ID: 1081244468

View in Genome Browser
Species Human (GRCh38)
Location 11:40747050-40747072
Sequence GCATCAGTGTTAGCTGGTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 122}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081244468_1081244474 11 Left 1081244468 11:40747050-40747072 CCTTTACCAGCTAACACTGATGC 0: 1
1: 0
2: 0
3: 11
4: 122
Right 1081244474 11:40747084-40747106 ATACACTGTTCTAGGGCCCAAGG 0: 1
1: 1
2: 1
3: 18
4: 206
1081244468_1081244475 15 Left 1081244468 11:40747050-40747072 CCTTTACCAGCTAACACTGATGC 0: 1
1: 0
2: 0
3: 11
4: 122
Right 1081244475 11:40747088-40747110 ACTGTTCTAGGGCCCAAGGCAGG 0: 1
1: 0
2: 1
3: 9
4: 146
1081244468_1081244472 4 Left 1081244468 11:40747050-40747072 CCTTTACCAGCTAACACTGATGC 0: 1
1: 0
2: 0
3: 11
4: 122
Right 1081244472 11:40747077-40747099 GTACACCATACACTGTTCTAGGG 0: 1
1: 0
2: 2
3: 12
4: 119
1081244468_1081244471 3 Left 1081244468 11:40747050-40747072 CCTTTACCAGCTAACACTGATGC 0: 1
1: 0
2: 0
3: 11
4: 122
Right 1081244471 11:40747076-40747098 CGTACACCATACACTGTTCTAGG 0: 1
1: 0
2: 0
3: 13
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081244468 Original CRISPR GCATCAGTGTTAGCTGGTAA AGG (reversed) Intronic
903604220 1:24563187-24563209 GCTTCAGTGATAGCTGAGAAAGG - Intronic
903730414 1:25489918-25489940 GCATCAGAGATAGATGGGAAAGG + Intronic
905733517 1:40311754-40311776 GCACTAGGGTAAGCTGGTAAGGG - Intronic
906625612 1:47322751-47322773 GCTTTAGTGCTAGCTGGTATGGG + Intergenic
909912931 1:81282616-81282638 GCTTCAGTGTTATCTGTTCAAGG - Intergenic
911893839 1:103404721-103404743 CCATGAGTGTTAGCTGCTAGTGG + Intergenic
912411045 1:109480890-109480912 GAATCAGTGTTAACTGGGTAAGG + Exonic
915726329 1:158020252-158020274 GCAGCAGTGTTAGCTAGGTATGG - Intronic
915930351 1:160056830-160056852 GAATTAGTGTTATCTGCTAAGGG - Intronic
919012396 1:191982773-191982795 GCACCAGTGTTAGCAGGTCCAGG + Intergenic
919848075 1:201654210-201654232 CCATCAGTGATGGATGGTAAAGG - Intronic
1065873497 10:29976665-29976687 GCATCACTGATAACTGATAAAGG - Intergenic
1066244466 10:33569085-33569107 ACAACAGTGGTTGCTGGTAAGGG + Intergenic
1067686867 10:48470998-48471020 GCAACCTTGTTAGCTGGTAGTGG - Intronic
1068596598 10:58908808-58908830 GCAGAAGTGTTAGCTGCTGAAGG + Intergenic
1068904302 10:62306228-62306250 GCAGCAGTGTTAGGAGGTAATGG + Intergenic
1071038877 10:81282465-81282487 CCATTAGTGTTGGCTGCTAATGG + Intergenic
1071664075 10:87536573-87536595 GTATCAGTGTTACCTGAAAATGG - Intronic
1072411230 10:95203828-95203850 GCATCCCTGTTAGCAGGCAAAGG - Intronic
1074202040 10:111246015-111246037 GCATAGGTTTTAGCTAGTAAAGG + Intergenic
1080624737 11:34017913-34017935 ACTTCAGTGTCAGCTGGCAAAGG + Intergenic
