ID: 1081239757

View in Genome Browser
Species Human (GRCh38)
Location 11:40690549-40690571
Sequence CTGAATATGCCAATGTAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 1, 2: 1, 3: 25, 4: 282}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081239757_1081239758 -10 Left 1081239757 11:40690549-40690571 CCATTTTACATTGGCATATTCAG 0: 1
1: 1
2: 1
3: 25
4: 282
Right 1081239758 11:40690562-40690584 GCATATTCAGTCTCTTAGAACGG 0: 1
1: 0
2: 0
3: 14
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081239757 Original CRISPR CTGAATATGCCAATGTAAAA TGG (reversed) Intronic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
904985872 1:34548249-34548271 CTGAATATAAAATTGTAAAATGG - Intergenic
906337819 1:44949404-44949426 CTGAATATACAAAGATAAAAGGG - Intronic
906444206 1:45880281-45880303 TTGAAGAAGCCTATGTAAAAAGG + Intronic
907587538 1:55634508-55634530 GTGAATATGCCATTTTAAGATGG - Intergenic
908224400 1:62041353-62041375 GAGAATATGCCACTCTAAAAAGG - Intronic
908321215 1:62980831-62980853 CTTAATATGCTAATGCAATATGG - Intergenic
909895251 1:81061115-81061137 CAGAGGAGGCCAATGTAAAAGGG + Intergenic
910789096 1:91032414-91032436 CTGCTTATGGGAATGTAAAATGG + Intergenic
913141511 1:115945938-115945960 CTGAATATTCTAAAGTAAGAGGG + Intergenic
913754360 1:122056105-122056127 TTGAACATTCCAATGGAAAAGGG + Intergenic
915178728 1:154039815-154039837 ATCAATATTCCAATGTAAGAAGG - Intronic
916298344 1:163245681-163245703 CTGATTATGCATCTGTAAAATGG + Intronic
916405926 1:164497907-164497929 CTGAAAATGCAAATGTCATAGGG - Intergenic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
917880616 1:179332135-179332157 CTGAGTATTACAATGAAAAAAGG - Intronic
921558601 1:216629210-216629232 CTAAATAAGTCAATGTATAAAGG + Intronic
921821262 1:219619768-219619790 CTTAATTTCCTAATGTAAAATGG - Intergenic
922304705 1:224334203-224334225 CTGAACATGTGAATGAAAAATGG - Intergenic
923608247 1:235464968-235464990 CTGACTATGGAAATGTAAAGTGG + Intronic
924786926 1:247207486-247207508 CTGAATATGGCAATGGAAAGTGG + Intergenic
1063154442 10:3365462-3365484 CTGGATATGTCAAGGTAAATGGG + Intergenic
1065248685 10:23786939-23786961 CTGAATATGACAATGAGAAATGG + Intronic
1066196521 10:33105807-33105829 CTGAATACGCCTATGGAAGAAGG - Intergenic
1068650664 10:59519120-59519142 CTGAATTGGCCACTTTAAAATGG - Intergenic
1069289114 10:66754843-66754865 CTGCAGATGAGAATGTAAAATGG + Intronic
1070080939 10:73186991-73187013 CTGAATTTGACAATTTAAAAGGG + Intronic
1070466585 10:76730170-76730192 ATTAATATGCAAATGTATAATGG - Intergenic
1071007151 10:80895910-80895932 TTGAATATACAAATTTAAAAGGG - Intergenic
1071595436 10:86919293-86919315 CTGAATAAGCCAATTTAAGCAGG - Exonic
1071684446 10:87739945-87739967 CTACATATACCAATGTACAATGG + Intronic
1071794258 10:88988811-88988833 CTTAGTATGCTAATGTCAAAGGG - Intronic
1072546045 10:96440080-96440102 CTGAATAGGACAATGTGAAGGGG - Intronic
1072927565 10:99629862-99629884 CTGAATAGTCCACTTTAAAATGG + Intergenic
1072971175 10:100019046-100019068 CTCAATATGCCAGTCTAAGATGG + Intergenic
1073497121 10:103902571-103902593 CTGAGTATTCGAATGTTAAAGGG - Intronic
