986835576 5:11633528-11633550 TGCACTTTGGGAGGCCAGAGTGG + Intronic
987403498 5:17502087-17502109 AGCCCTGCAGGAGCCCAGTGAGG - Intergenic
988698433 5:33647948-33647970 TGCCCTCGAGGAGCTCATGGTGG - Intronic
990988142 5:61659993-61660015 GGGCCTCTAGGAGCCAAGTGAGG + Intronic
994121156 5:96114398-96114420 TCAGCTCTTGGAGCCCAGAGAGG + Intergenic
995518122 5:112974367-112974389 TGGCCTCTAAGAGCCCAAAAGGG + Intergenic
996464708 5:123786240-123786262 TTGCCTCTAGGAAACCAGAGTGG - Intergenic
996996164 5:129699172-129699194 AGCTCTTTAGGAGGCCAGAGCGG + Intronic
997386354 5:133475887-133475909 TGCCTTCTAGGAGCTCTGAGTGG + Intronic
997475541 5:134140345-134140367 GGGACTGTAGGAGCCCAGAGAGG + Intronic
997523128 5:134535926-134535948 TTCCCTGTAGGAGCCCAAACTGG - Intronic
997843671 5:137265861-137265883 TACCCTACAGGAGCTCAGAGTGG - Intronic
998816332 5:146017778-146017800 TGGGCTCTAGGAGGCCAGTGAGG - Intronic
999202192 5:149824478-149824500 GGCCTTCTGGGAGCCCAGGGAGG + Intronic
1000719790 5:164692586-164692608 TGCCCTCTAGAAGCTGAAAGTGG + Intergenic
1001611609 5:173007396-173007418 TGGCCTCTAGGAGCTGACAGTGG - Intronic
1002522743 5:179800560-179800582 TGACCTCCAGGAGCCCAGAATGG + Exonic
1002772600 6:302507-302529 AGCCCTCTGCGACCCCAGAGTGG + Intronic
1003097615 6:3154914-3154936 TTCCCTCTGGCAGGCCAGAGTGG - Exonic
1003107155 6:3225802-3225824 TTCCCTCTGGCAGGCCAGAGTGG - Exonic
1003824861 6:9942118-9942140 TGGCCTCAACCAGCCCAGAGAGG - Intronic
1004927734 6:20431925-20431947 AGCCATCTTGGAGCCGAGAGCGG - Intronic
1006978414 6:38124736-38124758 TGGCCTCAACCAGCCCAGAGAGG + Intronic
1007128825 6:39450337-39450359 TATCCTATAGGAGCTCAGAGAGG + Intronic
1007432024 6:41782014-41782036 CGCCCTCAAGGAGCTCATAGTGG - Intronic
1007950109 6:45864519-45864541 TGCCCTTTGGGAGCCCAAGGTGG - Intergenic
1009478146 6:64121025-64121047 TGACCTCTAGGAACTGAGAGTGG - Intronic
1014270539 6:119330946-119330968 TGCCCACATGGAGCCCAAAGGGG - Intronic
1014931263 6:127339523-127339545 AGCACTCTAGGAGACCAAAGTGG + Intronic
1015745701 6:136507291-136507313 TGGCCTCCAGGAGTCCAGAGAGG - Intronic
1019352171 7:559465-559487 TGCCCGGCAGGAGCCCCGAGTGG + Intronic
1019388360 7:771274-771296 TGCCCTCTAGGAGCACTGGGAGG + Intronic
1020179823 7:5913674-5913696 AGCCCTGTGGAAGCCCAGAGAGG + Intronic
1020303113 7:6811210-6811232 AGCCCTGTGGAAGCCCAGAGAGG - Intronic
1020781170 7:12518525-12518547 TGCCATCTAGGAGCTCGGGGAGG - Intergenic
1020803587 7:12761254-12761276 TGCCCTCAAGGAGTCCATAAAGG + Intergenic
1021613148 7:22476945-22476967 TGACCTCTAGGGGCTGAGAGTGG - Intronic
1021845443 7:24758006-24758028 TGCCCTCAAGGAGCTTAGAGTGG - Exonic
1023563288 7:41497787-41497809 AGCCCTCTATGAACCAAGAGAGG + Intergenic
1024001440 7:45192014-45192036 CGCCCTCGAGGAGCCCACAAAGG + Intergenic
1026583017 7:71633622-71633644 TGCCCTCTGAGGGCCCCGAGAGG + Intronic
1029425088 7:100489787-100489809 TGTTTTCTAGGAGACCAGAGAGG + Intronic
1031985247 7:128160234-128160256 TGCCTTCCAGGAGCTCAGAGGGG + Intergenic
1034447709 7:151122050-151122072 GGACCCCTGGGAGCCCAGAGGGG - Intronic
1035161891 7:156956891-156956913 TGTCCTCTAGGAGGACAGGGAGG - Intronic
1035242598 7:157542066-157542088 TGCCCTCTGGCAGTGCAGAGGGG - Intronic
1035840523 8:2807859-2807881 GGCCCTCTGGGAGCCAAGATGGG + Intergenic