1081237966 11:40668918-40668940 GCATCAGTGATAACTTATAAGGG + Intronic
1081244468 11:40747050-40747072 GCATCAGTGTTAGCTGGTAAAGG - Intronic
1081554292 11:44143712-44143734 GCAGCAGTGATAGATGGTATTGG + Intronic
1082736237 11:56859183-56859205 GCCTCAGTGGAAGCTGGAAAGGG + Intergenic
1085493487 11:76945645-76945667 GCACCAGTGTTAGTGGGTACTGG + Intronic
1091934003 12:4420736-4420758 CAATCAATGTTAGCTGCTAATGG - Intergenic
1098284575 12:68894462-68894484 GCATTTGTGTTAGCAGGTAGTGG - Intronic
1099764067 12:86960317-86960339 ATATAGGTGTTAGCTGGTAATGG - Intergenic
1101192599 12:102350700-102350722 TATTAAGTGTTAGCTGGTAAAGG - Intergenic
1105230603 13:18491793-18491815 GCCTCAGTGGTAGATGGTAGGGG - Intergenic
1106173176 13:27306712-27306734 GCATCAGTATTAGCAGGGATTGG + Intergenic
1106930791 13:34662393-34662415 GTATGAGTGTTGGCTGCTAAAGG + Intergenic
1108091986 13:46858591-46858613 GCATGAGTGTGAACTGGAAATGG + Intronic
1112080121 13:95959817-95959839 GCACCAGTGTTAGCAGGTGCAGG - Intronic
1118032396 14:61831342-61831364 TCATCAGTGATAGATGATAAAGG - Intergenic
1119761951 14:77158052-77158074 CCATCAGTGTTAGCTGGGGAGGG + Intronic
1120830263 14:88991705-88991727 GGCTCAGTATTAGCTGGTAGGGG - Intergenic
1122951945 14:105050078-105050100 GCATCAGTGTGACCTGGTCTAGG + Exonic
1125010458 15:34867115-34867137 GCCTCAGTGTTAGAGGATAAAGG - Intronic
1128710268 15:69866482-69866504 GCATCAGAATTACCTGGTGAGGG - Intergenic
1128919990 15:71601722-71601744 GCTTCAGCGTCATCTGGTAATGG + Intronic
1138915314 16:61456111-61456133 GCATCAGTGTTAGTGGGTCCAGG - Intergenic
1146481909 17:33211697-33211719 CCATCTGGATTAGCTGGTAATGG - Intronic
1147714657 17:42497380-42497402 GAATCATTGTTAGCTGGGCACGG + Intronic
1148209712 17:45800778-45800800 GCATCAGTGCTAGCTGTGAAAGG + Intronic
1148288893 17:46423490-46423512 ACATCAGGGTAAGCTGGTAAAGG - Intergenic
1148311062 17:46641067-46641089 ACATCAGGGTAAGCTGGTAAAGG - Intronic
1154522802 18:15248075-15248097 GCCTCAGTGGTAGATGGTAGGGG + Intergenic
1160030504 18:75253888-75253910 AGATCAGTGTTATCTGGTAGTGG + Intronic
1160490787 18:79335414-79335436 GCAACAGTTTTAGCTGGTGATGG - Intronic
1164494641 19:28749008-28749030 GCATCTGTGTTGGCTGATGAGGG + Intergenic
1164602754 19:29574318-29574340 GAATCAGTTTTTGCTGATAAAGG - Intergenic
1166903594 19:46087064-46087086 GCATCAGTGTTAGCAGGTCCAGG + Intergenic
925831080 2:7896225-7896247 GCTTCAGTCTTATCAGGTAATGG - Intergenic
927142880 2:20141678-20141700 TCATCAGGGTTTGCTGGGAAAGG - Intergenic
930239414 2:48920879-48920901 GCAGCAGTATTAAGTGGTAAAGG - Intergenic
930635611 2:53802435-53802457 GTATCAGTGTTATCTTCTAAAGG + Intronic
