ID: 1081245653

View in Genome Browser
Species Human (GRCh38)
Location 11:40763653-40763675
Sequence AGGGAAAGCACAGTGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 723
Summary {0: 2, 1: 35, 2: 77, 3: 170, 4: 439}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081245647_1081245653 28 Left 1081245647 11:40763602-40763624 CCACACTGTAGCAGTGTCTGTGT 0: 1
1: 0
2: 1
3: 18
4: 207
Right 1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG 0: 2
1: 35
2: 77
3: 170
4: 439
1081245646_1081245653 29 Left 1081245646 11:40763601-40763623 CCCACACTGTAGCAGTGTCTGTG 0: 1
1: 0
2: 1
3: 18
4: 205
Right 1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG 0: 2
1: 35
2: 77
3: 170
4: 439
1081245645_1081245653 30 Left 1081245645 11:40763600-40763622 CCCCACACTGTAGCAGTGTCTGT 0: 1
1: 0
2: 0
3: 11
4: 163
Right 1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG 0: 2
1: 35
2: 77
3: 170
4: 439

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081245653 Original CRISPR AGGGAAAGCACAGTGATTGT GGG Intronic
903291531 1:22317386-22317408 AGGGCAGAAACAGTGATTGTGGG + Intergenic
904875914 1:33654468-33654490 AGGGAGAGCACAGTTGTTGCAGG + Intronic
905660012 1:39714610-39714632 AGGGAAGGCATAGTAATTTTGGG - Intronic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
905740222 1:40363792-40363814 AAGGAGAGTGCAGTGATTGTGGG + Intronic
906390931 1:45415433-45415455 AGCGAAAGCACAAAGATTATGGG - Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
907691041 1:56666645-56666667 AGAGAAAGCACAGTCCTTATGGG + Intronic
907911904 1:58834346-58834368 GAGGGAAGCACAGGGATTGTGGG + Intergenic
908093020 1:60706648-60706670 AGGGAAAGTGAAGTGACTGTGGG + Intergenic
908175705 1:61553152-61553174 AGTGAGAGCACACTGATTGTGGG - Intergenic
909582462 1:77253467-77253489 AGGGAGAGTGAAGTGATTGTGGG + Intergenic
909870362 1:80731131-80731153 AGGAAGAGCAAAGTGATTGTGGG + Intergenic
910087192 1:83417553-83417575 AGGAAAAGTACAGAGATTGGAGG - Intergenic
910328104 1:86034438-86034460 AGTTAAAGCACAGAGAGTGTAGG + Intronic
910384225 1:86664350-86664372 AGGCAGAGCACAGTGATTACAGG + Intergenic
910384430 1:86665570-86665592 AGGCAGAGCACAGTGATTACAGG - Intergenic
910422437 1:87080768-87080790 GGGGAGAGCACAGTGATTGCGGG + Intronic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910476836 1:87616518-87616540 TGGGAGAGCAGAGTGATTATAGG + Intergenic
910515489 1:88055094-88055116 AAGGAGAGCACCGTGATTGTGGG - Intergenic
910724845 1:90327793-90327815 AGGGAGAATGCAGTGATTGTGGG + Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
911019729 1:93374634-93374656 GGGGAGAGCACAGTTATTATGGG + Intergenic
911239520 1:95449694-95449716 AAAGAGAGCACAGTGCTTGTGGG - Intergenic
912601013 1:110933545-110933567 AGGGAGAGCACAGCAATTGCGGG + Intergenic
912633375 1:111268303-111268325 AGGAAGAACACAGTGATTGTAGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
916360470 1:163962126-163962148 AGGGACAGCACAGTTATTGTGGG + Intergenic
917171677 1:172183445-172183467 AAGGAAAATACAGTGATTCTGGG + Intronic
917191251 1:172421847-172421869 AGGGAGGGCACAGCGATTGTGGG + Intronic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
917405039 1:174696678-174696700 AGGGAGAGAGCAGGGATTGTGGG - Intronic
917745567 1:178003346-178003368 AGTGAAAGCACAGTGAATAAAGG - Intergenic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
918632948 1:186740542-186740564 TGGGAAGCCACAGAGATTGTGGG + Intergenic
918892707 1:190295753-190295775 AGGGAAAGGGAAGTGAGTGTGGG - Intronic
919047384 1:192470421-192470443 AGGGAAAGTGAAGTGATTGTGGG - Intergenic
919147336 1:193651935-193651957 AGGGAGAGCACAGTAACTGTGGG - Intergenic
919438509 1:197595405-197595427 AGGCAAACCACAGTGTCTGTAGG + Intronic
919455770 1:197818271-197818293 ATGGAGAGCATAGTGATTGTGGG + Intergenic
919835372 1:201569621-201569643 AGGGAAGGTACAGTGATTCTGGG + Intergenic
919971008 1:202578651-202578673 AGAAAACTCACAGTGATTGTAGG + Intronic
919972089 1:202587612-202587634 AGGAAAGGCACACTGATGGTGGG + Exonic
920596827 1:207280192-207280214 AGGGAGAGCACAGTTACTGTGGG - Intergenic
920601406 1:207328736-207328758 AGGTAAAGCACAATGATTTAGGG - Intronic
920679478 1:208061468-208061490 AGGGAAAGCAGTGGGAGTGTGGG + Intronic
920852886 1:209640600-209640622 AGGGAATGCACAGTGAGTGGTGG - Intronic
921002146 1:211055257-211055279 AGGAAAAACACAGTGATTGTGGG + Intronic
921073513 1:211682005-211682027 GGGGGCAGCACAGTGATGGTAGG + Intergenic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
921774669 1:219082784-219082806 AGAGACAGCTCAGTGATTGTGGG - Intergenic
922015099 1:221637303-221637325 AAGGAAAGCACAGTAAGTTTTGG + Intergenic
922036327 1:221852034-221852056 ATGGGATGCCCAGTGATTGTGGG - Intergenic
922377032 1:224979326-224979348 AGGGAGAGTGCAGTGCTTGTGGG + Intronic
922388659 1:225114776-225114798 AGAGAGAGCACAGTGACTGTGGG - Intronic
922806195 1:228391319-228391341 AGGGAAAGCACAGGGATCCGGGG + Intergenic
923094201 1:230761674-230761696 AGGGTAGGCACAGTGGTTTTGGG - Intronic
924516319 1:244769011-244769033 AGGGAGAGCGCAGTGACTGGGGG - Intergenic
1063066025 10:2609631-2609653 AGGAGAACCACAGTAATTGTTGG + Intergenic
1063213617 10:3904176-3904198 AGGTAAGGCACATTGAGTGTTGG + Intergenic
1064717279 10:18189879-18189901 AGGCAAAGAAAAGTGATTGTTGG + Intronic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1065711969 10:28527033-28527055 AAGGAAAGCTCTGTGATTGAAGG - Intergenic
1066708133 10:38203221-38203243 AGGGAGAGCACAGCAACTGTGGG + Intergenic
1067324464 10:45253729-45253751 GAGGAGAGCACAGTGATTGGAGG + Intergenic
1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
1068447821 10:57146178-57146200 AGGAAGAGCACAGTGGTTGTGGG + Intergenic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1069193570 10:65520302-65520324 AGGGAGAGAGCAGTGATAGTGGG - Intergenic
1069851846 10:71410421-71410443 ATGGGAAGCACAGTGCTGGTGGG - Intronic
1070059556 10:72968675-72968697 AGGGAAAGTACAGTAACTGGGGG - Intergenic
1070409963 10:76130569-76130591 AGGGAAAGCATATTGTTTGTAGG + Intronic
