ID: 1081245084

View in Genome Browser
Species Human (GRCh38)
Location 11:40755984-40756006
Sequence GAAGCCAGTCAGATTGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 224}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081245084_1081245085 -4 Left 1081245084 11:40755984-40756006 CCTGTTTCAATCTGACTGGCTTC 0: 1
1: 0
2: 0
3: 14
4: 224
Right 1081245085 11:40756003-40756025 CTTCCTGATAAGAAGAAATTTGG 0: 1
1: 0
2: 5
3: 43
4: 430
1081245084_1081245086 -3 Left 1081245084 11:40755984-40756006 CCTGTTTCAATCTGACTGGCTTC 0: 1
1: 0
2: 0
3: 14
4: 224
Right 1081245086 11:40756004-40756026 TTCCTGATAAGAAGAAATTTGGG 0: 1
1: 0
2: 3
3: 33
4: 427
1081245084_1081245088 16 Left 1081245084 11:40755984-40756006 CCTGTTTCAATCTGACTGGCTTC 0: 1
1: 0
2: 0
3: 14
4: 224
Right 1081245088 11:40756023-40756045 TGGGTACACAGAAAAACAACAGG 0: 1
1: 0
2: 1
3: 17
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081245084 Original CRISPR GAAGCCAGTCAGATTGAAAC AGG (reversed) Intronic
900532086 1:3159503-3159525 GACACCAGTCAGATTGGATCAGG + Intronic
901187329 1:7383406-7383428 GGTGCCAGTTAGATTCAAACCGG + Intronic
908380263 1:63591371-63591393 TAAGCCACTCAGATTTAGACTGG + Intronic
908551575 1:65213870-65213892 GACGCCAGTCAGATTGGATTGGG - Intronic
910336321 1:86136001-86136023 GAAGCCATTTAGAATGAAACTGG - Intronic
911866950 1:103039472-103039494 GAGACCAGTCAGATTCAATCAGG - Intronic
912682467 1:111738322-111738344 GAAGCCAGTGAGAATCAACCTGG + Intronic
913035172 1:114957646-114957668 GAAGACATACAGATGGAAACAGG + Intronic
919344684 1:196360606-196360628 GACACCAGTCAGATTGTAATAGG - Intronic
920551310 1:206863545-206863567 GAAGCCTTTCAACTTGAAACAGG + Intergenic
920755189 1:208723327-208723349 GACGCCAGTCATATTGAATTAGG - Intergenic
921742768 1:218705541-218705563 AAAGCCAGTCAGTTTGTTACTGG - Intergenic
923717600 1:236438156-236438178 GAAGCCAGTCATATTGAGTTAGG + Intronic
924111489 1:240703991-240704013 GAAGCCAGACAAATGGAGACAGG + Intergenic
1064318632 10:14280958-14280980 GAAACCAGTCAGATTGGATCAGG - Intronic
1065419901 10:25531571-25531593 GCAGTGAGTCAGACTGAAACAGG + Intronic
1068154916 10:53186309-53186331 TAAGCCTGTCAGATTTAAATGGG - Intergenic
1071128583 10:82365209-82365231 GAAGCAAGTCAGAATGAAAATGG + Intronic
1071564886 10:86666690-86666712 GAAGCCAGTCAGAGAGCAGCTGG - Intronic
1072463307 10:95640222-95640244 GAAGCTACTCATATTGAAAATGG - Intronic
1072867577 10:99080035-99080057 GAAACCAGCCACATTAAAACTGG - Intronic
1073930614 10:108569985-108570007 GAAGCCAGGCAGAATTAAATGGG + Intergenic
1077445575 11:2589140-2589162 GAAGCCAGGCAGCTGGAATCAGG - Intronic
1077793770 11:5469366-5469388 GAAGCCTGTTAGAGTGAAGCTGG + Intronic
1080699695 11:34634225-34634247 AACGACAGTCATATTGAAACAGG + Intronic
1081245084 11:40755984-40756006 GAAGCCAGTCAGATTGAAACAGG - Intronic
1084491802 11:69482914-69482936 GATGCCAGTCATATTGAATGAGG + Intergenic
1086263211 11:84966299-84966321 GAAGCCATTCTGATTGCAGCAGG + Intronic
