ID: 1081245188

View in Genome Browser
Species Human (GRCh38)
Location 11:40757296-40757318
Sequence TAGGATGGGCATCTTGTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081245183_1081245188 4 Left 1081245183 11:40757269-40757291 CCTTCTGGCTAATAAAAGCTTAG 0: 1
1: 0
2: 3
3: 88
4: 316
Right 1081245188 11:40757296-40757318 TAGGATGGGCATCTTGTAGATGG 0: 1
1: 0
2: 2
3: 4
4: 130
1081245182_1081245188 5 Left 1081245182 11:40757268-40757290 CCCTTCTGGCTAATAAAAGCTTA 0: 1
1: 0
2: 4
3: 29
4: 271
Right 1081245188 11:40757296-40757318 TAGGATGGGCATCTTGTAGATGG 0: 1
1: 0
2: 2
3: 4
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081245188 Original CRISPR TAGGATGGGCATCTTGTAGA TGG Intronic
903772954 1:25775588-25775610 TAGGAATGGCACCATGTAGAAGG + Intronic
905579637 1:39074453-39074475 TTTGATGGGCATCTTCTACAGGG + Intergenic
908649160 1:66313241-66313263 TTGGATGGGCATGTTAGAGAAGG - Intronic
909484948 1:76162237-76162259 TAGGCTGAGCATCTTTTACATGG - Intronic
910680296 1:89856686-89856708 TAAAATGGGTCTCTTGTAGACGG + Intronic
911336343 1:96585140-96585162 GAGGGTGGGCCTCTTGGAGAGGG + Intergenic
911404206 1:97415802-97415824 TAGCATGTGCAGCTTGTACAGGG + Intronic
911811144 1:102283738-102283760 CAGGATAGCCATCTTGTAAATGG + Intergenic
912699824 1:111869068-111869090 CAGGATGGGCAGCGTGTGGAAGG - Intronic
918313497 1:183303683-183303705 TAGGCTGGACAACTTGAAGAGGG - Intronic
923261740 1:232274131-232274153 AAGGACGGGCAACTTGTAAATGG - Intergenic
923459755 1:234198051-234198073 CAGGATGGGCATCTGACAGATGG + Intronic
924151194 1:241131813-241131835 TATTATGGGCAGCTTGCAGAGGG - Intronic
924450695 1:244176141-244176163 TAGGAGGGGCTTCTGGGAGAAGG - Intergenic
1063925055 10:10969383-10969405 TAGGAAGGGCTTCCAGTAGATGG + Intergenic
1066265671 10:33773930-33773952 CAGGATGGGGATCCTTTAGATGG - Intergenic
1069096764 10:64268771-64268793 TAGGATTGGAATGATGTAGAAGG + Intergenic
1071889473 10:89987416-89987438 TAGGCTGGCCATTTTGCAGAGGG + Intergenic
1071969443 10:90888206-90888228 TAGGAAGGTCATTTTCTAGATGG + Intronic
1073318695 10:102600618-102600640 TAGGGAGGGCATCTTGGAGGAGG + Intronic
1074844341 10:117383970-117383992 GAGCATGGGCATCAAGTAGAGGG - Intergenic
1075183515 10:120233530-120233552 AAGTATGGGCATCTGGTGGATGG + Intergenic
1076241527 10:128911970-128911992 TAGGTTGGGCACCTTGTCCAAGG + Intergenic
1076440347 10:130477086-130477108 TTTGATTGGCATCCTGTAGAAGG + Intergenic
1076558484 10:131345679-131345701 GAGGAAGGGCATCTTGGAGGGGG + Intergenic
1077199678 11:1299669-1299691 CAGTATGTGCATCTTGTACATGG - Intronic
1081245188 11:40757296-40757318 TAGGATGGGCATCTTGTAGATGG + Intronic
1090692861 11:129202643-129202665 TAGGATGGGAAACATTTAGAAGG - Intronic
1091776405 12:3187791-3187813 CAGGAAGGGCTTCTTGGAGAAGG - Intronic
1093889178 12:24499005-24499027 TAGGGTGGGCTTCTTTGAGAAGG - Intergenic
1095640532 12:44480898-44480920 TAGAATGGGCCTCTTCTCGAGGG + Intergenic
1099768618 12:87023034-87023056 TAAGATGGGTCTCTTGAAGAAGG - Intergenic
1101148079 12:101860468-101860490 TAGGAAGGGCTTCCTGAAGAAGG + Intergenic
1105533323 13:21240625-21240647 GAGGATGGGTAACTTGTAGAAGG - Intergenic
1109486685 13:63031717-63031739 TAGGATGATCATTTTGTAGTAGG - Intergenic
1110072213 13:71191439-71191461 AAGGATGGGGAGCATGTAGATGG + Intergenic
1111827345 13:93284086-93284108 TAAGTTGGGCTTCTTGCAGATGG + Intronic
1116282423 14:42926470-42926492 TGAGATGGGCCTCTTGAAGACGG + Intergenic
1116879893 14:50155514-50155536 TAGGGAAGGCATCTTGGAGAAGG - Intronic