1071962549 10:90821330-90821352 AGAAAGAGCACAGTGATTGTGGG + Intronic
1072058668 10:91787387-91787409 AGGAAGAGCACAGCAATTGTAGG + Intergenic
1072466536 10:95667852-95667874 ACTGAAAGCTCTGTGATTGTGGG - Intronic
1072716120 10:97753694-97753716 AGGGCTAGCACAGTGCTGGTTGG + Intronic
1073680767 10:105701096-105701118 AGGGAAATAACAGTGTTTGCTGG + Intergenic
1073766075 10:106684396-106684418 AGGGAAAGCACAGTGTTTAATGG - Intronic
1073827212 10:107337478-107337500 AGGGAGATCACAGTGACTGGGGG - Intergenic
1074265676 10:111900834-111900856 AGGGTTAGCACAGTCATTTTGGG - Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1076376709 10:129993146-129993168 AAGGAAAGCACGGTGATTGTGGG + Intergenic
1077911879 11:6579595-6579617 AAGGAGAGCAGAGTGATTGTGGG + Intronic
1078019335 11:7642228-7642250 AGAGGAAGCACAGTGACTGTAGG + Intronic
1078843194 11:15097726-15097748 AGGGAGAGCACAGTCATCGTGGG - Intergenic
1079416299 11:20239182-20239204 AAGGAGAGCACAGTGACTGGGGG - Intergenic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1080096879 11:28418775-28418797 AGGCAAAGTGCAGTGAATGTGGG + Intergenic
1080113085 11:28591717-28591739 AGAGAATGTACAGTGAGTGTAGG - Intergenic
1080649758 11:34212696-34212718 AAGGAAAGCACAGTGCTGATGGG - Intronic
1080707252 11:34707941-34707963 AGGGCAAGCACAGTGACTAGGGG - Intergenic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1081447373 11:43143953-43143975 GGGGCAGGCACAGTGATTGGTGG - Intergenic
1083528935 11:63398627-63398649 ATAGAGAGCACAGTGATTGTGGG - Intronic
1084859074 11:72006511-72006533 AGGGAATGCAGAGTGTTTATCGG + Intronic
1085572244 11:77569531-77569553 AGGGAGAGTGCAGTGATTATGGG - Intronic
1085980404 11:81717867-81717889 AGGAAAACTGCAGTGATTGTGGG + Intergenic
1086261619 11:84947019-84947041 AGGGAGAGCAAAGTGATGGCTGG - Intronic
1086278778 11:85161664-85161686 AGCTAAAGAACTGTGATTGTGGG + Intronic
1086569519 11:88266027-88266049 AGGGAGAGCAGAATGATTGTGGG + Intergenic
1086847921 11:91774415-91774437 AGGGAGAGCACAGCGATTTTAGG - Intergenic
1087473098 11:98601647-98601669 AAGGAAAGCACAATGATTGTAGG - Intergenic
1087498275 11:98917961-98917983 GGGGGAAGCACAGTGATCATGGG - Intergenic
1088330638 11:108647591-108647613 AGGGAGAGCAAAGTGAGTGTGGG + Intergenic
1088569814 11:111212528-111212550 AGGGAGAGCACAGCAATTGTGGG + Intergenic
1088629605 11:111761970-111761992 AGGTAAAGTACAGAGATGGTAGG + Intronic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1090210492 11:124917566-124917588 AGGGAGAGTGCAGTCATTGTGGG - Intergenic
1090439474 11:126713877-126713899 AGGGGGAGCACAGTGCTTGGAGG + Intronic
1092039819 12:5374338-5374360 AGGGAATGCAGAATGTTTGTAGG - Intergenic
1092477141 12:8828950-8828972 CGGGAGAGCACAGTGACTGTGGG - Intronic
1092657090 12:10697487-10697509 GGGGAAAACACACTGGTTGTAGG - Intergenic
1093931626 12:24960329-24960351 AGGAAGAGCACAGTGACTGTGGG + Intergenic
1094419680 12:30257476-30257498 AGGGAGAGCACAGTAACTATAGG + Intergenic
1094642989 12:32294684-32294706 AGTGAGAGACCAGTGATTGTAGG - Intronic
1094795742 12:33970272-33970294 AAGGAAAACAAAGTGATTGAGGG - Intergenic
1095101014 12:38183924-38183946 AGAGAGAGCACAGTGACTGGAGG + Intergenic
1095181823 12:39154805-39154827 AGGGAGAGCACAGCAATTGTGGG - Intergenic
1095397739 12:41779878-41779900 AGTGAAGGTACAGTGATGGTGGG - Intergenic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1097426140 12:59446707-59446729 AGACAGAGCACAGTGATTCTGGG - Intergenic
1098395201 12:70010213-70010235 AGGGACAGCACAGCAACTGTAGG + Intergenic
1099101011 12:78440094-78440116 AGGGAGAGCAAAGTGACTGTGGG - Intergenic
1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG + Intergenic
1099610208 12:84858035-84858057 AGGGAAAGCACAGTGACTAAGGG - Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1099807831 12:87542812-87542834 AGGCAGAGCACAGCGACTGTAGG + Intergenic
1101252100 12:102946556-102946578 AGGGACAGCAAAGGGATTGTGGG - Intronic
1101470482 12:104992460-104992482 AGGGAAGGCACAGTGAACGCAGG - Intronic
1103968064 12:124652709-124652731 AGGCAAAGCAGAGTGAGTGCTGG + Intergenic
1104230678 12:126880991-126881013 AGGGAAAGACCAGGGATTGGTGG - Intergenic
1106796101 13:33207726-33207748 AATGAAAGCACATGGATTGTTGG + Intronic
1107524317 13:41214709-41214731 AGGGAAAGCACAGCAATTTTGGG - Intergenic
1107722979 13:43268291-43268313 GTGGAAAGCACAGTGATTTCAGG + Intronic
1107753960 13:43599367-43599389 AGGGAGAGTGCAGTGATAGTGGG + Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1108961281 13:56234293-56234315 AGAGGAAGGACAGTGATTGAAGG + Intergenic
1108972926 13:56400619-56400641 AAGGAGATCACAATGATTGTGGG + Intergenic
1109639560 13:65172005-65172027 AGGAAAAACACAATGATGGTTGG - Intergenic
1109961760 13:69640024-69640046 AGGGAGAGCACAATGATTGCGGG - Intergenic
1110079046 13:71287473-71287495 AGAGAAAGCGCAGTGACTGTGGG - Intergenic
1110448876 13:75618612-75618634 AGGGAGAGTAGAGTGATTATGGG - Intergenic
1110901401 13:80830356-80830378 AGGGAGAGCACAATGATGGTGGG + Intergenic
1111335459 13:86815765-86815787 AGGGAGAGTGCTGTGATTGTGGG + Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1113244428 13:108378253-108378275 AGGGATAGCACAGTGACTGTGGG - Intergenic
1114045041 14:18867677-18867699 ATGCAAAGCACTGTGGTTGTCGG + Intergenic
1114119170 14:19651791-19651813 ATGCAAAGCACTGTGGTTGTCGG - Intergenic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1115660885 14:35493601-35493623 TGGGGGAGCACAGTGATTGTGGG + Intergenic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116413091 14:44648980-44649002 AGGGAGAGTTCAGTGATTATGGG + Intergenic
1116489938 14:45493316-45493338 AGGGAAAGCACAGCAATTTGAGG - Intergenic
1116583586 14:46674299-46674321 GAGGGAAGCACAGTGATTGAAGG + Intergenic
1116765844 14:49069923-49069945 GGGGAAAACACAGTGACTGTGGG + Intergenic
1117161617 14:52995341-52995363 AGGGAGAGCACAGTGACTATGGG - Intergenic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1117384369 14:55195809-55195831 AGGGAGAGCGCAGTGACTGATGG - Intergenic