1089210070 11:116794056-116794078 GAAGGCATTCAGAGTGATACTGG - Intergenic
1089880300 11:121766819-121766841 GAAGCCTGACAGAGTGAAAGGGG - Intergenic
1093804015 12:23410188-23410210 GACACCGGTCAGATTGAATCAGG + Intergenic
1095334017 12:41005297-41005319 GAAGCCAATCAGACTAAAAATGG - Intronic
1096472825 12:51889808-51889830 GAAGCCACTCAGCTAGGAACAGG - Intronic
1096983392 12:55742119-55742141 GAAGACTGTGAGCTTGAAACTGG - Intergenic
1097153860 12:56998450-56998472 GGAGCGAGGCAGATTGAAACAGG - Intergenic
1098185824 12:67895142-67895164 GAAGGCAGTCAGTTGGAAAAGGG + Intergenic
1098606929 12:72402568-72402590 GACACCAGTCATATTGAATCAGG + Intronic
1099866827 12:88293165-88293187 GAAGTCTGTCAGCTAGAAACAGG + Intergenic
1100857640 12:98772285-98772307 GACACCAGTCAGATTGCATCAGG - Intronic
1101625860 12:106440500-106440522 GAGGCCAGTGTGGTTGAAACAGG - Intronic
1104172755 12:126298304-126298326 GGAGCCAGTCACATTGGAAGTGG - Intergenic
1104667137 12:130655794-130655816 GAAGCCAGCCAGAATGAAAAGGG + Intronic
1105606080 13:21927521-21927543 GACGCCAGTCAGATTGGAATAGG - Intergenic
1106759814 13:32857618-32857640 GAAACAAGTCAGATTGGATCAGG - Intergenic
1106932508 13:34682180-34682202 GATTCCACTCATATTGAAACAGG + Intergenic
1108207035 13:48100851-48100873 GACACCAGTCAGATTGAATTAGG - Intergenic
1108299452 13:49059832-49059854 AAAGCCAGTCCAATTAAAACTGG + Intronic
1108521033 13:51247147-51247169 GAAGCCAGTCAGAATGAGGTGGG + Intronic
1109055832 13:57547299-57547321 GAAGCCAGTCAGATTGAGGAGGG - Intergenic
1112184919 13:97118480-97118502 GAAATGGGTCAGATTGAAACAGG - Intergenic
1113071961 13:106430951-106430973 GAAACCAGTCATGTTGAATCAGG - Intergenic
1116697335 14:48193744-48193766 GTAGCCAGTCAGACATAAACAGG + Intergenic
1117370680 14:55075763-55075785 AAAGACAGTCTGAGTGAAACTGG - Intergenic
1118391907 14:65302952-65302974 GGGTCCAGTCAGACTGAAACTGG + Intergenic
1120034770 14:79684280-79684302 GAAGCCATTCAACTAGAAACTGG + Intronic
1120038047 14:79720414-79720436 GGAGCCTGGCAGAGTGAAACAGG - Intronic
1120110528 14:80549295-80549317 GAACCCATTCAAACTGAAACCGG - Intronic
1120504645 14:85339880-85339902 GATGCCAGTCAGATTGGATTAGG - Intergenic
1121372519 14:93373302-93373324 GAAGTCAATGAAATTGAAACAGG + Intronic
1122962578 14:105102990-105103012 GAATCTACTCACATTGAAACTGG + Intergenic
1124902846 15:33840458-33840480 GAAGCCTGTCAGATGGAGGCAGG + Intronic
1126160858 15:45612151-45612173 AACTCAAGTCAGATTGAAACCGG + Intronic
1126240942 15:46442563-46442585 GGAGACAGACAGATTGGAACAGG + Intergenic
1126853496 15:52814328-52814350 AAAGACAGTCACATTGAAATAGG + Intergenic
1129650639 15:77485608-77485630 AAAGCAAGTAAAATTGAAACAGG - Intergenic
1133041719 16:3064574-3064596 GACACCAGTCATATTGAAATAGG - Intergenic
1134003479 16:10801049-10801071 GAAACCAGTCAGACTGGATCTGG - Intronic
1134043577 16:11085655-11085677 GAAGCCACTCAGATCCAGACAGG - Intronic
1137890796 16:52160164-52160186 GAAGCCTGTCAGATTAACAGTGG - Intergenic
1138965298 16:62077327-62077349 GAAGCCAGTCATATTGGAGTAGG - Intergenic