1077926324 11:6684907-6684929 CTGAATATGTACATGTAAAGAGG - Intergenic
1077939825 11:6829159-6829181 ATGAATATGCCAATGAAAGATGG - Intergenic
1080941528 11:36923528-36923550 CTGAATTTGACATTTTAAAAAGG + Intergenic
1081239757 11:40690549-40690571 CTGAATATGCCAATGTAAAATGG - Intronic
1082310421 11:50639426-50639448 GTGAATATACCAAGATAAAAAGG + Intergenic
1085149813 11:74241588-74241610 CTGCAAGTGCGAATGTAAAAGGG - Intronic
1085330773 11:75648754-75648776 CTGAATAGGACAATGGGAAAGGG + Intronic
1091404433 12:200411-200433 CTGAATATTCTTATGTAAACCGG + Intronic
1092696532 12:11177737-11177759 CTCAAAATGCCATTGTAATAGGG + Intergenic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1096055818 12:48651090-48651112 GTGAATATGCTATTGTAAAATGG - Intergenic
1096520995 12:52184422-52184444 CTGAATTGGCCAGTCTAAAAGGG - Intronic
1096612633 12:52813171-52813193 CTGATTTTGCAAATGAAAAAGGG - Intronic
1097728704 12:63103679-63103701 CTGTATTTGTCAATGTTAAAGGG + Intergenic
1098443440 12:70542047-70542069 CTGCTTATGAGAATGTAAAATGG - Intronic
1099461362 12:82925690-82925712 GTGACTATGCCCATATAAAATGG + Intronic
1100328653 12:93565845-93565867 CTGAATATGTCAGAATAAAAGGG - Intergenic
1100355095 12:93821307-93821329 CTGAAAATGCCAATGTCTACAGG - Intronic
1100928907 12:99584078-99584100 CCAGATATGACAATGTAAAAAGG + Intronic
1101127169 12:101648129-101648151 AAGATGATGCCAATGTAAAATGG + Exonic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104495533 12:129233542-129233564 GTGATTATGTCAATGTAACATGG + Intronic
1106874461 13:34056531-34056553 CTAAATATGCCATTTTTAAAAGG - Intergenic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1107960358 13:45552108-45552130 TTAAATTTGCCAATGTATAAAGG + Intronic
1108468625 13:50744959-50744981 CTGATGATGGAAATGTAAAATGG + Intronic
1108899597 13:55384293-55384315 CTGAATATCTCCATGAAAAAAGG + Intergenic
1109510802 13:63369798-63369820 CTGTAAGTGCCAATGTAAATAGG - Intergenic
1111245289 13:85530187-85530209 CTGAATATGCTGTAGTAAAAAGG - Intergenic
1112795355 13:103050717-103050739 CTGAATATGTCATTCTAAATAGG - Intronic
1112890898 13:104230080-104230102 CTGAAATTCCCAATGTTAAAAGG + Intergenic
1113629858 13:111874758-111874780 CTAAATATACCAATGGACAATGG - Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1116142614 14:41018065-41018087 AGGAATAATCCAATGTAAAATGG - Intergenic
1117273228 14:54166374-54166396 CTGAAGACAACAATGTAAAAAGG + Intergenic
1117392734 14:55277842-55277864 CTGAATAAGCCAAAGTAAAAAGG - Intronic
1117753461 14:58947903-58947925 ATAAATATGCAAATGTAAAGTGG - Intergenic
1117838671 14:59834140-59834162 ATGAATATCCAAATGCAAAAAGG + Intronic
1118784201 14:69032381-69032403 CAGAATGTGACAATGTAGAAAGG + Intergenic
1120124380 14:80723608-80723630 CTGAATATTTTAATGCAAAAAGG - Intronic
1120603818 14:86546479-86546501 CTGATAAGGCCAATATAAAAGGG + Intergenic
1120840371 14:89080251-89080273 CTGAATATGCCTGTGTAACCAGG - Intergenic
1120950702 14:90039338-90039360 CAGAGTAGGCTAATGTAAAATGG + Intronic
1121382937 14:93490046-93490068 CTGAATTTTACAATGTAAGAAGG + Intronic
1121430747 14:93885787-93885809 GTGAATAAGCCAGTGTGAAAAGG - Intergenic