1117607108 14:57440959-57440981 AGAGAAAGAACAGTGATTGTGGG - Intergenic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1118654231 14:67930089-67930111 AGGTAAAGTGCACTGATTGTAGG + Intronic
1119647622 14:76359721-76359743 AGGGAAAGCAGAGGGCTTGTGGG + Intronic
1120344522 14:83268772-83268794 AAAGAAAGAACAGTGAGTGTGGG - Intergenic
1120426066 14:84350292-84350314 AGAGAGAGCCGAGTGATTGTAGG + Intergenic
1120894401 14:89516908-89516930 AGGCTAAGAACAGTGACTGTTGG - Intronic
1121634838 14:95446833-95446855 GGGGCAAGAAGAGTGATTGTAGG - Intronic
1123136905 14:106036292-106036314 AGGGAAGTCTCAGTCATTGTTGG - Intergenic
1123538371 15:21261729-21261751 CGGGAAACCACAGTGGGTGTGGG + Intergenic
1126572285 15:50164903-50164925 GAGGAGAGCACAGTGATTGTAGG - Intronic
1126706749 15:51413490-51413512 AGGGAGAGGACAGTAATTGTGGG + Intergenic
1126865414 15:52932051-52932073 AGGGAACACAGAGTGATTATAGG + Intergenic
1127101201 15:55566685-55566707 AGGGAATGCACATAGACTGTTGG - Intronic
1128614844 15:69101051-69101073 AGGGTAGGCACAGTGATTCCAGG + Intergenic
1128966136 15:72060532-72060554 AGAGATAGCACAGAGATTGTGGG + Intronic
1130336250 15:82959437-82959459 AGGCAGAGCACAGTCATTGCAGG + Intronic
1130430543 15:83842686-83842708 TGTGAAAACAGAGTGATTGTAGG + Intronic
1131098730 15:89671952-89671974 AGGGAAAGAACGGTACTTGTTGG - Intronic
1131287965 15:91077972-91077994 AGGCAAAGCACAGAGTTTTTAGG - Intergenic
1131944800 15:97608397-97608419 AAGGAAAGTGCAGTGATTGTGGG + Intergenic
1132148268 15:99441469-99441491 AGGAGAAGGAAAGTGATTGTGGG - Intergenic
1132357833 15:101185901-101185923 AGGGAAAGCAGGGAGATGGTTGG - Intronic
1132589079 16:718519-718541 AGAGAAAGGACCGTGTTTGTGGG - Exonic
1132950569 16:2560012-2560034 GGGGAAAGGACAGTGATAGGAGG + Intronic
1132963780 16:2640158-2640180 GGGGAAAGGACAGTGATAGGAGG - Intergenic
1134407164 16:13970585-13970607 TGGGACAGCACAGTGATTGCAGG - Intergenic
1137839009 16:51622573-51622595 AGGGAAAGCACACTGCTTTTAGG + Intergenic
1138174290 16:54882641-54882663 AGGGAAAGCTCACTGCTTGAGGG + Intergenic
1138519367 16:57562312-57562334 ATGGAAAGCCCAGAGGTTGTGGG + Intronic
1138806933 16:60100906-60100928 AGAGCGAGCACAGTGACTGTGGG - Intergenic
1138890836 16:61142466-61142488 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1139027880 16:62841525-62841547 AGGGAAGGCACAGTGAGGATGGG + Intergenic
1139286744 16:65821992-65822014 AGGGAAAGGACTGTGAGTTTAGG + Intergenic
1140875550 16:79149497-79149519 AAGGAAAGCATACTGTTTGTTGG + Intronic
1141205084 16:81927307-81927329 AGGGAAGACACAGTGATGATAGG + Intronic
1142065931 16:88062774-88062796 AGGGATTGCACATTCATTGTTGG + Intronic
1142173701 16:88635410-88635432 AGGGAACGCACAGTGTTGGGAGG - Intergenic
1143042364 17:4048040-4048062 CGGGGAAGCACAGTGCTTATGGG + Intronic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1145104810 17:20106117-20106139 AGGGAAATCACAGTGGTTAAGGG - Intronic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1145723108 17:27090677-27090699 TGGGAAACCACAGTGGGTGTGGG - Intergenic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1146242678 17:31244616-31244638 ACGGACAGCACAGTGATTATGGG - Intronic
1146246806 17:31292560-31292582 ATTGAAAGCACAGTATTTGTGGG - Intronic
1146260537 17:31417418-31417440 GGGGAAAGGACAGTGCCTGTGGG - Intronic
1148037730 17:44680722-44680744 AGGAAAAGCACACTGAATGGAGG + Intronic
1148102719 17:45102523-45102545 AGAGAAAGAGCAGTGAGTGTGGG + Intronic
1148498954 17:48074384-48074406 AGGAAAATTACAGAGATTGTTGG + Intronic
1149111781 17:53041712-53041734 AGGGAATGCACATAGTTTGTTGG - Intergenic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1149249345 17:54750033-54750055 TGGGAGAGTGCAGTGATTGTGGG - Intergenic
1149582540 17:57761323-57761345 AGTGAATGCTCAGTGAATGTTGG - Intergenic
1149804154 17:59598669-59598691 TCTGAAAGCAAAGTGATTGTAGG + Intronic
1149842341 17:59976816-59976838 TCTGAAAGCAAAGTGATTGTAGG - Intergenic
1150336976 17:64337440-64337462 AGGGATAATACAGTGACTGTGGG + Intronic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1150669642 17:67181296-67181318 AGGGAAAGCTCTGTCATTTTAGG - Intronic
1150870897 17:68910321-68910343 AGGGAGAGGACAGTCATTGTGGG + Intronic
1151120856 17:71791265-71791287 AGAGAAAGCCCAGGGATTGGAGG - Intergenic
1152296365 17:79469489-79469511 AGGGACGGCACAGGGAATGTAGG - Intronic
1152411701 17:80127686-80127708 GGGGAAAGCATAATGATTTTTGG - Intergenic
1153201193 18:2649414-2649436 AGGGCAAGGAAAGTGATTTTGGG - Intergenic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1153765370 18:8369556-8369578 AGGAAGAGCGCAGTGACTGTGGG + Intronic
1155210415 18:23595855-23595877 AGGCAATGCACACTGATAGTTGG + Intergenic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1155792757 18:29995471-29995493 AGGGAGCGCATAGTGACTGTGGG + Intergenic
1157879197 18:51304113-51304135 AAGGAGAGTGCAGTGATTGTGGG + Intergenic
1157991723 18:52504516-52504538 AAGTAAAGCACAGTGGCTGTGGG + Intronic
1159303815 18:66613836-66613858 AGGAAAAGTACAGTGATTGAAGG - Intergenic
1159339797 18:67119809-67119831 ACGGAAAGCTCAGTGATTGGGGG - Intergenic
1159802680 18:72920395-72920417 AGGGAGAGCACAGTCATTATGGG - Intergenic
1160023573 18:75200664-75200686 AGGGAAACCACAGAGATTAGGGG - Exonic
1163476079 19:17526938-17526960 AGGGTAGGCACAGTGCTGGTGGG + Intronic
1163791468 19:19308824-19308846 AGGGTAAGCACATTGAGTGCAGG + Intronic
1165645267 19:37430885-37430907 AGGGAGACCAGAGTGATTGCAGG + Intronic
1166623919 19:44332318-44332340 TGGGGCAGCACACTGATTGTGGG + Intronic
1167613111 19:50516860-50516882 AGAGAAAACAAAGTGAATGTGGG - Intergenic
1168115079 19:54217854-54217876 AGGGAAAGGGCAGAGAGTGTGGG - Intronic
1168120772 19:54251546-54251568 AGGGAAAGGGCAGAGAGTGTGGG - Intronic
1168124350 19:54275443-54275465 AGGGAAAGGGCAGAGAGTGTGGG - Intronic
925194883 2:1914832-1914854 ATGGAAAAGACAGTGGTTGTGGG - Intronic
925426986 2:3757933-3757955 GGGGAAAGCACTGTGAGAGTGGG + Intronic
925484838 2:4316526-4316548 AAGGACAGTACAGTAATTGTGGG - Intergenic