1139030492 16:62875274-62875296 GAAGCTAGTCAGATTGGATTAGG + Intergenic
1139850191 16:69947294-69947316 GAGGCCAGTCAGACTGGATCAGG + Intergenic
1139879176 16:70170207-70170229 GAGGCCAGTCAGACTGGATCAGG + Intergenic
1140373345 16:74425345-74425367 GAGGCCAGTCAGACTGGATCAGG - Intergenic
1142681639 17:1553097-1553119 GAGGCCAGTAAAAATGAAACGGG - Exonic
1144177352 17:12720040-12720062 GAAGCCAGGAATATTGAAAATGG + Intronic
1144417547 17:15065886-15065908 GACTCCAGCCAGATTGAACCTGG + Intergenic
1149368739 17:55971604-55971626 GGAGACAGTCAGATTGAGAATGG - Intergenic
1149411736 17:56415232-56415254 GAAGACAGTCAAATTGGAAAGGG + Intronic
1151313875 17:73310551-73310573 GGAGCCGGTCAGATTGCAAGGGG + Intronic
1155577726 18:27266174-27266196 ATAATCAGTCAGATTGAAACAGG - Intergenic
1156143464 18:34145096-34145118 TATACTAGTCAGATTGAAACAGG + Intronic
1156953144 18:42929773-42929795 GAAGCCAGTCCCATTGCAATGGG + Intronic
1157145092 18:45154350-45154372 GACACCAGTCAGATTGAATTAGG + Intergenic
1157894553 18:51452540-51452562 GATACCAGTCAGATTGAATTAGG - Intergenic
1161949047 19:7457292-7457314 GATGCCAGTCAGATTGGATTTGG + Intronic
1162259809 19:9523432-9523454 GAAACCAGTCATATTGAATGAGG + Intergenic
1162302212 19:9850359-9850381 GAAGCCAGCCAGATGGGAGCGGG - Intergenic
1162673355 19:12277862-12277884 GAATCCAATCAGAGTCAAACTGG + Intronic
1167626102 19:50590442-50590464 GAAGCCAGTCAGAGGGAATGAGG + Intergenic
1168275341 19:55274790-55274812 GACGCCAGTCAGATTGCATTAGG - Intronic
925789858 2:7473170-7473192 GAAGCCTGTGATATTGAAAAAGG - Intergenic
926273435 2:11385509-11385531 GATGCCAGTCCGATGGAATCTGG + Intergenic
927815540 2:26213442-26213464 GAAGAAAGGCAGATTGAAGCTGG - Intronic
932476187 2:72007625-72007647 TAAGCCAGGCAGCTTCAAACAGG + Intergenic
932848258 2:75156808-75156830 GTAGAAAGACAGATTGAAACAGG - Intronic
935475284 2:103513492-103513514 GAAGTCAGGCAAATTCAAACAGG - Intergenic
936231011 2:110699579-110699601 GGAGCCAGTCAGATAGCAATGGG + Intergenic
937457789 2:122057960-122057982 GATGCCGGTCAGATTGGATCAGG + Intergenic
937526297 2:122773832-122773854 GAAGCCAGTCAGACTAATAGTGG + Intergenic
937923020 2:127145761-127145783 GAAGACAGCCAGCTTGAAATGGG - Intergenic
938106181 2:128531607-128531629 GAAGACAGTCTGATTAAAAATGG + Intergenic
939042704 2:137209917-137209939 GATACCAGTCAGATTCAAACAGG - Intronic
940048424 2:149435073-149435095 GAACCCAGTCAGATTGGATTAGG - Intronic
941060161 2:160837717-160837739 GAAAACTGTCAGATTGAAGCAGG - Intergenic
945859555 2:215105076-215105098 GAACACAGTCAGAATGCAACAGG - Intronic
948159977 2:235815399-235815421 GATGCCAGTCCCATTGAATCAGG + Intronic
1172470058 20:35186599-35186621 GAAGCCAGTCACAAAGAACCAGG + Intergenic
1172730093 20:37079848-37079870 GAAGCCTGGCAAACTGAAACTGG - Intronic
1173511222 20:43630238-43630260 GAAGCTGGTCAGACTGCAACTGG - Intronic
1176523379 21:7844692-7844714 GACACCAGTCAGATTGAATTAGG + Intergenic
1177298073 21:19202761-19202783 AAAACCAGTCAGATTGGAATAGG - Intergenic