1123954181 15:25316704-25316726 CTGATGATGGGAATGTAAAATGG + Intergenic
1127187891 15:56498942-56498964 TTAAATATGCAAATGTATAAAGG - Intergenic
1129830909 15:78669370-78669392 TTTAATATGCCAATGTAAATTGG - Intronic
1130857290 15:87851732-87851754 CAGACTGTGCCATTGTAAAATGG - Intergenic
1131773787 15:95771507-95771529 ATAAATATATCAATGTAAAAAGG + Intergenic
1131881024 15:96862293-96862315 CTGAATATGAGACTATAAAATGG - Intergenic
1133440908 16:5820252-5820274 CTGAATAAGACAATGTAGCATGG - Intergenic
1133911977 16:10074268-10074290 CTGATTGTGAGAATGTAAAATGG + Intronic
1135321304 16:21499007-21499029 CTGAATATGTGAATGTCATATGG - Intergenic
1135374137 16:21930509-21930531 CTGAATATGTGAATGTCATATGG - Intergenic
1135437649 16:22440212-22440234 CTGAATATGTGAATGTCATATGG + Intergenic
1135715986 16:24767466-24767488 GTGTATATTCCAATTTAAAAGGG - Intronic
1137050200 16:35704311-35704333 CTGGATATCCCATTGTAAAAGGG + Intergenic
1138484266 16:57326769-57326791 TTGATTATGGGAATGTAAAATGG - Intergenic
1138786705 16:59854956-59854978 CTTAATATGCCTATGCAAGAGGG + Intergenic
1141350126 16:83287057-83287079 CTGAAGGTACCCATGTAAAAAGG + Intronic
1141403653 16:83772857-83772879 CTGAACATGTCAAAGAAAAATGG + Intronic
1143797711 17:9351087-9351109 CTATATAGGCCAATGTTAAATGG + Intronic
1144125874 17:12202487-12202509 ATGAATCTGCCAAAGGAAAATGG - Intergenic
1144151024 17:12446374-12446396 CTGCTGATGGCAATGTAAAATGG - Intergenic
1145098730 17:20055414-20055436 CTGTTTATGAGAATGTAAAATGG - Intronic
1146120013 17:30184467-30184489 CTGATTATCCAAATGCAAAAAGG - Intronic
1146402610 17:32511830-32511852 CTGAATAAGCAAATATATAATGG - Intronic
1148667169 17:49383366-49383388 CTGAATATTCCCATGGAAACTGG - Intronic
1151521810 17:74635573-74635595 CTGAGTCTGCCCATTTAAAAGGG - Intergenic
1151566593 17:74902021-74902043 CTGATAATGACAATGAAAAATGG + Intergenic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1155838023 18:30612091-30612113 CTGGATATGCCAAGGAAGAAAGG + Intergenic
1156610293 18:38717113-38717135 CCCACTATGCCTATGTAAAACGG + Intergenic
1156865385 18:41883692-41883714 CTGAAAATGACAATGTCATAGGG + Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159637737 18:70825914-70825936 CTGAATACGCAAATGGATAATGG - Intergenic
1159974123 18:74689714-74689736 CTGAAGTTGCCCATGTCAAAAGG + Intronic
1160007736 18:75080543-75080565 CTCAATTTGGAAATGTAAAAAGG + Intergenic
1160544068 18:79641251-79641273 CTGAATATTCCACTGTAGGACGG + Intergenic
1162711420 19:12597490-12597512 CTGAATAGGCCACTTAAAAATGG - Intronic
1163295619 19:16410405-16410427 CTGCTTATGGGAATGTAAAATGG + Intronic
1164574909 19:29400431-29400453 CTCACTATGCCAAGGGAAAAGGG - Intergenic
1166649479 19:44561309-44561331 CAGAATATGCGAAGGAAAAATGG + Intergenic
1167506778 19:49875119-49875141 CTGAGTTTGCAACTGTAAAATGG - Intronic
926835863 2:17019128-17019150 GTGAAAAGGCCAATGTCAAAAGG - Intergenic
927045798 2:19276895-19276917 CTGAAATTGCCAATTTATAATGG - Intergenic
928836305 2:35550759-35550781 CTAAATATGACAATCTTAAAAGG + Intergenic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
933156186 2:78978455-78978477 GGGAAGATTCCAATGTAAAATGG + Intergenic