925506439 2:4569891-4569913 AGAGAAAACACAGTGATTGTGGG - Intergenic
925570229 2:5302671-5302693 AGGGAAACTACCGTAATTGTGGG + Intergenic
925967256 2:9077517-9077539 AGGGACAGCAATGTGATTGATGG - Intergenic
926320042 2:11743345-11743367 AGGGAGAGGACAGTGATCCTCGG - Intronic
926516250 2:13850645-13850667 AGAGAGAGCACAGTAATTGTGGG + Intergenic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
927108731 2:19849193-19849215 AGGGAAAGCTCAGGGAATGGAGG + Intergenic
928293443 2:30060606-30060628 AGGGAAAACACAGTGATTCTGGG + Intergenic
928450105 2:31371067-31371089 TGGGATAGCACAATGAATGTGGG - Intronic
928468050 2:31541776-31541798 ATGGACAGTACAGTGATTGTGGG + Intronic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
928847610 2:35696689-35696711 AGGGAGAGCAAAGTGACTGGGGG - Intergenic
929281837 2:40088203-40088225 AAGGAAAGTGCAGTGACTGTGGG - Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930439784 2:51391220-51391242 AGGGAGAGTACAGTGACTGGGGG - Intergenic
930778157 2:55196028-55196050 AGGAAGAGTGCAGTGATTGTAGG + Intronic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
930971402 2:57398799-57398821 AGAAAGAGCACAGTGATTGTGGG - Intergenic
930981271 2:57528779-57528801 AGGGAGAGTTAAGTGATTGTGGG - Intergenic
932101144 2:68900382-68900404 AAGGACAGCAAGGTGATTGTAGG + Intergenic
932889379 2:75579003-75579025 AGAGAAAGTGCAGTGATTGTGGG + Intergenic
933754684 2:85628976-85628998 ATGGTAAGCACAGTGCTGGTCGG + Intronic
934039809 2:88118414-88118436 AGAGTAAGTACAGTGATTGGTGG - Intergenic
934917675 2:98313379-98313401 AGGCAAGGAACAGTGCTTGTGGG + Intergenic
934928862 2:98404045-98404067 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
935619278 2:105114605-105114627 GGGGAAAATACAGTGATTTTTGG + Intergenic
936511403 2:113150406-113150428 AGGGATAGTGCAGTGATTGCCGG - Intergenic
936940504 2:117879297-117879319 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
937664964 2:124476426-124476448 AGTGACATCACAGTGTTTGTGGG + Intronic
938270542 2:129966440-129966462 ATGCAAAGCACTGTGGTTGTCGG - Intergenic
938587636 2:132707207-132707229 GGGGAAAGTGCAGTGACTGTGGG + Intronic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942294761 2:174506952-174506974 AGAGAAAGCACAGCGAGTGTCGG + Intergenic
942596460 2:177595658-177595680 CTGGAAAGCACAGTGATTAAAGG - Intergenic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
942972378 2:181971868-181971890 AAGGAGAGCAAAGGGATTGTGGG - Intronic
943117607 2:183692442-183692464 AGGGAGAGCACAGTGAATGGGGG - Intergenic
943177104 2:184490663-184490685 AGGGAGAGCAGAGAGATTGGGGG + Intergenic
943237335 2:185338843-185338865 AGAGAGAGCACAGTGACTGTGGG - Intergenic
943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG + Intergenic
944133379 2:196370828-196370850 AGGGAGAATGCAGTGATTGTGGG - Intronic
944524468 2:200604332-200604354 CGTGAAATCACAGTGTTTGTAGG + Intronic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944677071 2:202042502-202042524 ATGAAAAGCACAGTGTTTTTTGG - Intergenic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
944928906 2:204495822-204495844 AAGGAAAAAAGAGTGATTGTGGG - Intergenic
946786360 2:223248361-223248383 AGGAAAAGCAAATTGGTTGTGGG - Intergenic
947009273 2:225547616-225547638 AAGGAGAGTATAGTGATTGTGGG - Intronic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
947587220 2:231363919-231363941 GGGGAAGGCACCATGATTGTAGG - Intronic
948475616 2:238217116-238217138 GGAGAGAACACAGTGATTGTGGG - Intergenic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
948794714 2:240396417-240396439 AGGGAAAGCTCAGTAAATGGTGG + Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1168900046 20:1355541-1355563 GAAGAGAGCACAGTGATTGTGGG - Intronic
1169623824 20:7540200-7540222 AGGGAGAGCAAGGTGATTGTAGG + Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170142006 20:13133775-13133797 AGGGATGGTCCAGTGATTGTAGG + Intronic
1170293795 20:14801837-14801859 AAGGAAAGTACAGTGATGCTCGG - Intronic
1170311409 20:14996693-14996715 AAGGAGAGTGCAGTGATTGTAGG + Intronic
1170460804 20:16574829-16574851 AGGGAAAACCCAGTGATTTCCGG - Intergenic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1170864221 20:20138508-20138530 AGAGAAAGTGCAGTGACTGTGGG - Intronic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1172838890 20:37890201-37890223 AGGAACAGCGCAGTGAATGTGGG + Intergenic
1173097465 20:40049756-40049778 AAGGAAAGCACTAGGATTGTTGG - Intergenic
1173462502 20:43254536-43254558 GTGAAAAGCACAGTGCTTGTAGG - Intergenic
1173709696 20:45143786-45143808 AGGGAGAGCTCAGTGCTTGTGGG - Intergenic
1174845689 20:53941004-53941026 AGGGAAAGGACACAGATTCTTGG + Intronic
1174977115 20:55348622-55348644 GGGGAAAACACAGGGCTTGTGGG + Intergenic
1174998499 20:55599914-55599936 GTGGAAAACACAGTGATGGTGGG + Intergenic
1175206160 20:57313118-57313140 ACTGGAAGCCCAGTGATTGTAGG + Intergenic
1175325443 20:58124094-58124116 AGGTAAAGCACAGGGAATTTAGG + Intergenic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1175824626 20:61930353-61930375 TGGGAACCCACAGTGGTTGTGGG - Intronic
1176914448 21:14608309-14608331 AGGGAGAGCAAAGTTATTGTGGG + Intronic
1177222330 21:18210291-18210313 AGGGGAAGTGCCGTGATTGTGGG - Intronic
1177539734 21:22477109-22477131 AGGGAGAGTGCAGTAATTGTAGG + Intergenic
1177692699 21:24531890-24531912 AGAGACAACACAGTAATTGTGGG + Intergenic
1178170739 21:30036907-30036929 AGTGTAAGAACAGTGATGGTTGG - Intergenic
1178664527 21:34534761-34534783 AGGGGAAGCACTGTGCTTGAGGG + Intronic
1179652382 21:42820035-42820057 AGGGAAGGTGCAGTGATTGTGGG + Intergenic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1180463571 22:15590291-15590313 ATGCAAAGCACTGTGGTTGTCGG + Intergenic
1185219960 22:49624261-49624283 AGGGAGGGCACAGTGATGCTCGG + Intronic
1185219995 22:49624415-49624437 GGGGAGAGCACAGTGATGCTCGG + Exonic
949251471 3:1989554-1989576 ATGGAAAGCACATGGATTGTTGG - Intergenic
949962388 3:9323194-9323216 AGGGACAGCACAGGGAGTTTTGG + Intronic