1177952853 21:27560513-27560535 GACGCCAGTCAGATTAGATCAGG - Intergenic
1178486923 21:33025355-33025377 GAAACCAGTGAGATGGGAACAGG + Intergenic
1178657399 21:34474704-34474726 GACACCAGTCAGATTGAATTAGG + Intergenic
1179368357 21:40780648-40780670 GACACCAGTCAGATTGGAACAGG - Intronic
1179430833 21:41319944-41319966 GACACCAGTCAGATTGGATCAGG - Intronic
1179582838 21:42354573-42354595 GACACCAGTCAAATTGAACCAGG + Intergenic
1180761409 22:18211132-18211154 GAATTCATTCAGACTGAAACAGG + Intergenic
1180774258 22:18413487-18413509 GAATTCATTCAGACTGAAACAGG - Intergenic
1181070369 22:20332490-20332512 GAATTCATTCAGACTGAAACAGG - Intergenic
1181193359 22:21160439-21160461 GAATTCATTCAGACTGAAACAGG - Intergenic
1181216084 22:21332161-21332183 GAATTCATTCAGACTGAAACAGG + Intergenic
1182136680 22:27911057-27911079 GAAGCTAGTAAGAATGAGACTGG - Exonic
1183077567 22:35436581-35436603 GAAGCCAGGGAGATGGAAAAAGG - Intergenic
1184122199 22:42459228-42459250 GACGTCAGTGAGATTGAGACAGG - Intergenic
949103770 3:179003-179025 GAAGCCATTGAGATTGAGAGAGG - Intergenic
950141128 3:10616273-10616295 GACACCAGTCAGATTGAATAAGG - Intronic
951501804 3:23396624-23396646 GAGGCCATACAGATTGAAAGTGG - Intronic
951954275 3:28237639-28237661 GAACTGAGTCAGATTAAAACAGG + Intergenic
953083461 3:39643548-39643570 GAAGCATGTGAGGTTGAAACAGG - Intergenic
953824843 3:46242313-46242335 GAAGCTAGTCTGTTTAAAACAGG + Intronic
954704344 3:52471262-52471284 GAAGGCAGTAAGATGCAAACAGG - Intronic
954757278 3:52848004-52848026 GAAGCCAGCCCCATTGACACTGG + Intronic
955076336 3:55617164-55617186 GAAGGCTATCAGTTTGAAACTGG - Intronic
955497103 3:59545077-59545099 GAACCCAGTCATATTGAATTTGG - Intergenic
955857892 3:63293826-63293848 GACGCCAGTCATATTGAATTAGG + Intronic
956427799 3:69154885-69154907 GCAGCCAGGCTGATTGAAAGAGG + Intergenic
957629908 3:82705767-82705789 GAAGCCAATCAGATTAACAGTGG - Intergenic
957691536 3:83577043-83577065 GGAGCCAGTCACATGAAAACTGG + Intergenic
957713296 3:83891988-83892010 GACACCAGTCAGATTGAATTAGG - Intergenic
959696684 3:109255882-109255904 GAACCCAGGCATTTTGAAACTGG + Intergenic
960420578 3:117440410-117440432 GACACCAGTCAGATTGAATTAGG - Intergenic
961392215 3:126558848-126558870 GACGCCAGGCAGACTGAAGCTGG + Exonic
961486857 3:127222739-127222761 GAAGACAGTCTGGGTGAAACCGG + Intergenic
962484907 3:135832998-135833020 GATGCCAGTCATATTGAATTAGG + Intergenic
962671828 3:137715854-137715876 GAAGTCAGTTAAATGGAAACTGG + Intergenic
963749155 3:149157443-149157465 GATGCCAGTCAGCTGGAACCTGG + Exonic
964741921 3:159975340-159975362 GTAGCCAGTCAGTTTGAAGTAGG + Intergenic
966849760 3:184156926-184156948 GAAGCCAGACAGATGAACACTGG - Intronic
967814595 3:193788277-193788299 AAAGGCAGTCACACTGAAACGGG - Intergenic
967873047 3:194248211-194248233 GACACCAGTCATATTGAAGCAGG + Intergenic
967894512 3:194385197-194385219 GAACCCAGCCACATGGAAACTGG - Intergenic
967993492 3:195149535-195149557 GAAGCCAGGCTCAGTGAAACAGG + Intronic
972812650 4:42607735-42607757 GAAACCAGTCACAATGTAACTGG + Intronic