933231835 2:79816845-79816867 CTAGGTATGCCACTGTAAAAAGG - Intronic
933357405 2:81229680-81229702 CTCAATATTGCAAGGTAAAAGGG + Intergenic
933693922 2:85201701-85201723 CTGCTGATGGCAATGTAAAATGG - Intronic
936488197 2:112945617-112945639 TGGAATATGCCAGTGGAAAATGG + Intergenic
936781836 2:116042304-116042326 CTGAAGCTGTAAATGTAAAATGG + Intergenic
938575765 2:132602697-132602719 CTGAATAATCTGATGTAAAATGG + Intronic
939234302 2:139471080-139471102 CTGAATATACCAATGGACCATGG - Intergenic
940664776 2:156594831-156594853 ATGAATAAGCCAATGTTGAAAGG + Intronic
941544366 2:166829455-166829477 CTGAATCTGTCAATCTGAAATGG + Intergenic
941926655 2:170902329-170902351 CTGAATATGCAAATGGAATAAGG + Intergenic
943650610 2:190454152-190454174 CTCATTAAGCCATTGTAAAATGG - Intronic
943667593 2:190626425-190626447 CTTAATATGGTAATATAAAAGGG - Intergenic
944188014 2:196971035-196971057 TTGAATATGCCTATGGACAAGGG - Intronic
944189566 2:196987402-196987424 CAGAATATACAAATATAAAAAGG + Intronic
944865960 2:203862052-203862074 CTGAATATTCAAATGTCTAAGGG - Intergenic
945539295 2:211064284-211064306 CTAAATATACCAATTTCAAAAGG - Intergenic
945629470 2:212255317-212255339 CTGAATTAGCCACTTTAAAAAGG - Intronic
946816804 2:223587177-223587199 CTGAAAATGCCAAGGTCAAAAGG + Intergenic
947809461 2:232993461-232993483 CTGCAGATGGGAATGTAAAATGG + Intronic
947939924 2:234044240-234044262 CTGTTTATGTGAATGTAAAATGG + Intergenic
1168908332 20:1424795-1424817 CTGAAAGTGGGAATGTAAAATGG - Intergenic
1170008183 20:11691876-11691898 CTGAAAAAGCCAATCTGAAAAGG + Intergenic
1170193951 20:13671429-13671451 CTGAAGATGACAAAGAAAAAAGG + Intergenic
1170202121 20:13755823-13755845 CTGTATAACCCAATGTAAAAAGG + Intronic
1170912560 20:20588597-20588619 CAGAATATACAAATGTAAACTGG + Intronic
1170937177 20:20820561-20820583 CTGAATGTGCTATTGTTAAAGGG - Intergenic
1170991794 20:21308456-21308478 CTGCTGATGCCAATGTAAAATGG - Intronic
1172328708 20:34058587-34058609 GTGAACATGTCAATGTGAAATGG - Intronic
1172564715 20:35919943-35919965 GTGATTATGCCAATGTCAAATGG - Intronic
1172725468 20:37037324-37037346 ATGAATATACAAATGTAAAGCGG + Intronic
1173556351 20:43968727-43968749 CTGAAGATGGCAATGGGAAAAGG + Intronic
1174059224 20:47820873-47820895 CTAAATAAGCCAAGATAAAATGG + Intergenic
1176865569 21:14051895-14051917 CACAATAAGCCAATTTAAAATGG + Intergenic
1176985785 21:15434051-15434073 CGGAATCTGCCAAAGTAAACTGG + Intergenic
1177225423 21:18246407-18246429 CTTAATATGCCAATGTCTAAAGG - Intronic
1177303038 21:19274802-19274824 CTAAATATGGCAATGTAAACAGG - Intergenic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
949256205 3:2049472-2049494 CTGAATTTTCCAATGAAATAAGG + Intergenic
951074640 3:18375095-18375117 ATGAATATGTCAATGAAGAAAGG + Intronic
951212511 3:19991195-19991217 CTGACTATGCCACTTTAAAAAGG - Intronic
952761284 3:36916625-36916647 AGAAATAAGCCAATGTAAAATGG + Intronic
953296880 3:41727773-41727795 CAGACTATGGAAATGTAAAAAGG + Intronic
954784983 3:53085999-53086021 CTGATTATGCCAAGGTAATTGGG + Intronic