950829167 3:15858012-15858034 AGGTAAAGCACAGTTATAGCAGG - Intronic
950859174 3:16132395-16132417 AGGGAAAGCCCAGTCATTCCAGG - Intergenic
951022587 3:17797163-17797185 AGGGAACTCAGAGTGGTTGTGGG + Intronic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951279667 3:20732346-20732368 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
951597453 3:24333634-24333656 AGGCAAAGCACAGTATGTGTGGG + Intronic
952683366 3:36121723-36121745 AAGGAGAGCAAAGTGAGTGTGGG + Intergenic
952688486 3:36176245-36176267 AGGAAAAGTGCAGTGATTGTGGG - Intergenic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
952812011 3:37412334-37412356 AGGAACAGCACAGTGATTGTGGG - Intronic
953024025 3:39134580-39134602 GGGGAAAGCACATTCACTGTAGG + Intronic
954473363 3:50719371-50719393 AGCAAGAGCACAGTGATTATAGG + Intronic
954488447 3:50877420-50877442 AGGGAAAGCACACAGATTTCTGG - Intronic
954491478 3:50910709-50910731 AGGGAGAACAAAGTGACTGTGGG - Intronic
954724626 3:52597101-52597123 AGTTAGAGCACAGTGATTGAGGG - Intronic
954877990 3:53815742-53815764 AGGGTCAGCACAGTCATGGTTGG + Exonic
955585332 3:60471512-60471534 AAGGAGAGTGCAGTGATTGTGGG - Intronic
955604809 3:60690114-60690136 AGTGAAAGCACAAAGATTCTAGG + Intronic
955688150 3:61564552-61564574 AGGGAAAGGACAGTGGTGGGAGG + Intronic
956098303 3:65740588-65740610 AGGAAAATCCCAGTGATAGTGGG + Intronic
956221549 3:66909367-66909389 TGAGAAAGTACAGTGATAGTTGG + Intergenic
956416163 3:69032278-69032300 AGGAATAGCACAGAGATAGTTGG + Intronic
956549382 3:70441361-70441383 AGAGAGAGCACAGTAATTGTAGG + Intergenic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957538098 3:81532020-81532042 AGGGAAAACACAGTGACTGTGGG - Intronic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
957977087 3:87460578-87460600 AGGGACAGAAAAGTAATTGTAGG + Intergenic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
958760055 3:98296223-98296245 AGGGAGAGAACACTGATTGTGGG + Intergenic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959259216 3:104053274-104053296 AGTGAAAGCCCAGTAGTTGTGGG + Intergenic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
959868991 3:111304871-111304893 AGGAAAAGCACAGTGCATCTAGG + Intronic
960298188 3:115968999-115969021 AAGGTGAGCTCAGTGATTGTAGG - Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
960471947 3:118076375-118076397 AGGGAGAGCATAGTGATTATGGG - Intergenic
960840933 3:121957918-121957940 AGGGAAAGCACCGTAATTGTGGG + Intergenic
961161521 3:124730642-124730664 AGGGAAAGGACAGGGCTTGGTGG + Intronic
961349431 3:126290289-126290311 AGGGAAAGCACAGGGATGCTTGG + Intergenic
961764931 3:129202432-129202454 AGGCAGAGCACAGAGATTTTGGG - Intergenic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
963572029 3:147009377-147009399 AGGGAGAGAAAAGTAATTGTGGG - Intergenic
963701282 3:148629986-148630008 AGGAAAAGCAAAGTGATTATGGG + Intergenic
964140888 3:153397455-153397477 AAGGAGAGCAAAGTGATTGTGGG - Intergenic
964151561 3:153531753-153531775 AGGCAGAGCACAGTGTTTGTGGG + Intergenic
964179222 3:153864281-153864303 AAGGAAAGCACAGTGATTTAGGG + Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
964945061 3:162211577-162211599 AGGGAAAACAGAGTCTTTGTTGG - Intergenic
965027096 3:163316168-163316190 AGTGAGAGCAAAGTGATTGGAGG - Intergenic
965256984 3:166425751-166425773 AAGGAGAGCACAGTGACAGTGGG + Intergenic
965264052 3:166518184-166518206 AGGGAAAGTGCAGTTACTGTGGG + Intergenic
965379141 3:167966775-167966797 AGGGAAAGCACAGTGATTTTAGG + Intergenic
965535362 3:169818169-169818191 AGGGAGAGGAAAGTGACTGTGGG - Intergenic
965844395 3:172945580-172945602 AGGGAGAATACAGTAATTGTGGG + Intronic
965853942 3:173065698-173065720 AGGGAAAGTAAAGTGAGTGTGGG + Intronic
966328905 3:178789597-178789619 GAGAAGAGCACAGTGATTGTGGG + Intronic
966454107 3:180095059-180095081 AGGGAGAACACGGTGATTGTGGG - Intergenic
967677360 3:192316458-192316480 AAGGAGAGTACAGTGGTTGTGGG + Intronic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
968096043 3:195931515-195931537 AGGTAGAGCACAGTGATGATGGG + Intergenic
968096053 3:195931577-195931599 AGGCAGAGCACAGTGATGATGGG + Intergenic
968096064 3:195931639-195931661 AGGTAGAGCACAGTGATGATGGG + Intergenic
968096075 3:195931701-195931723 AGGTAGAGCACAGTGATGATGGG + Intergenic
968096083 3:195931763-195931785 AGGCAGAGCACAGTGATGATAGG + Intergenic
968218459 3:196914930-196914952 AGGAAGAGCAAAATGATTGTGGG + Intronic
969951223 4:10837721-10837743 AGAGAAAGCACAGTGTTTAGGGG + Intergenic
970920768 4:21391781-21391803 AGGGAAAGGAATGTGATTGCAGG - Intronic
970963233 4:21897959-21897981 AGGGAAAGTGCAGTGATTATGGG + Intronic
972125399 4:35758931-35758953 AGGGAGATTGCAGTGATTGTGGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972278568 4:37582066-37582088 AGGGAGAGTACAGTGATTTGGGG - Intronic
972380264 4:38512823-38512845 GAGGAAAGCACAGTGAGTTTGGG - Intergenic
972668310 4:41189459-41189481 AGGGAAAGCACACAGATCTTAGG - Intronic
973169468 4:47121265-47121287 AAGAAAAGCACAGCAATTGTGGG - Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973348443 4:49082258-49082280 AGGGAAAGTGCAGTGATTGTGGG + Intergenic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
974224361 4:59019227-59019249 AGAGAAAGCACAGTGATTGTCGG - Intergenic
974655887 4:64821452-64821474 AAGGGAAGCACAGTGATTAAAGG - Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
975463570 4:74683584-74683606 AGGGAAGGCGCAGTGATATTGGG - Intergenic
976082940 4:81376033-81376055 GGGGAGGGCACAGCGATTGTGGG - Intergenic
976721951 4:88177769-88177791 AGGGAGAGCACAGCGATTATGGG + Intronic
977134168 4:93281402-93281424 AGGGAGAGAACAGTCATTGCAGG + Intronic
977237366 4:94524880-94524902 AGGGAATGCAGAGTGATGGAAGG + Intronic
977521740 4:98093745-98093767 AGGCAAAGCACAGCAATTGGGGG + Intronic
977644389 4:99395645-99395667 AGGGAGAGTGCAGTGATAGTGGG + Intergenic
978096419 4:104784456-104784478 AGAGAAAGCACAGAGACTGTGGG - Intergenic
978478245 4:109157137-109157159 AGGAAGAGCACAGTGACTGAAGG + Intronic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
