ID: 1081245409

View in Genome Browser
Species Human (GRCh38)
Location 11:40760319-40760341
Sequence CTGCTCTTCGTGCCGAAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 56}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081245407_1081245409 11 Left 1081245407 11:40760285-40760307 CCACACTCATTCATTTCTGTATT 0: 2
1: 14
2: 71
3: 295
4: 1315
Right 1081245409 11:40760319-40760341 CTGCTCTTCGTGCCGAAAAAGGG 0: 1
1: 0
2: 1
3: 1
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081245409 Original CRISPR CTGCTCTTCGTGCCGAAAAA GGG Intronic
900942184 1:5806821-5806843 CTTCTCTTCTTGCTTAAAAAGGG + Intergenic
910445328 1:87294169-87294191 CTACTCTTCATGAAGAAAAATGG + Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
1066750571 10:38652168-38652190 CTGCTTTTGGTGAAGAAAAAAGG + Intergenic
1066966479 10:42270944-42270966 CTGCTTTTGGTGAAGAAAAAAGG - Intergenic
1069155572 10:65026334-65026356 CTGCTCTTAATACCAAAAAAGGG - Intergenic
1081245409 11:40760319-40760341 CTGCTCTTCGTGCCGAAAAAGGG + Intronic
1094218870 12:27972549-27972571 CTGCTCTTCTGGCTGAAAGAGGG + Exonic
1098176959 12:67802883-67802905 CTGCTCTTCCTGCCGTACCATGG - Intergenic
1099979267 12:89580283-89580305 CTGAACTTCGGGCTGAAAAAAGG + Intergenic
1107339929 13:39395171-39395193 CTGCTCATTCTGCTGAAAAAAGG - Intronic
1107412679 13:40172404-40172426 GTGCCCTTCGCTCCGAAAAACGG + Intergenic
1112628213 13:101130152-101130174 GTGCTCTTTGTGGAGAAAAAAGG - Intronic
1112895864 13:104298978-104299000 CTGCTCTTCCTGCTGGGAAAAGG + Intergenic
1114647150 14:24262184-24262206 CTGCTGTTCATGCCGAAATGCGG - Exonic
1120362242 14:83519433-83519455 TTGTTCTTCCTGCAGAAAAATGG + Intergenic
1123607945 15:22055578-22055600 CTGCTCTCCATGCAGAAAAGAGG + Intergenic
1123697786 15:22891576-22891598 ATGCTCTGAGTGCCGTAAAAAGG + Intronic
1124444580 15:29718662-29718684 CTGCTCTTCGTGCCGCAGGGCGG + Exonic
1202980180 15_KI270727v1_random:347376-347398 CTGCTCTCCATGCAGAAAAGAGG + Intergenic
1132886846 16:2185939-2185961 TTGCTCTTGGTGAAGAAAAAAGG - Intronic
1134510555 16:14843291-14843313 CTGCTCTTAGTGGCCAAAATCGG - Intronic
1134698195 16:16241780-16241802 CTGCTCTTAGTGGCCAAAATCGG - Intronic
1134973643 16:18552897-18552919 CTGCTCTTAGTGGCCAAAATCGG + Intronic
1135748934 16:25040799-25040821 CTGCTTTTCATGCCCAAAGAAGG + Intergenic
1140696886 16:77543510-77543532 CTACTCTTCGTGGTGTAAAAAGG - Intergenic
1143205194 17:5136258-5136280 CTGCCCTTGGTGCCCACAAATGG + Intronic
1151591423 17:75047180-75047202 CGGCTCTCCCTGCCGAGAAATGG + Intronic
1168414670 19:56160546-56160568 CTGCTCTTCAGGCAGGAAAAGGG - Exonic
927727034 2:25433494-25433516 CTGCTCTCTGTGCCGTTAAATGG + Intronic
931303157 2:61001023-61001045 ATGATCTTCCTGCCGAAAAGAGG - Intronic
934313571 2:91894325-91894347 CTGCTTTTGGTGAAGAAAAAAGG + Intergenic
939867058 2:147484289-147484311 CTGGTCTTGGTACCGAAATAAGG + Intergenic
945720239 2:213410067-213410089 CTGCTGTTCGTACAGCAAAAAGG + Intronic
1170213173 20:13865675-13865697 CTGATCTTTGTGCCTATAAAAGG - Intronic
1171451012 20:25236478-25236500 CTGCTCTTCCTGCCTAAAACGGG - Intergenic
1180540311 22:16440229-16440251 CTGCTTTTGGTGAAGAAAAAAGG + Intergenic
952075833 3:29696580-29696602 CTGGCCTTCGTGCAGAAAAGAGG - Intronic
953233242 3:41083292-41083314 CAGCTCTTCGTGCTGTAATAGGG + Intergenic
953619286 3:44518964-44518986 CTGCTCTGTATGCAGAAAAAAGG - Intergenic
959818972 3:110709686-110709708 CTGCTAGTGGTGCAGAAAAATGG - Intergenic
961424842 3:126836908-126836930 CTGCTCTTCCTGAGGAGAAATGG + Intronic
972980333 4:44691656-44691678 CTGCTCTTCGAGCCTAAAAAGGG - Exonic
977945773 4:102912376-102912398 CTGCTTTTGGTGAAGAAAAAAGG + Intronic
986025458 5:3846401-3846423 CTGCTCTTCTTGCTTACAAATGG + Intergenic
995030049 5:107470201-107470223 CTGCTTTTAGTCCCAAAAAATGG + Intronic
1001116084 5:168941277-168941299 CTGTTCTTCCTGCCGAGAGATGG - Intronic
1003540837 6:7016771-7016793 CTGCTCTGAGTGCTGAAATACGG + Intergenic
1005871169 6:29975266-29975288 CAGCTCCTGGTCCCGAAAAAAGG + Intergenic
1006363048 6:33598112-33598134 CTGCCCTTCGTGCCCATGAAAGG - Intergenic
1021386978 7:20043605-20043627 CTGCTCTTGTTGCAGCAAAATGG - Intergenic
1028345828 7:89780489-89780511 CTGCTGCTGGTGCCCAAAAATGG + Intergenic
1030522468 7:110615210-110615232 CTGCTCAGCATGCAGAAAAAGGG - Intergenic
1035449126 7:158964065-158964087 CTGCTCTTCCTGCCTAGAACAGG + Intergenic
1035609278 8:949243-949265 CTCCTTTTCCTGCCGACAAATGG - Intergenic
1049026317 8:139991813-139991835 CTGCTCTCTTTGCTGAAAAAGGG - Intronic
1051850325 9:21499258-21499280 CTGCTCTTCTGACCTAAAAAAGG + Intergenic
1196455860 X:115891187-115891209 TTGCTCTTAGTGCAGAAACAAGG + Intergenic
1201181486 Y:11351816-11351838 CTGCTTTTGGTGAAGAAAAAAGG + Intergenic