955457850 3:59143949-59143971 CTGAGTATGCCAATGGGAATGGG + Intergenic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956454706 3:69409180-69409202 CTGAATGTGTGAATGCAAAAGGG + Intronic
957127600 3:76182195-76182217 CAGAAAAGGCCAATGTAAACTGG - Intronic
957542004 3:81583627-81583649 CTGAAAATGCCAATCCAGAAAGG + Intronic
958459706 3:94379462-94379484 CTGGAAATGCCTAAGTAAAATGG + Intergenic
959710574 3:109381921-109381943 CTGAATGTACAAATGAAAAATGG + Intergenic
960738972 3:120811713-120811735 GTGAATCTCCCAATCTAAAAAGG - Intergenic
961021142 3:123508173-123508195 CTGAATATGCAACTTTGAAACGG - Intronic
963052075 3:141150898-141150920 CAGAATATGGGAATGTCAAATGG - Intergenic
963594732 3:147311545-147311567 CTGAAAATGCCAATTTATCAAGG - Intergenic
963928841 3:150980701-150980723 ATGAATACCCCAATTTAAAATGG + Intergenic
964028987 3:152114724-152114746 CTGAGGATGCAAATGTAAAGAGG - Intergenic
965907729 3:173729889-173729911 ATAGATATGCAAATGTAAAATGG - Intronic
967794137 3:193580064-193580086 CTGGATATGTTAAAGTAAAAAGG + Intronic
968724571 4:2238892-2238914 TTGAATATGCCAGTGGTAAAGGG - Exonic
970065519 4:12089499-12089521 ATTAATATGCAAATGGAAAAGGG - Intergenic
970505488 4:16725319-16725341 TTGAATATGCCAATAGACAATGG + Intronic
970622336 4:17836060-17836082 CTGAAGATGGAAATTTAAAATGG - Intronic
970956276 4:21815292-21815314 ATGAAGATGATAATGTAAAATGG + Intronic
971863009 4:32133004-32133026 CAGAATATGCCAATTTTATAAGG + Intergenic
972577932 4:40369006-40369028 CTGGATAAGGAAATGTAAAAAGG - Intergenic
972869053 4:43273462-43273484 TTGAATCTGGCAATGTAAGAGGG + Intergenic
973139212 4:46745157-46745179 CTAAATATTCCAATCTAAATGGG - Intronic
973909286 4:55563372-55563394 TTGAATATGTTTATGTAAAATGG - Intronic
974201227 4:58643370-58643392 CTGAATTTGCCTATGAACAATGG + Intergenic
974621308 4:64359376-64359398 TTGAATATGCCACAGTATAATGG - Intronic
974777373 4:66502817-66502839 CTGAATTTGCCCTTGTCAAAGGG - Intergenic
975122165 4:70740188-70740210 CTGAGCATGCCAAGGTAAAGTGG + Intronic
975261698 4:72309759-72309781 ATGACTATGACAATTTAAAATGG - Intronic
975599258 4:76082297-76082319 CTGAATATGCCAAGGTAAAATGG - Exonic
976775602 4:88702869-88702891 CTGAATATTCCTATGGACAATGG + Intronic
977434568 4:96977111-96977133 TGGAATATGACAATGTTAAAAGG + Intergenic
977593037 4:98848275-98848297 TTGAACCTGCCACTGTAAAATGG + Intergenic
978552800 4:109946020-109946042 CAGAATATGCCACTCCAAAATGG - Intronic
979080370 4:116330879-116330901 CTGATAATGGCAAAGTAAAAAGG + Intergenic
979595267 4:122527796-122527818 ATGAAAATGCCACTGTAATAGGG - Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
982681575 4:158437387-158437409 AAGAATATGCCAATGGGAAAAGG + Intronic
983698714 4:170565401-170565423 ATGAATAAGCCAATGCAGAAAGG - Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
989472980 5:41842420-41842442 CTGCATGTGCCTATATAAAAGGG + Intronic
990387036 5:55275243-55275265 ATGTATATGCCAAGATAAAAAGG - Intronic
990405033 5:55480885-55480907 CGGAATGTGGGAATGTAAAAGGG - Intronic
992349378 5:75913337-75913359 CTGAATATGCCATTGTATCTAGG + Intergenic
992703968 5:79369342-79369364 TTGAATAGGCCAATTTATAAAGG + Intergenic
993146341 5:84098191-84098213 CTGAACATATAAATGTAAAATGG + Intronic