1118175886 14:63439763-63439785 TAGGATGTCCATCATGGAGATGG + Intronic
1122206934 14:100152309-100152331 CAGGGTGGGCATCATGGAGAAGG + Intronic
1126543006 15:49842604-49842626 CAGGAAGGGCATCTTCTATATGG - Intergenic
1126748121 15:51847794-51847816 TAAAATGGGCATTTTTTAGAAGG + Intronic
1127564141 15:60169875-60169897 TAGGATGGGCATATAGAAGTAGG + Intergenic
1135664489 16:24324610-24324632 TAGGATATGCATTTTGTAAATGG - Intronic
1138809321 16:60129992-60130014 TAGGTTGGGCAAATTGTAGGGGG + Intergenic
1139294058 16:65884637-65884659 TGGGATGGGTCTCTTGTAAACGG + Intergenic
1140626705 16:76803444-76803466 TAGGATGGGCAGGTTGTAGATGG + Intergenic
1141110473 16:81267264-81267286 TAGAATGGCCATTTTATAGATGG - Intronic
1141841299 16:86575949-86575971 TAGGAGGGGCCTCTGTTAGAAGG - Intergenic
1144090966 17:11856121-11856143 TTGGATGTGCATGTGGTAGATGG - Intronic
1144851783 17:18247497-18247519 TAGGAGGGGCAGCTTGCAGAGGG + Intronic
1144955881 17:19018599-19018621 TAGCATGTGCCTGTTGTAGAGGG + Intronic
1147764989 17:42828529-42828551 TAGGGTGGGCATCAATTAGAGGG - Intronic
1148869948 17:50651750-50651772 TAGGAAGGACATCTTTTACATGG + Intronic
1151985225 17:77538505-77538527 TTGGATGGGCATGTTTCAGATGG + Intergenic
1153352585 18:4097362-4097384 TATGATTGGCATCCTGGAGAAGG - Intronic
1154157445 18:11955005-11955027 TAGGATGCTTATCTTGGAGAAGG - Intergenic
1155636376 18:27960370-27960392 CAGGAAGAACATCTTGTAGATGG + Intronic
1162476815 19:10905317-10905339 CAGGATGGGCCTCTTGGAGGTGG - Intronic
1163156914 19:15444649-15444671 TAGGATGGGGGTGTTGGAGAGGG + Intronic
926092629 2:10060460-10060482 AAGGATCGGCATCTAGCAGAGGG + Intronic
926935053 2:18078567-18078589 TAGGATGGACATATTTGAGAAGG + Intronic
934715232 2:96539189-96539211 TAGCACGCCCATCTTGTAGATGG + Intronic
937951698 2:127393059-127393081 TAGGGTGGGCACCTTATAAAAGG - Intergenic
941463723 2:165800783-165800805 GAGGATGGGGATATTGTAGTAGG + Intergenic
944597326 2:201273015-201273037 TAAGATGTGCATGTGGTAGAAGG - Intronic
1170289632 20:14754198-14754220 TAGAATGGTCATCATGGAGATGG + Intronic
1170952964 20:20953313-20953335 TAGAATGTGCAACTGGTAGAAGG - Intergenic
1173736821 20:45367754-45367776 CAGGATGGGGACCTGGTAGAAGG - Exonic
1174704607 20:52642913-52642935 TAGAATGGGCATCTTCCAGTGGG - Intergenic
1180730652 22:17979637-17979659 TAGGCTGGGACTGTTGTAGAAGG - Intronic
1183337346 22:37257482-37257504 TAGGATAGGCATCTTTTTGGAGG + Intergenic
1184404226 22:44291165-44291187 TAGGATGGCCCTGCTGTAGAAGG - Intronic
949820148 3:8107150-8107172 CAGGATCTGCAGCTTGTAGATGG + Intergenic
951281179 3:20751642-20751664 TATGCTGGGCATCTTTTAGGTGG + Intergenic
955230578 3:57095697-57095719 TAGGTTGGTCATCGTGCAGAAGG - Exonic
955740522 3:62086373-62086395 TAGGGTGGGAATTTGGTAGATGG - Intronic
956563289 3:70607317-70607339 TAGGATAGGGGACTTGTAGAAGG - Intergenic
958258316 3:91350929-91350951 CAGGCTGGGCAACTTGCAGATGG - Intergenic
960228161 3:115191995-115192017 TAGGATGGTTTACTTGTAGAAGG - Intergenic
962929749 3:140025421-140025443 CAGGATGAGCAACTTGTGGAAGG - Intronic
963471860 3:145750797-145750819 TAGGATGGGCATGCTGTAAGAGG - Intergenic
965256285 3:166417287-166417309 TAGGATAGAGATCTTGTAGCCGG + Intergenic
966348074 3:179000951-179000973 TGGGATGGGGAGCATGTAGATGG + Intergenic
968722737 4:2219706-2219728 TAGAATGGCCATATTGTGGAGGG - Intronic
968963639 4:3758357-3758379 TAGGAAGGGCTTCTTGTGGAGGG - Intergenic
972010470 4:34174053-34174075 TAAGATGGGTCTCTTGAAGATGG + Intergenic
