ID: 1081246646

View in Genome Browser
Species Human (GRCh38)
Location 11:40775108-40775130
Sequence GTGGACAAGAAAGTAAATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 1, 2: 1, 3: 28, 4: 275}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081246645_1081246646 -8 Left 1081246645 11:40775093-40775115 CCAGTTTTTAATGTAGTGGACAA 0: 1
1: 0
2: 1
3: 14
4: 134
Right 1081246646 11:40775108-40775130 GTGGACAAGAAAGTAAATATTGG 0: 1
1: 1
2: 1
3: 28
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081246646 Original CRISPR GTGGACAAGAAAGTAAATAT TGG Intronic
902285272 1:15404275-15404297 GTGAACAAAAAACAAAATATAGG + Intergenic
904641310 1:31932501-31932523 GTGGGCAAGAAAATCAGTATAGG + Intronic
906128559 1:43442357-43442379 GTGGACAAGAAGGTAAATATGGG + Exonic
906744822 1:48214233-48214255 TTGGAGAAGAAAGTAAAAAGAGG + Intergenic
908432736 1:64074556-64074578 GTGGACAAGAAATGAAAAGTGGG + Intronic
908631938 1:66118816-66118838 GTAGAGAAGAAAGAAAAAATAGG - Intronic
909014503 1:70368216-70368238 TTGGAGAAGAAAGTAAAAAGAGG - Intronic
909212996 1:72848025-72848047 GTGGACAAGAAAGTCAATTATGG - Intergenic
910559582 1:88576195-88576217 GGAGGCAAGAAAGTACATATGGG + Intergenic
911300680 1:96169394-96169416 GTGCACAAGAAAGCAGAAATAGG + Intergenic
913970841 1:143415140-143415162 GAGGAAAAGAAAGTAAATGAAGG - Intergenic
914065218 1:144240751-144240773 GAGGAAAAGAAAGTAAATGAAGG - Intergenic
914113933 1:144725603-144725625 GAGGAAAAGAAAGTAAATGAAGG + Intergenic
914360740 1:146933701-146933723 GTGGATAAGAAAAGAAATATTGG - Intergenic
914491842 1:148156938-148156960 GTGGATAAGAAAAGAAATATTGG + Intergenic
914885383 1:151580356-151580378 GAGGACAAAAAATTATATATAGG + Intronic
916875775 1:168966891-168966913 CTGAACAAGAGTGTAAATATTGG + Intergenic
917485133 1:175448731-175448753 GTGGTCACGAAAGTGAATATCGG - Intronic
918682368 1:187371247-187371269 GTAAATAAGTAAGTAAATATAGG + Intergenic
921037354 1:211394068-211394090 GGGGGGAAGAAAGTAAATGTAGG - Intergenic
921561424 1:216662992-216663014 GTGAGCAAGAAAGGAAATAATGG - Intronic
921592939 1:217024627-217024649 GGGGACAATAAAGGAAAGATGGG - Intronic
921641539 1:217560520-217560542 GTGTTCAAGAAAGTATATATAGG - Intronic
923814454 1:237359810-237359832 CTGGATAAGAAAGTAACTAATGG + Intronic
923877858 1:238069554-238069576 TTGAACAAGTAAGTAAATATAGG - Intergenic
923946474 1:238893682-238893704 GTCAACAAGAAGGTAAATGTTGG - Intergenic
924397040 1:243631624-243631646 TTGGAAGAGAAAGTCAATATGGG - Intronic
1064749626 10:18514187-18514209 GTGGACAGGAGAGGAAAAATAGG - Intronic
1068939406 10:62666224-62666246 GAGGACAAGACATCAAATATAGG - Intronic
1072095758 10:92177864-92177886 GAGGTCAAGAAAGTAAAAAAAGG + Intronic
1073394359 10:103206026-103206048 TTGGAGAAGAGAGTAAAAATAGG - Intergenic
1073673360 10:105617254-105617276 GTGGACAAGAAAGGCAGCATAGG + Intergenic
1073707074 10:105996688-105996710 GTGGAAAAGAAAGTAATGAAAGG - Intergenic
1078150713 11:8757462-8757484 GGAGACAAGAAAGTAAAAAGTGG + Intronic
1079230304 11:18643835-18643857 TTGGAGAAGAGAGTAAAAATAGG - Intergenic
1079607332 11:22386370-22386392 GTGGAGAAGAATGTAAACAGAGG + Intergenic
1079880317 11:25919702-25919724 TTGGCCAAAAAAGTAAATATAGG + Intergenic
1081246646 11:40775108-40775130 GTGGACAAGAAAGTAAATATTGG + Intronic
1081324950 11:41732906-41732928 ATGGAAAAGTTAGTAAATATAGG + Intergenic
1084879936 11:72163694-72163716 GTGGAGAAGAAAGGAAAAAAAGG + Intergenic
1085902504 11:80718383-80718405 GAGGACCAGAAAGAAAATAGAGG - Intergenic