978733686 4:112061326-112061348 AGGGACAGCACAGTGATCATGGG + Intergenic
978934726 4:114360283-114360305 AGGGAGAGCACAGAGACTGCCGG - Intergenic
979111271 4:116761152-116761174 AGGGGAAGCACGGTGATTGTGGG + Intergenic
979213391 4:118133372-118133394 AGGGAGAGCACAGTGACAGGGGG - Intronic
979565189 4:122146462-122146484 AAGGAGAGTGCAGTGATTGTGGG - Intergenic
979945725 4:126829535-126829557 AGGGAAAGCACAGTGATTGCGGG + Intergenic
980103454 4:128564900-128564922 AGAGAAAGCAGAGAGATTGGAGG + Intergenic
980712638 4:136590671-136590693 AAGAAGAGCACAGTGATTGTGGG + Intergenic
980842058 4:138275562-138275584 AGGGAAAGCCCATTCACTGTTGG + Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981530910 4:145752945-145752967 AGTGAGAGCACAGCGATTGTGGG - Intronic
982208200 4:153013157-153013179 AAGGAAAGCACAGTGATATCTGG - Intergenic
982339723 4:154284589-154284611 AGGGTGAGCATGGTGATTGTGGG + Intronic
982502780 4:156178809-156178831 AGAGAAAGTAAAGTGTTTGTAGG + Intergenic
982798116 4:159669273-159669295 AGGGAGAGAAAAGTGAGTGTGGG - Intergenic
982817657 4:159906741-159906763 AGTGAGAGCACAGTGACTGTAGG + Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983417627 4:167479369-167479391 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
983755378 4:171328650-171328672 AGGAAGAGCAAAGTGAGTGTGGG + Intergenic
984395802 4:179198347-179198369 ATGGAAAGCAAAGTAAGTGTTGG - Intergenic
985124652 4:186681086-186681108 AGGGAAACAAGAGTGAATGTAGG + Intronic
985187256 4:187331120-187331142 AGAAAAAGAACAATGATTGTGGG + Intergenic
985880934 5:2638607-2638629 AGGGAAACCACCGTGAATGGAGG + Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
987886184 5:23815904-23815926 AGGGAGAGTAAAGTGAGTGTGGG + Intergenic
988265427 5:28942666-28942688 TGGGAGAGCACAGTTATTGTGGG - Intergenic
988516427 5:31908536-31908558 ACGGAAAGCACAGTAATGGCTGG + Intronic
989672498 5:43935505-43935527 AGGGAAAGAACAGCAATTGTGGG + Intergenic
990202965 5:53398311-53398333 AGGAAGACCATAGTGATTGTGGG - Intergenic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
991395410 5:66199280-66199302 AGGGAGAGTACAGCAATTGTGGG - Intergenic
991959096 5:72023759-72023781 AAGGAAAGCATATTGATTTTTGG + Intergenic
992531913 5:77660116-77660138 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
993279264 5:85904750-85904772 AGGGAAAGTGCAGTGACTGAGGG + Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
994000839 5:94777129-94777151 ATGGAAAACACACTGCTTGTCGG + Intronic
994114075 5:96041994-96042016 AGGGAAATCAAAGTAATTTTCGG + Intergenic
994320334 5:98387314-98387336 AGGGGAAGTGCAGTGATTGTGGG - Intergenic
995147001 5:108797540-108797562 AAAGAGAGCACTGTGATTGTGGG - Intronic
995245155 5:109927120-109927142 AGTGAAAGCACAATGATTGGGGG + Intergenic
995265185 5:110151839-110151861 AGGCAGAGCACAGTGACTGGGGG + Intergenic
995268742 5:110195729-110195751 AGGAAGAGTGCAGTGATTGTGGG - Intergenic
995290372 5:110444374-110444396 AGGGAGAGCTCAGTGACTGGGGG - Intronic
995421632 5:111974105-111974127 AGGGAAAACACAGTCACGGTAGG - Intronic
995557426 5:113344123-113344145 AGGGAAAGCACAGCAAGTGGGGG + Intronic
995573286 5:113503636-113503658 AGGGAGAGTGCAGTGATAGTGGG - Intergenic
995614354 5:113944306-113944328 AGTGAAAGCACAGTGAATGCTGG + Intergenic
995836344 5:116403258-116403280 AGTGAAAGCACAGCAATGGTGGG - Intronic
996653715 5:125913992-125914014 AGGAAGAGCTCAGTGATTGTGGG - Intergenic
996659856 5:125988954-125988976 AGGGACAGCAAAGTGATTGTGGG - Intergenic
996906691 5:128608971-128608993 AAGAACAGCACAGTGACTGTGGG - Intronic
997437824 5:133887703-133887725 AGGGACAGTCCAGTGACTGTGGG + Intergenic
998633920 5:143931481-143931503 AGGGAGAGCACAGAGACTGGAGG + Intergenic
998751352 5:145324896-145324918 AGGGAAAGCAAAGTATTTGTAGG + Intergenic
1000433411 5:161179310-161179332 ACGGAGAGCACAGTGATGGTGGG + Intergenic
1002794780 6:463594-463616 GGGGAAAGCCTGGTGATTGTTGG + Intergenic
1004017088 6:11742013-11742035 GGGAAAAGCTAAGTGATTGTAGG - Intronic
1004017092 6:11742046-11742068 GGGAAAAGCTAAGTGATTGTAGG - Intronic
1004989971 6:21125865-21125887 CGGGGAAGCACAGAGATTGTGGG - Intronic
1007416324 6:41693602-41693624 CGGGAAGGCACAGTGGTGGTGGG - Intronic
1008101147 6:47392495-47392517 AGGGAGACAACAGTGACTGTGGG - Intergenic
1008940396 6:57040183-57040205 AGGGAAAGCACAGCAACTGGAGG + Intergenic
1009373629 6:62939374-62939396 AAGGAGAGCACAGTGATGGCAGG - Intergenic
1009488590 6:64258106-64258128 AGGTAAAGCAGATTGATTGGAGG - Intronic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009847456 6:69151400-69151422 TGGGGGAGCACAGTGATTGTGGG - Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1010088792 6:71953617-71953639 AGGGAAAGTACAGTGGTAATGGG - Intronic
1011322935 6:86116723-86116745 AGGAACAGCACAAGGATTGTGGG - Intergenic
1011340892 6:86313219-86313241 AGGGAGACCACAGCAATTGTAGG + Intergenic
1011359814 6:86511371-86511393 AGGGGGAGAACAGTAATTGTGGG - Intergenic
1012047724 6:94300403-94300425 AGGGAAAGTGCAGTTATTGTGGG + Intergenic
1012059769 6:94463420-94463442 AAGGAAAGCTCAGTGATTGTGGG - Intergenic
1012783124 6:103589062-103589084 AGGGAAAGCGCAGCAATAGTGGG - Intergenic
1012892005 6:104907577-104907599 AAGGAAAGCACAGTGATTGTGGG + Intergenic
1013386843 6:109640283-109640305 TGGAAAAGCACAGTATTTGTGGG + Intronic
1013595950 6:111661419-111661441 AAGGAAAGCACTAGGATTGTTGG + Exonic
1013908450 6:115245936-115245958 AGGAAGAGTACAGCGATTGTGGG + Intergenic
1014234515 6:118939592-118939614 AGGGATAGCATAGAGATTATGGG + Intergenic
1014840902 6:126219007-126219029 AGGGAAAGCATAACAATTGTGGG - Intergenic
1015392788 6:132701848-132701870 AAGGAAAGTACAGTGATTGTGGG + Intronic
1015460595 6:133487086-133487108 AGGGAGAGCTCAGTGAGTGTAGG + Intronic
1015890770 6:137967812-137967834 TGGGACAGCAGAGTGATGGTGGG - Intergenic
1015890787 6:137967882-137967904 TGGGACAGCAGAGTGATGGTGGG - Intergenic
1015890810 6:137967983-137968005 TGGGACAGCAGAGTGATCGTGGG - Intergenic