933788820 2:85867259-85867281 GCATCAGTGTAACCTGGAAGTGG + Intronic
933803842 2:85983893-85983915 GCCTCAGTGTTAACTGTGAATGG - Intergenic
938522089 2:132080927-132080949 GCCTCAGTGGTAGATGGTAGGGG + Intergenic
941800466 2:169653612-169653634 TCATCAGTATTAGGTCGTAATGG - Intronic
942700825 2:178707901-178707923 GCAACAGTGTTACCTGTTAGAGG - Intronic
943381736 2:187157988-187158010 GCATTCGTATTAGCTGGGAATGG + Intergenic
947266676 2:228290063-228290085 GCATCAGTGTAAAGAGGTAATGG + Intergenic
948024701 2:234767644-234767666 GCCTCAGTGTGAACTGGGAATGG + Intergenic
1169537790 20:6564520-6564542 GCATGAATGTTGGCTGCTAATGG + Intergenic
1172329197 20:34062961-34062983 GGATCAGTGTTAGGAGGTAGAGG + Intronic
1176774594 21:13120140-13120162 GCCTCAGTGGTAGATGGTAGGGG - Intergenic
1181370034 22:22408673-22408695 TCATCAGGGTTAGCTGCAAAAGG + Intergenic
1183097927 22:35565084-35565106 GCATGTGTGTTAAGTGGTAATGG - Intergenic
1184610296 22:45599076-45599098 GGATCCGGGTTAGCGGGTAAGGG - Intronic
949552624 3:5123538-5123560 GACTCAGTTTTAGCTGGTAGTGG + Intronic
953372461 3:42400876-42400898 GTAGCAGTGTAAGCTGGAAATGG + Intronic
955498169 3:59558209-59558231 GCATCAGAGTTGGCTGGAGAGGG - Intergenic
955627444 3:60933629-60933651 GCATCAGTAGTAAATGGTAATGG - Intronic
957157640 3:76565977-76565999 TGATCAGTGCCAGCTGGTAATGG - Intronic
957608260 3:82432367-82432389 GCATCAGTGGTGTCTGGTGAGGG + Intergenic
962592612 3:136906524-136906546 GCACCAGTGTTAGCAGGTTCAGG + Intronic
965209460 3:165766830-165766852 GCATCAGAGTTGGCTGGGCATGG - Intergenic
966233781 3:177677786-177677808 GCATCAGTATTATCTGTTACTGG + Intergenic
968401139 4:298750-298772 GCCTCAGAGTTAGCTGATCAGGG - Intronic
969225736 4:5797205-5797227 GCATCAGTGGCAGCTGCTCAGGG + Exonic
969836612 4:9847556-9847578 CCCTCAGTGTTTGCTGGGAACGG + Intronic
970559770 4:17271155-17271177 CCATCAGTGTTTGCTGAAAAAGG - Intergenic
974677415 4:65111466-65111488 GCATATTTGTTAACTGGTAAGGG - Intergenic
978468248 4:109032025-109032047 CCATAAGTGTTAGCTGTTCAAGG - Intronic
980623872 4:135345525-135345547 GCATCAGTGGTAGCTAGTCTAGG - Intergenic
982428222 4:155292285-155292307 ACATCAGTGTCTACTGGTAATGG + Intergenic
985489851 5:172735-172757 GCCTTAATGTTAGCTGTTAAAGG - Intronic
985767764 5:1789084-1789106 GCACCAGGGTTGGCTGGTGAGGG + Intergenic
988373362 5:30401662-30401684 GCATCAGTGTTACCAGCTGAGGG + Intergenic
988551737 5:32206394-32206416 ACATCTGTGTTAGCTGAAAATGG + Intergenic
989173108 5:38493089-38493111 GCATCAGGGTTAAGTGGTAAGGG + Intronic
990420639 5:55629352-55629374 GCATGGGTGTTAGCCGGTCATGG - Intronic
990810513 5:59717080-59717102 GCATCAGTTTTGCCTGGTAATGG - Intronic
