ID: 1081240086

View in Genome Browser
Species Human (GRCh38)
Location 11:40694781-40694803
Sequence CACACTGCACAAATTGATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081240085_1081240086 16 Left 1081240085 11:40694742-40694764 CCTATACATTGCAGCACAGAAAA 0: 2
1: 0
2: 0
3: 23
4: 223
Right 1081240086 11:40694781-40694803 CACACTGCACAAATTGATATAGG 0: 1
1: 0
2: 0
3: 10
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081240086 Original CRISPR CACACTGCACAAATTGATAT AGG Intronic
903139903 1:21333172-21333194 CACACTGAACAAACAGGTATTGG + Intronic
908702562 1:66918589-66918611 AACCCTGGAAAAATTGATATAGG - Intronic
911369400 1:96978568-96978590 CACCCTACACAAATTGCTAGTGG + Intergenic
917429735 1:174953643-174953665 GACACTGCACAAAATGAAATGGG - Intronic
919068515 1:192724385-192724407 TACGCTGCAAAAATTGATTTAGG - Intergenic
1062944378 10:1449431-1449453 CACACAGGACCAATGGATATGGG - Intronic
1064200551 10:13281116-13281138 CAAAGTGAACAAATTGATATTGG + Intronic
1064862879 10:19846669-19846691 CACACTGCATATCTTGACATTGG - Intronic
1074068421 10:110040402-110040424 CACACAGCACAAATTTAGTTTGG + Intronic
1078298754 11:10103243-10103265 CATACTTCATAATTTGATATTGG - Intronic
1079485253 11:20929459-20929481 CACACTGCACCCATTGCTCTGGG + Intronic
1081240086 11:40694781-40694803 CACACTGCACAAATTGATATAGG + Intronic
1085135201 11:74080952-74080974 AAGTCTGCACAAGTTGATATGGG - Intronic
1098767826 12:74512250-74512272 CACACAACACAAACTGAAATTGG + Intergenic
1099764759 12:86969422-86969444 AAAACTGGACAAATTGTTATTGG + Intergenic
1100933060 12:99632584-99632606 CATTCTGCACAAACTGATGTGGG - Intronic
1101953969 12:109197595-109197617 CACACTGAACAAACAGATAGTGG + Intronic
1102444481 12:112991279-112991301 CAGACAGCACAAATTGCTACTGG - Intronic
1105788327 13:23771093-23771115 CACACTGCAACAAGTGCTATGGG + Intronic
1107348780 13:39491703-39491725 CACATTGCAGAAATTTGTATTGG - Intronic
1108401142 13:50045294-50045316 CAAACTGCACATAGTTATATAGG - Intergenic
1108992050 13:56671943-56671965 CACATTTCATAACTTGATATTGG + Intergenic
1109405671 13:61895487-61895509 CACACTGCAAAAATATATAATGG + Intergenic
1110050715 13:70894956-70894978 CTCTCTTCACAATTTGATATAGG - Intergenic
1111897026 13:94154872-94154894 CTTACTGAACAAAATGATATTGG - Intronic
1112697532 13:101967418-101967440 TATACTGCAGAAACTGATATTGG - Intronic
1113886486 13:113662859-113662881 CAATCTCCCCAAATTGATATAGG + Intergenic
1114058166 14:18993395-18993417 CAAGCTGCTCACATTGATATTGG + Intronic
1114104381 14:19408359-19408381 CAAGCTGCTCACATTGATATTGG - Intronic
1119196534 14:72721120-72721142 CACAGTGCAGAAATAGAGATAGG + Intronic
1123497288 15:20840946-20840968 CAAGCTGCTCACATTGATATTGG - Intronic
1123533164 15:21160044-21160066 TACACTGGAAAAATTGAGATTGG + Intergenic
1123590767 15:21851899-21851921 CAAGCTGCTCACATTGATATTGG - Intergenic
1127696038 15:61448885-61448907 GACACTGCTGAAATTGATACAGG - Intergenic
1202962868 15_KI270727v1_random:141778-141800 CAAGCTGCTCACATTGATATTGG - Intergenic
1137747016 16:50829843-50829865 CTCACTGCTGAAATTGATACAGG + Intergenic