976427532 4:84923227-84923249 TAGGAAGGGCATCTTTCACATGG - Intronic
980740431 4:136943084-136943106 TAAGATAGGTTTCTTGTAGATGG - Intergenic
980948412 4:139346901-139346923 GAGGATGGGTATAGTGTAGAGGG + Intronic
982239232 4:153282103-153282125 TAGGATGAGCTTGTTGTTGATGG - Intronic
986345036 5:6826973-6826995 TAGGATGGGCATGGTGGGGAGGG - Intergenic
986962881 5:13237028-13237050 TAGGTTGGGGATCTTGAGGAGGG - Intergenic
989701069 5:44265437-44265459 TAGGATGGGGGTCTGGTAGAAGG - Intergenic
990174421 5:53091368-53091390 CAGGATGGGCTTCTAGCAGATGG - Exonic
990349752 5:54904086-54904108 TAGGCTGGGAATCCTGTAGCTGG + Intergenic
992187583 5:74259047-74259069 GAGGCTGGGCAACTTGTACATGG - Intergenic
997016028 5:129936693-129936715 TAAGATAGGGATCTTGTATAGGG + Intronic
999063180 5:148656827-148656849 TAGGACTGGCATCATGTGGAGGG - Intronic
999452925 5:151691894-151691916 TAGCATAGGCATCTTGGAGGAGG + Intergenic
1001403821 5:171461995-171462017 TAGGATGTGCATTTTGTAGATGG + Intergenic
1003388932 6:5695604-5695626 GAGGATGAGTAACTTGTAGAAGG + Intronic
1005718575 6:28577871-28577893 TAGGATGGACATCTCAGAGAAGG - Intronic
1006245832 6:32734624-32734646 TAAAATGGGTTTCTTGTAGATGG + Intergenic
1013055884 6:106582566-106582588 TAGGATGGAGAACTTTTAGAGGG - Intronic
1013189270 6:107788618-107788640 TGAGATGGGCATCATCTAGATGG - Intronic
1014198678 6:118585550-118585572 TAGGATGGGCCACTTCTCGAGGG + Intronic
1015834124 6:137401118-137401140 TAGAATGTGCATCTTGAATAAGG - Intergenic
1024739058 7:52335892-52335914 TAGGAGGGGTATATAGTAGAAGG + Intergenic
1026901481 7:74039798-74039820 TATAATGGCCATTTTGTAGATGG + Intronic
1029915073 7:104200278-104200300 TAGGTTGGGCAGATTGTGGAAGG - Intronic
1030171198 7:106604559-106604581 CAGTATTGGAATCTTGTAGAAGG + Intergenic
1035160293 7:156945007-156945029 GAGGATGGGCATCGGGCAGAAGG - Intergenic
1035590645 8:810999-811021 TTGGATGGCCACCGTGTAGAAGG + Intergenic
1036157521 8:6356590-6356612 TATGAAGGGCATCTTGAAAATGG - Intergenic
1037873404 8:22521469-22521491 TAGGAAGGGCTGCTTGGAGAAGG - Intronic
1038907854 8:31927226-31927248 TGGAATGGGCATCATTTAGAGGG + Intronic
1039277896 8:35953151-35953173 GAGGATGGGCATATGGTGGAAGG + Intergenic
1040747474 8:50663005-50663027 TAGGAAGGGCATTTTGGAGGAGG + Intronic
1041172793 8:55162089-55162111 TAGGAAGGGCTTCCTGGAGAAGG - Intronic
1046853552 8:119003610-119003632 TGGGATGGGCCCCTTCTAGAAGG + Intronic
1047157317 8:122333898-122333920 TAGGATGTTCATCTTGGATAAGG + Intergenic
1049291903 8:141807806-141807828 TAGGGTGGGCGTCCTGCAGAGGG + Intergenic
1051877158 9:21804962-21804984 TAGAATGTCCATCTTGAAGAGGG + Intronic
1053754776 9:41294453-41294475 TAGAATTGGCATCTTTTATATGG - Intergenic
1054260299 9:62858757-62858779 TAGAATTGGCATCTTTTATATGG - Intergenic
1054331472 9:63761238-63761260 TAGAATTGGCATCTTTTATATGG + Intergenic
1057244950 9:93447263-93447285 TAGGTTGGGCTCCTTGAAGAAGG + Exonic
1058133167 9:101276451-101276473 TAGGAGGGGTATATTGAAGATGG - Intronic
1062300413 9:135864535-135864557 TTGGATGGAGATCTTGCAGAGGG - Intronic
1186936145 X:14451713-14451735 TGAGATGGGCCTCTTGAAGACGG - Intergenic
1191204382 X:57818901-57818923 TAGAATAGGCCTCTTGTCGAAGG - Intergenic
1193102725 X:77634348-77634370 TAGGAAAGGCATCTTTTAGGAGG - Intronic
1196871510 X:120116697-120116719 TGGGATCGGGATCTTGGAGATGG + Intergenic
1197415130 X:126165379-126165401 CAGGGTGGGCAGCTGGTAGATGG + Exonic
1198039522 X:132836138-132836160 TACTATGGGCATCTGGAAGAGGG - Intronic