1015969143 6:138726827-138726849 AAGGCAAGCACAGTGAGTGATGG + Intergenic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016229684 6:141788279-141788301 AGGGAGAGCATAGTAATTGTGGG + Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1018364943 6:163110459-163110481 AGGGGATGCAGAGTGACTGTTGG - Intronic
1019844638 7:3485433-3485455 AGGGAAAGCAAAGTGAGTGTGGG - Intronic
1020574935 7:9913997-9914019 AGGGAGAGTGTAGTGATTGTGGG - Intergenic
1020624195 7:10557901-10557923 AGGGAAAGCACAGCAACTGGGGG + Intergenic
1021179599 7:17490201-17490223 AGGGAAAGGACAGTCAGTCTAGG - Intergenic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1021842547 7:24732628-24732650 AGGGAGAGCACAGCAACTGTGGG + Intronic
1021884984 7:25129436-25129458 AGGGACAGGGCAGTGATTGCAGG - Intergenic
1021922978 7:25505713-25505735 AGGGACAGCACAATGACTGTAGG + Intergenic
1022223700 7:28340921-28340943 AGAGACAGCACAGTGATTATGGG - Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1022749992 7:33214290-33214312 AGGGACAGCACAGTGACTTGAGG - Intronic
1023646163 7:42318271-42318293 AGGGAGAGTGCAGTGGTTGTGGG + Intergenic
1023716136 7:43046303-43046325 AGTGACAGCACAGTGATTGTGGG + Intergenic
1024369222 7:48560323-48560345 AGGAAGAGCACAGTGACTGGGGG - Intronic
1024700099 7:51897599-51897621 AGAGAGAGCAAAGTAATTGTCGG - Intergenic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG + Intronic
1026479236 7:70764167-70764189 GGGGAAAGCACAGTCTTTGGGGG + Intronic
1027304066 7:76874035-76874057 AGGAAAAGTACAGAGATTGGAGG - Intergenic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1027604764 7:80287304-80287326 GTGGAGAGAACAGTGATTGTAGG + Intergenic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1027921286 7:84399125-84399147 AGGAAAAGCACGGTGAGTGTGGG + Intronic
1028207662 7:88034819-88034841 AGGGAGAGCACAGCAATTGTGGG - Intronic
1028568623 7:92260985-92261007 AAGGAAAGCAGAGTAAATGTTGG - Intronic
1028929664 7:96398414-96398436 AGGGAGAATGCAGTGATTGTGGG - Intergenic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1029652787 7:101905244-101905266 AGGAAAAGCACTATGATTTTAGG + Intronic
1030079118 7:105762277-105762299 AGGAAAAGAACAGGGATTGAAGG - Intronic
1030226814 7:107161943-107161965 AGGGAAAGCACCGTCACTCTTGG - Intergenic
1030257852 7:107530803-107530825 AGGGAAAGGAAATTGATTGGAGG - Intronic
1030362664 7:108611097-108611119 AGAGAAAGCACAAGGATTCTGGG - Intergenic
1030431723 7:109456350-109456372 AAGAACAGCACAGTGATTATCGG - Intergenic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1031215328 7:118883095-118883117 AGGGAGAGCACAGTGATCGGGGG + Intergenic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031272164 7:119665715-119665737 AGGGAAGGTGCAGTGATTGTGGG + Intergenic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031732541 7:125316384-125316406 AGGGAGAGTACAGAGATTTTGGG + Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1032331710 7:130986611-130986633 AGGAAATGCCCATTGATTGTTGG - Intergenic
1032989481 7:137376318-137376340 AGAGAAAGAACAGTAATTTTAGG - Intergenic
1033301718 7:140192247-140192269 AGGGGAAGCACATTTGTTGTGGG - Intergenic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033814120 7:145051648-145051670 AGAGAAAGCACGGTGATTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034581920 7:152050925-152050947 AGGGAGAGGGCAGGGATTGTAGG - Intronic
1035346815 7:158205776-158205798 AGAGAGAGCACAGTGATAGTGGG + Intronic
1035355747 7:158275177-158275199 AGGGACAGCACCGTGGCTGTGGG + Intronic
1038097511 8:24331296-24331318 TGGGAGAGGACTGTGATTGTGGG + Exonic
1038098167 8:24339802-24339824 ACACAAAGCACAGTCATTGTTGG + Intronic
1039211605 8:35222202-35222224 AGGGAGAGCACAGTGAATAAAGG - Intergenic
1040294958 8:46144352-46144374 ACGGAAACCACAGGGAATGTTGG - Intergenic
1040929994 8:52723551-52723573 AGGGACAGAATAGTGACTGTTGG - Intronic
1040991986 8:53362051-53362073 GGGGAAAGGACAGTCAGTGTAGG + Intergenic
1041156893 8:54996724-54996746 AGGGCCAGCACAGTGGTAGTTGG + Intergenic
1041222581 8:55666123-55666145 AAGGAAAGCACAGTGACACTGGG + Intergenic
1041744881 8:61197878-61197900 AGGGAGAGAACAGTGACTATAGG - Intronic
1043214885 8:77573652-77573674 AAGGAGAGCAAAGTGATTGTGGG + Intergenic
1043567203 8:81561639-81561661 AAGGAGGGCACGGTGATTGTGGG + Intergenic
1043804497 8:84654572-84654594 AGGGAAAGAGCAGTGGTGGTAGG - Intronic
1044124165 8:88437342-88437364 AGGGAGAGCCCAGCGATTCTGGG + Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1045592599 8:103614341-103614363 AGGGAGAGCATAGTGACTGGGGG - Intronic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1047548073 8:125839149-125839171 TGGGAATGCACAGTTGTTGTGGG - Intergenic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1049879043 8:145049523-145049545 AGGGGCTGCACAGTAATTGTAGG - Intergenic
1050145098 9:2559369-2559391 AGGGAGAGCACAGTAATTTAGGG + Intergenic
1051039219 9:12785665-12785687 AGGGAGAATACAGTGATTATGGG - Intronic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1054834135 9:69658712-69658734 TGGGAAAGCACATTGAAAGTAGG - Intronic
1054978084 9:71171666-71171688 AGGAAAAGCACAGGGTGTGTTGG + Intronic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1055127234 9:72732904-72732926 AGCTAAAGCACACTGAGTGTTGG - Intronic
1055615913 9:78072743-78072765 AGTGAAGGCACAGGGAATGTAGG + Intergenic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1056289388 9:85127466-85127488 AGGGAAAACACAGATATTGGGGG - Intergenic
1056424287 9:86461163-86461185 AAGGTAAGCTCAGTGATTCTTGG + Intergenic
1056516665 9:87358799-87358821 AGAGAAAGTGCAGTGACTGTGGG + Intergenic
1056609388 9:88114862-88114884 CGGGAAATCACAGTGGGTGTGGG - Intergenic
1057241226 9:93411776-93411798 AGAGAAAGTGCAGTGATTGTGGG - Intergenic
1058086284 9:100752028-100752050 AGGGGTTGCACAGTGATTGTGGG - Intergenic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1058820773 9:108727679-108727701 AGGGAAAGCACAGTGATTGCTGG + Intergenic
