ID: 1081245653

View in Genome Browser
Species Human (GRCh38)
Location 11:40763653-40763675
Sequence AGGGAAAGCACAGTGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 723
Summary {0: 2, 1: 35, 2: 77, 3: 170, 4: 439}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081245647_1081245653 28 Left 1081245647 11:40763602-40763624 CCACACTGTAGCAGTGTCTGTGT 0: 1
1: 0
2: 1
3: 18
4: 207
Right 1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG 0: 2
1: 35
2: 77
3: 170
4: 439
1081245645_1081245653 30 Left 1081245645 11:40763600-40763622 CCCCACACTGTAGCAGTGTCTGT 0: 1
1: 0
2: 0
3: 11
4: 163
Right 1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG 0: 2
1: 35
2: 77
3: 170
4: 439
1081245646_1081245653 29 Left 1081245646 11:40763601-40763623 CCCACACTGTAGCAGTGTCTGTG 0: 1
1: 0
2: 1
3: 18
4: 205
Right 1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG 0: 2
1: 35
2: 77
3: 170
4: 439

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081245653 Original CRISPR AGGGAAAGCACAGTGATTGT GGG Intronic