974329642 4:60461499-60461521 GAAGCCAGTCACACTGAAGCTGG + Intergenic
974973723 4:68863952-68863974 GAAGAAAGTTAGTTTGAAACAGG + Intergenic
976108424 4:81644287-81644309 GACACCAGTCAGATTGAATTAGG - Intronic
979269347 4:118742013-118742035 AAAGCCAGTAAGATGTAAACAGG - Intronic
979407985 4:120338568-120338590 GGATACAGTGAGATTGAAACTGG - Intergenic
979458453 4:120952811-120952833 GATGCCAGTCATATTGAATTAGG + Intergenic
980477992 4:133344956-133344978 GAAACCAGCCACATTGAAGCTGG - Intergenic
981271747 4:142853861-142853883 GATGCCAGTCAGATTGTATCAGG + Intergenic
982418356 4:155163815-155163837 GACGCCAGTCATATTGAATTAGG + Intergenic
983589766 4:169395753-169395775 GAAGGCAGTAAGATTGAGAAAGG - Intronic
984436122 4:179712437-179712459 GTACCCAAACAGATTGAAACAGG + Intergenic
984856176 4:184198072-184198094 GAAGCCAGTGAGATCAAAACAGG + Intronic
985245662 4:187977502-187977524 GATGCCAGTCAGATTGGATGAGG - Intergenic
986481506 5:8193203-8193225 CAAGCCAGTCAACTTGAAACTGG - Intergenic
987299935 5:16588338-16588360 GACACCAGTCATATTGAATCAGG + Intronic
988175376 5:27716375-27716397 GAACCCAGACAGATTTAAAAGGG + Intergenic
988937324 5:36098230-36098252 GAAACCAGTGAAATTGAAAATGG - Intergenic
989968024 5:50488352-50488374 GAAGCCAATCAGACTGACAGTGG - Intergenic
990442517 5:55860998-55861020 GATGCCAGTCAGATTGGATTAGG + Intronic
993572255 5:89555689-89555711 TAAGAAAGTCAGATTGAAGCTGG - Intergenic
995610732 5:113908077-113908099 GACACCAGTCACATTGAATCAGG - Intergenic
996522641 5:124444333-124444355 GAAGTCAGTCAGAGTTAACCAGG + Intergenic
997642222 5:135456710-135456732 GGAGCCAGGCTGAGTGAAACCGG - Intergenic
998666619 5:144305423-144305445 GACACCAGTCAGATTGAATTAGG - Intronic
998779957 5:145645899-145645921 GAAGCCCGTCAGATTAACAGCGG - Intronic
999128469 5:149264551-149264573 GACACCAGTCAGATTGGATCAGG - Intergenic
999391151 5:151192185-151192207 GAAACCAGTGAGATGGAAAATGG + Intronic
1000199703 5:158996006-158996028 GAGGCCAGACAGCTAGAAACAGG - Intronic
1001251540 5:170151084-170151106 GCAGCCAGGCAGCTGGAAACAGG + Intergenic
1005816995 6:29561453-29561475 GAAAAAAGTCAGATTGACACTGG - Intronic
1009988840 6:70815701-70815723 AAAGGCAGTTAGACTGAAACAGG + Intronic
1010647488 6:78408697-78408719 GACACCAGTCAGATTGAATTAGG - Intergenic
1011000440 6:82582608-82582630 GACACCAGTCAGATTGAATGAGG - Intergenic
1011022185 6:82826905-82826927 GAAACCAGTCAGATTGGATTAGG - Intergenic
1015405803 6:132835733-132835755 GCAGACAGTCAGATTGAATTAGG - Intergenic
1016903026 6:149120701-149120723 GACGCCAGTTAGATTGAATTAGG - Intergenic
1016913143 6:149218696-149218718 CCAGGCAGTCATATTGAAACTGG - Intronic
1018085689 6:160299690-160299712 GACGCCAGTCAGATTGGATCTGG - Intergenic
1018200248 6:161387840-161387862 GACACCAGTCAGATTGAAGAAGG - Intronic
1022214376 7:28243688-28243710 GACACTAGTCAGATTAAAACAGG - Intergenic
1027183496 7:75955661-75955683 GAAGACAGACAGAATGAAAGGGG - Intronic
1028512132 7:91636967-91636989 GAAGCCTTTCAGTTTGCAACCGG + Intergenic