994612689 5:102065010-102065032 GCTTCAGTGCCTGCTGGTAAAGG - Intergenic
995820802 5:116229557-116229579 GCAACACTGTTAGCTGCTAAAGG + Intronic
997594478 5:135096860-135096882 AAATCAGTGTAAGGTGGTAATGG + Intronic
998948951 5:147372312-147372334 GCACCAGTTGTGGCTGGTAATGG + Intronic
999413031 5:151368961-151368983 GCATGCGTATCAGCTGGTAAAGG - Intergenic
1000705748 5:164509234-164509256 GCATCAGTGTTCTCTGAAAATGG + Intergenic
1001256298 5:170185922-170185944 GGATCAGTGTGAGATGGTCAGGG - Intergenic
1005962865 6:30705812-30705834 GCAGCAGAGGTAGCTGGAAAGGG + Exonic
1008699437 6:54081118-54081140 GCATCAGTGTCAGAGGGTACTGG - Intronic
1010736983 6:79454152-79454174 ACATCAGAGTTGTCTGGTAAAGG + Intergenic
1012718731 6:102712558-102712580 GCTTCAGTGTTACATGGTACAGG + Intergenic
1014963087 6:127711472-127711494 CCATCAGTGTTAACTGGGACTGG + Intronic
1014987175 6:128025720-128025742 GCAGCACTGGTAGCTGGAAAAGG - Intronic
1014987554 6:128030219-128030241 CCGTCAGTGTTAGCTGCTATTGG - Intronic
1015353351 6:132248420-132248442 GCATCCGTATTATCTGCTAAGGG - Intergenic
1016237677 6:141887710-141887732 GCATCATTGTTAGCTGGGCTGGG - Intergenic
1028703098 7:93806244-93806266 GCAACAGTGCTATCTGTTAATGG + Intronic
1036209586 8:6831502-6831524 GCATCACTGTGAGCAGGGAATGG - Intronic
1036826044 8:11977061-11977083 GCACCAGTGTTAGCAGGTCCAGG + Intergenic
1038173786 8:25162762-25162784 GCAGCAGTGGTAGCTGGGTATGG + Intergenic
1042418529 8:68556835-68556857 ACATTTGTGTTAGCTGTTAAAGG - Intronic
1043791774 8:84477290-84477312 GCAACAGCGTTAGATGCTAAAGG - Intronic
1046225927 8:111280309-111280331 GAGTCAGTGTTAGAGGGTAAAGG - Intergenic
1050560909 9:6833703-6833725 GAATCAGTGTTAGCTGCTGCAGG + Intronic
1050670687 9:7993551-7993573 CCAGCTGTGTTTGCTGGTAAGGG + Intergenic
1051563442 9:18469354-18469376 GCCTCAGTGTTCTCTGTTAAAGG + Intergenic
1055662693 9:78520612-78520634 GCAACAGTGTTAGCAGGTTCAGG - Intergenic
1055758781 9:79583959-79583981 GCCTCAGTGTTATCTATTAAAGG - Intronic
1058393592 9:104524656-104524678 GCATCAGTGTGACCTGGACATGG - Intergenic
1061075083 9:128336262-128336284 GCATCAGGCTTAGCTGGGAATGG + Intergenic
1186949279 X:14605018-14605040 GCATCAGGGTTAGGTCATAAAGG - Intronic
1187277821 X:17831832-17831854 GCATCAGAGTTTGCTGCAAATGG + Intronic
1189961911 X:46332407-46332429 GCAACAGTGGTTGCTGGGAAGGG - Intergenic
1190768144 X:53492595-53492617 GCTTCAGTGGCAGCTGGCAAAGG + Intergenic
1192211531 X:69130900-69130922 GCATCAGTTTAACCTGGGAAGGG - Intergenic
1196255977 X:113519464-113519486 ACATCAGTGTTTGCTTGAAATGG + Intergenic
1196635598 X:117999066-117999088 ACTTCAGTGTCAGGTGGTAATGG + Intronic
1201067975 Y:10117347-10117369 GCATTAGTGTTCCCTGGAAATGG + Intergenic