1087317521 11:96621155-96621177 GAGGACAAGAAAATAAAGACAGG - Intergenic
1087420244 11:97913960-97913982 GAGGTCAAGAAAAGAAATATCGG - Intergenic
1087713943 11:101584955-101584977 GTGGACAACAAAATGAATGTTGG + Intronic
1091500261 12:1010178-1010200 GTCGAAGAGAAAGGAAATATTGG + Intronic
1094064315 12:26347169-26347191 GTGGACAATTAAGTAAGAATAGG - Intronic
1095673567 12:44890219-44890241 GTGAGCAAGAAAATAAATGTGGG + Intronic
1096713156 12:53472874-53472896 GTGGACAAGAAAACAAATCTAGG - Intronic
1097438501 12:59580089-59580111 GAAGACTAGAAAGTTAATATAGG - Intergenic
1097751674 12:63361492-63361514 GTGAATAAAAAAGTATATATTGG + Intergenic
1097993564 12:65862838-65862860 GTGGAGAAGAAAGGGAATATGGG + Intronic
1098296803 12:69012267-69012289 GTGGATAGAAAAGTAAAAATAGG - Intergenic
1098476388 12:70908994-70909016 GTGGAGAAGAAAGAGAAAATTGG + Intronic
1099329805 12:81269723-81269745 GCAGACAAAAAAGTACATATTGG - Intronic
1100481549 12:94984219-94984241 GTGGACAAGCTAGGAAACATGGG - Intronic
1102648937 12:114423098-114423120 TTGGGCAAGGAAATAAATATTGG + Intergenic
1103114331 12:118312881-118312903 GTGGAGAAAAAAATAAATTTGGG + Intronic
1104495604 12:129234463-129234485 GTGTTCAAGAAAATAAATCTAGG + Intronic
1105329077 13:19398185-19398207 ATGGACAAGAAAGTAATCTTTGG - Intergenic
1106151714 13:27110153-27110175 GTGGAAGAGAAGGAAAATATTGG + Intronic
1106155755 13:27154344-27154366 TTTGATAAGTAAGTAAATATAGG - Intronic
1106876462 13:34079307-34079329 GTAGACAAGAAAACAAAAATTGG + Intergenic
1107220590 13:37974345-37974367 TTGGAGAAGAAAGTAAAAAGAGG + Intergenic
1107341929 13:39416854-39416876 GTAGACAAGAAGATAAAAATAGG - Intronic
1107374627 13:39788796-39788818 GTGGAGAAAAAAGTTAATAATGG - Intronic
1107620361 13:42222584-42222606 GTCCACAAAAAAGTAAATGTAGG + Intronic
1109807451 13:67462181-67462203 GTGGACCATAAAGTCACTATTGG + Intergenic
1110982187 13:81915040-81915062 GTGGACAATAAAATAAACAGAGG - Intergenic
1111177373 13:84613256-84613278 TTTGACAAGAGAGAAAATATAGG - Intergenic
1111673753 13:91361244-91361266 GTGGAAAAAATATTAAATATTGG - Intergenic
1111830062 13:93317655-93317677 GTTGATAAAAAAGTAAATGTAGG - Intronic
1111847091 13:93524508-93524530 TTGGACAAGAAAGTTTACATTGG + Intronic
1113316482 13:109185311-109185333 GTGCACAAAAAAGTAATTTTGGG + Intronic
1113380513 13:109800528-109800550 GTGGACTTCAAAATAAATATTGG - Intergenic
1114512322 14:23272792-23272814 GAGGACAAGAAGGTAGATGTGGG - Exonic
1115620718 14:35137399-35137421 GTAGAAAAGAAAGTGAAGATGGG + Intronic
1116062330 14:39939573-39939595 GGGAAAAAGAAAGTAAAAATGGG - Intergenic
1116665872 14:47774706-47774728 GTGAACAATAATGTAAATTTTGG + Intergenic
1116709980 14:48356081-48356103 GTGGATAAGAAATTAAAAGTTGG + Intergenic
1116926555 14:50644286-50644308 CTAGACAAGAAAGTGAAAATTGG - Intronic
1117333377 14:54736205-54736227 CTGGAAAAGAAATTAAAGATGGG + Intronic
1118057178 14:62091411-62091433 GTTAACATGTAAGTAAATATAGG + Intronic
1118985874 14:70754418-70754440 GTAAACAAGAAAGAAAAGATAGG - Intronic
1120244021 14:81984485-81984507 GTAGCCAAGCAAGTAAAAATTGG - Intergenic
1120633842 14:86926610-86926632 GTGAACATGAAATTAAAAATGGG - Intergenic
1122020347 14:98833086-98833108 CTTGTCAAGAAAGTAAATCTTGG - Intergenic
1123459343 15:20455203-20455225 GTGGACAAGCCAGGAACTATGGG - Intergenic
1123658718 15:22545215-22545237 GTGGACAAGCCAGGAACTATGGG + Intergenic
1124010786 15:25836896-25836918 GTGGACCTGAAGGTAAATACTGG - Intronic
1124056056 15:26241992-26242014 GTGGACAAGAAAGTTATGATAGG - Intergenic