1031560738 7:123234953-123234975 GTAGCCAAACAGATTGAAAATGG - Intergenic
1031990731 7:128197325-128197347 GAAGAAAGTCAGATTGCTACTGG + Intergenic
1032759771 7:134929002-134929024 TAAACCAGTTAGATTGAAAAAGG - Intronic
1034623818 7:152477201-152477223 GACACCAGTCATATTGAATCAGG + Intergenic
1034919484 7:155068284-155068306 GATGTCAGTCAGATTGAATGAGG + Exonic
1035926819 8:3736710-3736732 GAAGCCAGGCAGTGTGAAGCAGG - Intronic
1035951578 8:4027732-4027754 GAAGCCAGTCTGTTTGAGAAGGG + Intronic
1036059089 8:5294865-5294887 GAAACCAGTCAGATTAAATTAGG - Intergenic
1038348303 8:26752447-26752469 GAAGCCAGTTATATTCAAAATGG - Intronic
1039950207 8:42165110-42165132 CATGCCAGTCAGCTTGACACAGG - Exonic
1040590561 8:48788836-48788858 GAAGCCAGTCAAGTGGACACCGG - Intergenic
1040698571 8:50033720-50033742 AACGCCAGTCAGATTGAATTAGG + Intronic
1041164886 8:55081555-55081577 GAAGCCTGTAACATTGAAATCGG + Intergenic
1044020441 8:87099516-87099538 GAAGCCAGTCAAATTCATCCTGG - Intronic
1044139780 8:88636271-88636293 GACACCAGTCAGATTGGATCTGG - Intergenic
1048324179 8:133426327-133426349 GAAGCCTGTTAGGTTAAAACTGG + Intergenic
1048786187 8:138052896-138052918 GAAGCCAGTGAGAATGGAAGGGG - Intergenic
1048817919 8:138351307-138351329 GACACCAGTCAGATTGGATCAGG - Intronic
1048881186 8:138874049-138874071 GCAGCTAGTGAGATTGAATCAGG - Intronic
1049076033 8:140396742-140396764 TAAGTCAGTGAGATTGGAACTGG - Intronic
1056048245 9:82741385-82741407 GACACCAGTCAGATTGAATTAGG - Intergenic
1057180558 9:93027476-93027498 GACACCAGTAAGATTGAATCAGG + Intronic
1057523157 9:95776134-95776156 AAAGTCAGACAGATTTAAACTGG + Intergenic
1058930881 9:109717517-109717539 GAGGCAAGACTGATTGAAACAGG + Intronic
1059749327 9:117233090-117233112 GGAGGCTGTGAGATTGAAACTGG - Intronic
1059970700 9:119665347-119665369 GTAGACAGTGAGATTGAAAAGGG - Intergenic
1061549214 9:131323551-131323573 GACACCAGTCAGATTGGATCAGG - Intergenic
1062450947 9:136615523-136615545 GACGCCAGTCATATTGGATCAGG + Intergenic
1186852158 X:13591226-13591248 GAAGTCAGTCAGGTGGAAAGGGG + Intronic
1190971221 X:55350438-55350460 GAAGGCATTCAAATTGAAAAGGG - Intergenic
1191752463 X:64557947-64557969 GAAGCCATTTACATTGCAACAGG + Intergenic
1194777689 X:97985188-97985210 GGAGCTAGTAAGATTGAAAATGG + Intergenic
1194937898 X:99973059-99973081 GATGCCAGTCAGATTGGATTAGG + Intergenic
1197275671 X:124476033-124476055 AAAGCCATTTAGATTGACACTGG - Intronic
1197575019 X:128200696-128200718 GAAGCCAGTCAGACTAACAGCGG + Intergenic
1197616250 X:128695136-128695158 GAAGCTAGTCTGGTTGAAGCAGG + Intergenic
1197624265 X:128784285-128784307 GAAGCCAGTCAGACTAACAGCGG + Intergenic
1198376156 X:136042019-136042041 GACACCAGTCATATTGAATCAGG + Intronic
1198524886 X:137491166-137491188 GACACCGGTCAGATTGAAATAGG - Intergenic
1198795195 X:140387152-140387174 AAAGGCAGTCATATCGAAACAGG - Intergenic
1199132894 X:144214454-144214476 GACACCAGTCATATTGAATCAGG + Intergenic
1199848360 X:151707771-151707793 GATGCCAGTCAGATTGGATTAGG + Intergenic