1139738232 16:69011911-69011933 CACAATGCCAGAATTGATATAGG + Intronic
1144324083 17:14161133-14161155 CACACTGGACAAAGTAAGATGGG - Intronic
1145049298 17:19647419-19647441 CACATTGCACAAATAGAAAAAGG + Intergenic
1146467574 17:33098307-33098329 CACACTGCCCAATTTTAGATAGG - Intronic
1154455310 18:14517354-14517376 CAAGCTGCTCACATTGATATTGG - Intronic
1155721270 18:29015084-29015106 TACACTGAACAAATAGAAATTGG - Intergenic
1158035036 18:53017877-53017899 CACCATGCAGAAATTGACATGGG - Intronic
1158093131 18:53738830-53738852 CACATTCCACATATTGATTTTGG + Intergenic
1158801876 18:60921064-60921086 CAAACTGGACAAATTGATAGTGG - Intergenic
1160426927 18:78784014-78784036 CACACTACACACATGCATATGGG + Intergenic
1162923324 19:13917010-13917032 CACACTGCATAAATATATTTTGG + Intronic
930755936 2:54972772-54972794 CACAGTGCACAAACTGAAAAGGG + Exonic
931228490 2:60353902-60353924 CACACTGAACAAATTAAAAATGG + Intergenic
935331532 2:101981006-101981028 CAAACTGCACGAAGTGATATCGG - Intergenic
935635312 2:105245309-105245331 CAGTCTGAACAAACTGATATAGG - Intergenic
938476575 2:131620335-131620357 CAAGCTGCTCACATTGATATTGG + Intergenic
942139993 2:172968109-172968131 GGCACTCCACAAATTGCTATGGG + Intronic
944403220 2:199352409-199352431 CTTACTGCACCAATTCATATAGG - Intronic
944665040 2:201952622-201952644 CACACTGCACAAAATAAGGTTGG + Intergenic
1171216452 20:23356129-23356151 CACACACCCCAAATTGATAATGG - Intergenic
1173028524 20:39332512-39332534 GACACTGCTCCAATTGAAATGGG + Intergenic
1173457677 20:43216519-43216541 CACACTTCCCAAATAGATTTTGG - Intergenic
1174641327 20:52046957-52046979 CACACTAAACAAATTGCTATGGG + Intergenic
1176818859 21:13635958-13635980 CAAGCTGCTCACATTGATATTGG + Intronic
1177308303 21:19350718-19350740 CACACAGCAAAAATAGATAACGG - Intergenic
1177392026 21:20487644-20487666 CACAATACACAAAATTATATTGG + Intergenic
1180476653 22:15716011-15716033 CAAGCTGCTCACATTGATATTGG + Intronic
1180627142 22:17201316-17201338 CACACTGAACAAATTCATAAGGG - Intronic
1181446635 22:22981358-22981380 CTCACTTCACAAATGGTTATAGG - Intergenic
1182753984 22:32663939-32663961 CACACTGCACATTTTGAAAAAGG + Intronic
951874302 3:27404445-27404467 CACACTGTAGAAATGAATATAGG - Intronic
952713145 3:36452535-36452557 CTCACTTAACAAATTCATATTGG - Intronic
953839602 3:46378805-46378827 CACACTGCAGAGATTGGTCTGGG - Intergenic
957640209 3:82843967-82843989 CACAATGAAAAAAATGATATAGG + Intergenic
959718079 3:109455671-109455693 CAGCCTGCACAAGTTGATCTTGG + Intergenic
960266653 3:115627796-115627818 CACACTTCACAAATTGAAAAGGG - Intronic
965656735 3:170994145-170994167 CACACTTTAAAAACTGATATTGG - Intergenic
966039706 3:175467008-175467030 CACACTGCACACAGTTATAATGG + Exonic
968044992 3:195619016-195619038 CACAATGGACATATTGACATTGG + Intergenic
968060776 3:195725068-195725090 CACAATGGACATATTGACATTGG + Exonic
969398740 4:6939670-6939692 CACACTGCAGAGACTGATAAGGG + Intronic
971551938 4:27968466-27968488 CATATTTTACAAATTGATATAGG - Intergenic
973998764 4:56488286-56488308 CACACTGACGAAAATGATATAGG - Intronic