1036823793 8:11960373-11960395 AGCACTTTAGGAGCCCAAAGTGG - Intergenic
1038782696 8:30581753-30581775 TGCTCTCAAGGAGCTTAGAGAGG - Intronic
1045836058 8:106523103-106523125 TGGCCCCTAGGAGCTGAGAGTGG - Intronic
1046792782 8:118339807-118339829 TGCCCTGGAGGAGCCCTGACAGG - Intronic
1047111485 8:121794082-121794104 TGCCCTCTGAGGCCCCAGAGAGG + Intergenic
1047588589 8:126302063-126302085 TTCCCTCTTGGTGCCCAGGGTGG - Intergenic
1047803380 8:128333022-128333044 TGCCCTCTAAGAGAACAGGGAGG - Intergenic
1049051573 8:140201086-140201108 AGGCCTCTAAGAGTCCAGAGGGG + Intronic
1049224510 8:141443420-141443442 TGCCCTCTCCGGGGCCAGAGTGG - Intergenic
1049331493 8:142056442-142056464 TGCCTTGCAGGAGCCCAGCGGGG - Intergenic
1050217750 9:3347071-3347093 AGCACTCTAGGAGGCCAAAGTGG + Intronic
1051063610 9:13074528-13074550 TGCCCTTTAGGAGGCCACAGAGG + Intergenic
1051135913 9:13920265-13920287 AGCCATCTAGGAGCACAGATAGG - Intergenic
1053475052 9:38376610-38376632 TGCCCACTTGGAATCCAGAGGGG - Intergenic
1053532910 9:38899420-38899442 TGCCTTATAGGAGCCCTTAGGGG - Intergenic
1053785704 9:41651115-41651137 TGCCCTCTAGGAAACCAGCTAGG - Intergenic
1054159328 9:61663064-61663086 TGCCCTCTAGGAAACCAGCTAGG + Intergenic
1054205137 9:62123849-62123871 TGCCTTATAGGAGCCCTTAGGGG - Intergenic
1054449277 9:65394126-65394148 TGCCCTCTAGGAAACCAGCTAGG - Intergenic
1054479102 9:65594069-65594091 TGCCCTCTAGGAAACCAGCTAGG + Intergenic
1054633223 9:67464521-67464543 TGCCTTATAGGAGCCCTTAGGGG + Intergenic
1055154338 9:73041955-73041977 TGCACTTTAGGAGGCCAAAGCGG - Intronic
1057063424 9:92026274-92026296 AGGCCTCCAGGAGCCCTGAGAGG + Intergenic
1057519951 9:95752368-95752390 TGCCCGGGAGGAGCCCAGCGAGG + Intergenic
1057889704 9:98860113-98860135 TGGCCTCTAGGCGCTCAGAGTGG + Intergenic
1060207908 9:121693395-121693417 TCCCCTCCTGGAGCCGAGAGAGG + Intronic
1060789262 9:126474855-126474877 GGCCTTCAAGGAGGCCAGAGTGG - Intronic
1061045717 9:128163808-128163830 TGCCCTCCTGGGGCCAAGAGTGG + Exonic
1061064494 9:128268904-128268926 TGCCCAGTAGGGGCCCAGTGAGG - Intronic
1061680254 9:132239523-132239545 TCCCCTCCAGTTGCCCAGAGAGG - Intronic
1061680494 9:132240611-132240633 ACCCCTCTAGTTGCCCAGAGAGG + Intronic
1061781905 9:133001066-133001088 CGCCCTCTTGGAGCTCAGCGGGG + Intergenic
1061795205 9:133082214-133082236 TGTCCCCTAGGTCCCCAGAGGGG - Intronic
1203467406 Un_GL000220v1:100528-100550 TATCCTATAGAAGCCCAGAGAGG + Intergenic
1186342686 X:8660525-8660547 AGCCCTCTAGGAGGCCAAGGTGG + Intronic
1187482495 X:19670710-19670732 TGCCAGCTAGGATCCCACAGAGG - Intronic
1187965977 X:24612125-24612147 TGGCCTCTAGGAGCTGAGGGTGG + Intronic
1188359403 X:29233950-29233972 TGGCCTCTAGGAGCAAAGAGTGG + Intronic
1189164672 X:38849205-38849227 TTCCCTCTATGAGCCCAGGCCGG - Intergenic
1190573616 X:51810681-51810703 TGGGCTATAGGAGCACAGAGAGG + Intronic
1192346766 X:70315856-70315878 TTCCCCCTAGGAGTTCAGAGTGG + Intronic
1194915968 X:99709100-99709122 TGACCTCTAGGAGCTGAAAGTGG - Intergenic
1198537026 X:137596704-137596726 TGCCCTCAAGGTGCTCATAGGGG + Intergenic
1198782470 X:140252352-140252374 TGCCCTCTGGGAGCTCACAGTGG + Intergenic
1200293988 X:154899242-154899264 TGCCTTCTAGAAGCCCAAACAGG - Intronic