1058919107 9:109596535-109596557 ATGGAAAGCAAAGTCATTCTTGG + Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1059921137 9:119161146-119161168 AGGGAAAGCACAGTCATCTCTGG + Intronic
1060126612 9:121053729-121053751 AGAGAGAGCAAAGTGAGTGTGGG + Intergenic
1061638142 9:131928557-131928579 AGGGAGAGCACAGCGACTGGGGG + Intronic
1062122893 9:134843301-134843323 AGGGAAACCACATTTTTTGTAGG + Exonic
1062454384 9:136628856-136628878 CTGGAAGACACAGTGATTGTGGG - Intergenic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1186382356 X:9074200-9074222 AGGCAAAGCACAGTGACAGTGGG - Intronic
1186434820 X:9533659-9533681 AAGAAAGGCACAGTGATGGTGGG + Intronic
1186602034 X:11048606-11048628 AGGGAGAGCACAGTGTCTGGGGG - Intergenic
1187115773 X:16348927-16348949 AGGGAAAGCACAGAGAACCTGGG - Intergenic
1187132591 X:16517163-16517185 AGAGACAGCCCAATGATTGTGGG + Intergenic
1187575125 X:20545995-20546017 AGGGACAGCACAGCAATTGTGGG - Intergenic
1187579422 X:20592506-20592528 AGGAAGAGCACAGTGACTGGAGG - Intergenic
1187636677 X:21237417-21237439 AGGGAGAACATAGTGACTGTGGG + Intergenic
1187723890 X:22182388-22182410 AAGGAGAGTACGGTGATTGTGGG - Intronic
1187790250 X:22942544-22942566 AGGGAAATCACAGTGCTATTAGG - Intergenic
1188071920 X:25727688-25727710 AGAGACAGCATAGTGATTATGGG - Intergenic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188232108 X:27677226-27677248 AGAGAACACACAGTGTTTGTGGG - Intronic
1188421225 X:29992518-29992540 AGGGAGGGCATAGTAATTGTGGG - Intergenic
1188711338 X:33404296-33404318 AAAGAAAGCACAGTGCTTTTTGG + Intergenic
1188716548 X:33465465-33465487 AAAGAGAGCACAATGATTGTGGG - Intergenic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188902850 X:35755999-35756021 AGGAAAAGCCCAGGGATAGTTGG + Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1189119414 X:38378261-38378283 AAGGAAGCCACAATGATTGTGGG - Intronic
1189412003 X:40780596-40780618 AAGGAGAGCACAGTGATGGTGGG - Intergenic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1189640650 X:43067449-43067471 AAGGAAAGTGTAGTGATTGTGGG + Intergenic
1190122597 X:47674549-47674571 AGGGAGAACACAGTGAATGTGGG - Intergenic
1190340461 X:49291861-49291883 AGGGGAAGCAGAGGGGTTGTAGG - Intronic
1191593322 X:62913011-62913033 ATGTAAAAGACAGTGATTGTGGG - Intergenic
1191812497 X:65204037-65204059 AGAGAGAACACAATGATTGTGGG - Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192626373 X:72733007-72733029 AGAGAATGCACAGTGATTTCCGG - Intergenic
1192677962 X:73219602-73219624 AGGGAGTGCAAAGTGAGTGTGGG + Intergenic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1192858609 X:75040694-75040716 AGAGAGAGAACAGTGATAGTGGG - Intergenic
1192875348 X:75223645-75223667 AGGGAAACTGCAGTGATTGTGGG - Intergenic
1192958903 X:76104971-76104993 GGAGACAGCACAGTGATTATGGG - Intergenic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1193750513 X:85337271-85337293 AGGGAGAGCAAGGTGAGTGTGGG - Intronic
1193856825 X:86612604-86612626 AGGGAAAGCATAGCTATTATGGG - Intronic
1193896935 X:87126496-87126518 AGGGAGAGTGCAGTGATTATGGG + Intergenic
1193912137 X:87318258-87318280 AGCGAAAGAACAGCAATTGTGGG - Intergenic
1193931694 X:87561371-87561393 GGGGAAAGCAAAGTGATTGTAGG + Intronic
1193933198 X:87582386-87582408 AGGGATAACACAGCAATTGTGGG + Intronic
1194095647 X:89636024-89636046 AGGGACAGCACAGCAATTGTGGG + Intergenic
1194196733 X:90903554-90903576 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1194526369 X:94982843-94982865 TGGGAAAGTGCAGTGACTGTGGG + Intergenic
1194693043 X:97010244-97010266 AGAGAGAGCACAATGATTGTGGG - Intronic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1194937740 X:99971124-99971146 AGGGAGAGCACAATTATTGTGGG - Intergenic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195230901 X:102845813-102845835 TAAGAAAGCACAGTGATTGCTGG + Intergenic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195300339 X:103524160-103524182 TAAGAAAGCACAGTGATTGCTGG - Intergenic
1195303333 X:103554330-103554352 CAAGAAAGCACAGTGATTGCTGG - Intergenic
1195543435 X:106088249-106088271 AAGGAAAGCACAGCAATTGTGGG - Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196290125 X:113930070-113930092 GGGGACAGCAAAGTGAGTGTGGG - Intergenic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196384963 X:115139690-115139712 AGGGAGAGCACAGGGACTGGGGG + Intronic
1196512190 X:116524591-116524613 AGGGAGAGCACAATGATTGGAGG - Intergenic
1196532642 X:116806793-116806815 AGAGACAGCACAGTGACTGGGGG - Intergenic
1196619479 X:117806333-117806355 CAGGAGAGCACAGTGACTGTGGG + Intergenic
1197011478 X:121569974-121569996 AGGGAAAGTACAATGATTGTGGG + Intergenic
1197053802 X:122093477-122093499 GGGAAGAGCACAGCGATTGTGGG + Intergenic
1197078296 X:122379061-122379083 AGGGAGAGCACAGTGACTGAAGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197177965 X:123504780-123504802 AGGGAGAGCACAGTGATTTGGGG + Intergenic
1197399871 X:125977356-125977378 AGGGAAAGCAAAGTGATTGTGGG + Intergenic
1197439220 X:126470281-126470303 AGGGAAAGCATAGTGATTGTGGG + Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197514697 X:127411270-127411292 AGAGACAGCACAGTGATTGTGGG - Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1198697362 X:139355765-139355787 GAGAAAAGCACAGTGATTGTGGG - Intergenic
1198761561 X:140038345-140038367 AGGGAGAGGAAAGTGACTGTGGG + Intergenic
1198947674 X:142032232-142032254 AGGGAGAATGCAGTGATTGTAGG - Intergenic
1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG + Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199795396 X:151191064-151191086 AGGGAGAGCAAAGTGATTGCGGG + Intergenic
1199962820 X:152791773-152791795 AGAGAGAGGGCAGTGATTGTGGG + Intergenic
1200177207 X:154125533-154125555 AGGGAGGGCACGGTGACTGTGGG + Intergenic
1200370089 X:155715867-155715889 AGGGCAAGCACAGCGACTGGGGG - Intergenic
1200448646 Y:3297392-3297414 AGGGACAGCACAGCAATTGTGGG + Intergenic
1200542579 Y:4477755-4477777 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1201066970 Y:10106251-10106273 AGGGAGGGCACAGTGACTGGAGG + Intergenic