974300526 4:60060105-60060127 TACACTGCTCACATTCATATGGG + Intergenic
975891904 4:79039754-79039776 CAGACTGCTTATATTGATATTGG + Intergenic
979869997 4:125807239-125807261 CAAACTCCAGAAATTTATATTGG - Intergenic
979942960 4:126785561-126785583 CACACTGGAAAAATTGTCATGGG + Intergenic
980556172 4:134408504-134408526 CACACTGAACACAATCATATTGG - Intergenic
980699402 4:136404220-136404242 CAGACTTCAAAAATTGATAAGGG - Intergenic
982513572 4:156316399-156316421 CACAATGCACTAATTAATTTAGG + Intergenic
983554948 4:169051595-169051617 AAAACTGCACAGATTTATATAGG + Intergenic
988247420 5:28705076-28705098 CACACATCACAGATTGATAATGG + Intergenic
988704544 5:33711503-33711525 CACACAGCACAAACAGATTTTGG + Intronic
992041599 5:72839633-72839655 CAGACTGCACCGATTAATATGGG - Intronic
1006935133 6:37712021-37712043 CACACTGTTCAACTTGAGATAGG + Intergenic
1007930241 6:45684314-45684336 CAAACTGCTCAAAGTCATATAGG + Intergenic
1008105009 6:47431662-47431684 CTCACTGCACAAAGTAATCTCGG - Intergenic
1013004148 6:106055619-106055641 AACACTCAACAAATAGATATTGG - Intergenic
1013516828 6:110895507-110895529 AAAACTGCACAAATTTTTATGGG + Exonic
1014667374 6:124255991-124256013 TCCACTGAACAAATAGATATGGG + Intronic
1016455780 6:144229479-144229501 CACACTGCACAAAATAACAGAGG + Intergenic
1020159991 7:5763225-5763247 CACACTCCACATATTGATTGTGG + Intronic
1022209639 7:28195840-28195862 CATACTTCCCAAATTGATATTGG + Intergenic
1022270692 7:28804772-28804794 CACACTGCAAAAATAGATTTTGG - Intronic
1032551567 7:132789178-132789200 AACACTGCATAAATTAACATAGG + Intronic
1033314460 7:140285981-140286003 CACACTGCACACATGGGAATGGG - Intergenic
1034330814 7:150280654-150280676 CTCACTGCACACATTGAAAAAGG + Intronic
1040085498 8:43336014-43336036 CAAGCTGCTCACATTGATATTGG + Intergenic
1042621056 8:70704644-70704666 CACACAGCAGAAATTGAGAGAGG - Intronic
1043493698 8:80777070-80777092 AACACTGAACTAATTTATATTGG - Intronic
1046227254 8:111299107-111299129 CAAAATTCACAAATTGATTTTGG + Intergenic
1051397015 9:16634150-16634172 CACAGTGGACAAATTGCAATTGG - Intronic
1051806755 9:21002829-21002851 TACACTGTACAAAATGAAATAGG + Exonic
1053873093 9:42514189-42514211 CACACTGTATAAACAGATATTGG - Intergenic
1053899660 9:42781731-42781753 CACACTGTATAAACAGATATCGG + Intergenic
1054261987 9:62875862-62875884 CACACTGTATAAACGGATATTGG - Intergenic
1054269237 9:62952563-62952585 CACACTGTATAAACAGATATTGG + Intergenic
1055490893 9:76804470-76804492 CACTCTTCCCAAAGTGATATGGG - Intronic
1058347041 9:103976546-103976568 TTCACTGTATAAATTGATATAGG - Intergenic
1058721380 9:107767867-107767889 AACACTGCACATGTTAATATTGG + Intergenic
1203528498 Un_GL000213v1:113547-113569 CAAGCTGCTCACATTGATATTGG - Intergenic
1189530024 X:41870436-41870458 CACACTACACAAATTTCTAAAGG + Intronic
1194970582 X:100338750-100338772 CACACTGCCAAAATTTCTATGGG - Intronic
1196393624 X:115235205-115235227 CACATTGCTCAAATTGAAATAGG - Intergenic
1200326183 X:155242121-155242143 CAGACTGCACAAAAGGACATAGG + Intergenic
1201526642 Y:14943471-14943493 CAGCATGTACAAATTGATATAGG + Intergenic