993460860 5:88179256-88179278 CTGAATATGAAAGTCTAAAATGG - Intergenic
993570162 5:89526782-89526804 CTGGTTATGCCAATGACAAAGGG + Intergenic
994250854 5:97535308-97535330 CTGTTGATGCCAATGTAAGATGG - Intergenic
994838175 5:104884403-104884425 TTGATTATGAGAATGTAAAATGG + Intergenic
995554921 5:113317780-113317802 ATGAAGATGCAAATGGAAAAAGG + Intronic
995971762 5:117980871-117980893 CAGAATATTCAAATTTAAAAAGG + Intergenic
995982796 5:118126296-118126318 CTGTTAATGGCAATGTAAAATGG + Intergenic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
997171602 5:131727815-131727837 CTAAATATGGCAAGGGAAAACGG - Intronic
997225342 5:132205470-132205492 CTCAAAATGTGAATGTAAAATGG + Intronic
1000036220 5:157450271-157450293 TTTAATATGCTAATGTACAATGG + Intronic
1000532271 5:162438089-162438111 CTGACCATGCCCATATAAAAAGG + Intergenic
1001717771 5:173830924-173830946 GTGAAAATGCCCATGAAAAAGGG + Intergenic
1002762431 6:212248-212270 GTGAATAAGATAATGTAAAATGG + Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1005563904 6:27069562-27069584 CTGACTTTGCCAAAGGAAAAGGG + Intergenic
1009478995 6:64131656-64131678 CTGAATATGCAGATGAAAAATGG + Intronic
1009649472 6:66455809-66455831 TTATATATGCAAATGTAAAATGG + Intergenic
1010772277 6:79845546-79845568 GTGCAAATGCCAATGGAAAAAGG + Intergenic
1011262379 6:85482979-85483001 TTTAATATGCCAATGACAAAAGG + Intronic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1014753354 6:125277052-125277074 CTGAGTAAGCCAAACTAAAATGG + Intronic
1015075971 6:129158110-129158132 CTGAATAAGCCAATTTAAGCAGG + Intronic
1015217978 6:130772100-130772122 TTGAAGAAGCCAATGTGAAACGG + Intergenic
1016711145 6:147173326-147173348 CTGAATCTGGCACTATAAAAAGG - Intergenic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1017184726 6:151589321-151589343 CTGAGTATGGTAATGTAAATTGG + Intronic
1018278227 6:162156194-162156216 CTGAATAGGCCACTGAATAATGG + Intronic
1018339417 6:162834929-162834951 CTTAATATGCCAAAATAAAGGGG - Intronic
1018588949 6:165395025-165395047 CTAAATATTCCAATAAAAAAGGG - Intronic
1020484776 7:8708030-8708052 ATGAATATGCAAATTTTAAATGG + Intronic
1021343780 7:19497285-19497307 TTGAATATGGCACAGTAAAATGG + Intergenic
1023325124 7:39046055-39046077 CTGCTGATGCTAATGTAAAATGG - Intronic
1024946831 7:54816634-54816656 TTTAAAATGCCAATTTAAAAAGG - Intergenic
1026300898 7:69097129-69097151 ATGAATATTGCAATGTAAAGGGG + Intergenic
1026478495 7:70758714-70758736 CTGAATTTGCCAAAGGATAAAGG - Intronic
1027931276 7:84538039-84538061 CTGAAAATGAAAATGTAAAGAGG - Intergenic
1028075484 7:86508588-86508610 CAGAATATGACAAAGGAAAAGGG + Intergenic
1028270825 7:88786885-88786907 CTAAATATACAAATGAAAAAAGG + Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1031963515 7:128010665-128010687 CTGAGGATGCCAAAGTAATAGGG - Intronic
1033460446 7:141542623-141542645 CTGGATATGGCAATATAAAGAGG - Intergenic
1034055220 7:148027220-148027242 CTGAATAGGCCTATGGAGAAAGG - Intronic
1034484660 7:151351521-151351543 TCAAATAAGCCAATGTAAAAAGG - Intronic
1036038242 8:5043673-5043695 ATAAATATGGCAAAGTAAAATGG - Intergenic
1037151255 8:15637855-15637877 CAGAATATGCCACTGCAAGAAGG - Intronic
1037421906 8:18711141-18711163 CTGAATATGGAAAGGGAAAATGG + Intronic
1037551834 8:19981984-19982006 GTGAATATGTTAATGTCAAAAGG - Intergenic
1039396532 8:37230222-37230244 CCCAATATGCAAATGGAAAAGGG + Intergenic
1039714836 8:40096680-40096702 CTGAATAAAACAATCTAAAATGG - Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040042818 8:42933644-42933666 CTGAAGATGCCACTAGAAAATGG - Intronic
1041443914 8:57929437-57929459 CTGAATATACCAATGGATAATGG - Intergenic
1041626171 8:60029840-60029862 TTGAATATGCATATTTAAAACGG - Intergenic
1043165119 8:76893802-76893824 CAGAAGAGGCCAATGTAAGATGG - Intergenic
1043614566 8:82109531-82109553 ATGAATTTGCCAAAGGAAAAGGG + Intergenic
1043879094 8:85521311-85521333 ATAAATATGTAAATGTAAAATGG - Intergenic
1044018859 8:87079416-87079438 CTGATAATGGAAATGTAAAATGG - Intronic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1044802779 8:95974403-95974425 CTGAAGAAGCCATTGTAAAAAGG + Intergenic
1045668604 8:104520113-104520135 CTGAATATACCCACCTAAAATGG + Intronic
1048108704 8:131442458-131442480 CTAATTATACCACTGTAAAAAGG + Intergenic
1049238124 8:141522950-141522972 CTGAATAGGCCAATGTGATCTGG + Intergenic
1049467711 8:142759994-142760016 CTGAATTAGCCACTGTAAACGGG - Intergenic
1049467819 8:142760778-142760800 CTGAATTAGCCACTGTAAACGGG - Intergenic
1049467845 8:142760974-142760996 CTGAATTAGCCACTGTAAACGGG - Intergenic
1049467871 8:142761170-142761192 CTGAATTAGCCACTGTAAACGGG - Intergenic
1049467877 8:142761219-142761241 CTGAATTAGCCACTGTAAACGGG - Intergenic
1052079864 9:24191207-24191229 TTAAAAATGCCAATGTATAAAGG - Intergenic
1052827796 9:33189630-33189652 CTGAATAGGGCAGTGAAAAAAGG + Intergenic
1052973344 9:34393922-34393944 ATGAGTAGGCAAATGTAAAAAGG - Intronic
1055611071 9:78024990-78025012 CTGATTATGGCTATGTATAAAGG + Intronic
1056919311 9:90772209-90772231 CTGAAAAAGCCAAGGTAGAAGGG - Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1186931046 X:14390487-14390509 CTGGTTATGGAAATGTAAAATGG + Intergenic
1187619931 X:21040942-21040964 CTGAATTTGGCAATGTGAAGGGG - Intergenic
1187761215 X:22587887-22587909 ATGAATGTGCAAATGTATAAGGG - Intergenic
1188170164 X:26914592-26914614 GTAAATATGCAAGTGTAAAAGGG - Intergenic
1189621860 X:42849259-42849281 CTGCTTATGCGAATGTAGAATGG + Intergenic
1190428787 X:50357881-50357903 CTGCTTATGGGAATGTAAAATGG - Intergenic
1190469771 X:50766718-50766740 TTGAATATATAAATGTAAAAAGG + Intronic
1193710890 X:84878363-84878385 CTTAATATGCCAATGAACAATGG - Intergenic
1194231479 X:91330622-91330644 CTGGATATGCTCATGTAAATAGG - Intergenic
1194401868 X:93447311-93447333 CTGATTATGTCAATCTCAAAAGG + Intergenic
1194697537 X:97073127-97073149 CTAAATATGCCTGTTTAAAAAGG - Intronic
1195813971 X:108865322-108865344 CCAAATAATCCAATGTAAAATGG - Intergenic
1196631904 X:117950998-117951020 CTTAAAAAGCCAATGGAAAATGG - Intronic
1197194783 X:123688014-123688036 CTGCTGATGGCAATGTAAAATGG + Intronic
1199291973 X:146114385-146114407 CTGAAAATGCCAATGTACTCCGG + Intergenic
1200898842 Y:8407061-8407083 TTGAATGTGCCACTGAAAAAAGG + Intergenic