1124265575 15:28231027-28231049 GTGGACAAGCCAGGAACTATGGG - Intronic
1124312583 15:28639711-28639733 GTGGACAAGCCAGGAACTATGGG + Intergenic
1125498862 15:40224488-40224510 GTAGATAAAAAATTAAATATAGG + Intergenic
1126060354 15:44774943-44774965 GTAAATAAGAAAGTAAATTTTGG - Intergenic
1126300784 15:47194028-47194050 GTAGACAACTAAATAAATATTGG + Intronic
1128052449 15:64675915-64675937 GTGGACAAGAAGGCAGAGATGGG + Exonic
1131320022 15:91379458-91379480 CTGGACATGAAAGTAGACATTGG + Intergenic
1131394152 15:92073404-92073426 GTGGACAAGAAAGTTAATTCTGG + Intronic
1132213891 15:100048514-100048536 GTGGAGAAGGAAACAAATATTGG - Intronic
1135912439 16:26573688-26573710 GTAGATAAGGAAATAAATATTGG + Intergenic
1136767841 16:32804301-32804323 GTGTACATGAAACTAAATTTTGG - Intergenic
1136800308 16:33066396-33066418 GTGTACATGAAACTAAATTTTGG + Intergenic
1138158823 16:54733196-54733218 ATGGATTAGAAAGTTAATATTGG + Intergenic
1138208550 16:55143486-55143508 GTGGACAGAAAAGTAAGTGTTGG - Intergenic
1140596995 16:76427755-76427777 TTGAACATGAAAGTCAATATTGG - Intronic
1140958522 16:79890150-79890172 GTTGACAAGAAAGACAATAATGG - Intergenic
1141329393 16:83095064-83095086 GTTGACAATAAAGTTAATTTTGG - Intronic
1203070232 16_KI270728v1_random:1066323-1066345 GTGTACATGAAACTAAATTTTGG - Intergenic
1142908429 17:3065346-3065368 GTGTTTAAGGAAGTAAATATAGG + Intergenic
1142926136 17:3238898-3238920 GTGTTTAAGGAAGTAAATATAGG - Intergenic
1145299172 17:21618869-21618891 GAGGAAGAGAAAGTAAATATGGG + Intergenic
1145351107 17:22084413-22084435 GAGGAAGAGAAAGTAAATATGGG - Intergenic
1146713782 17:35066297-35066319 GCAGAAAAGAAAGTAAATCTGGG - Intronic
1148076327 17:44937730-44937752 ATAGACAAGAAATGAAATATTGG - Intronic
1150881669 17:69036146-69036168 ATGGACAAAAAAGTAGATAATGG + Intronic
1151090184 17:71430442-71430464 ATTGACAACAGAGTAAATATTGG + Intergenic
1151741721 17:75987547-75987569 ATGCACAAGGATGTAAATATCGG + Intronic
1155373295 18:25127840-25127862 GTGGAAAAGAAAATAAATAATGG + Intronic
1155405138 18:25479680-25479702 GATGACAAGAAAAGAAATATTGG - Intergenic
1155891303 18:31273190-31273212 GTGGCCTAGAACATAAATATCGG + Intergenic
1156784958 18:40900040-40900062 ATTTACCAGAAAGTAAATATTGG - Intergenic
1156877270 18:42029970-42029992 GAGGAGAAGAAAGTAAAGAGAGG + Intronic
1159430968 18:68352816-68352838 GAGGACAAGAATGTAAATACAGG - Intergenic
1161180278 19:2876181-2876203 GTTCACAAGAAAGAATATATGGG + Exonic
1162942255 19:14018062-14018084 TTGCACAATAATGTAAATATGGG + Intergenic
1163006754 19:14401679-14401701 GGGGACAAGAACGTCACTATGGG + Exonic
1164791119 19:30981888-30981910 GAGTACAAGAAACTAAACATAGG - Intergenic
1165196796 19:34110493-34110515 TTGTATAAGAAAGAAAATATAGG - Intergenic
1165798915 19:38535972-38535994 GAGGAAAAGAAAGGAAAGATAGG - Intronic
1168594309 19:57663313-57663335 GTGTACATAAATGTAAATATTGG - Intergenic
925470046 2:4151267-4151289 TTGGAGAAGAAAGTAAATCAAGG - Intergenic
926481239 2:13398482-13398504 GTCGACATGAAAGAAAAAATGGG - Intergenic
926907836 2:17822535-17822557 GTGGAGAAGAACGTAACTAATGG - Intergenic
930687971 2:54329729-54329751 GTGGATGAGTAAATAAATATGGG - Intergenic
932702545 2:74001658-74001680 GTGGCCCAGGAAGTAAATCTAGG + Intronic
933754862 2:85630187-85630209 TTGTACATAAAAGTAAATATAGG - Intronic
934175541 2:89576066-89576088 GAGGAAAAGAAAGTAAATGAAGG - Intergenic
934255637 2:91412655-91412677 ATGGACACGAAAGTAATCATCGG + Intergenic
934285857 2:91650430-91650452 GAGGAAAAGAAAGTAAATGAAGG - Intergenic
936745751 2:115574475-115574497 GTGCACAAGAATTTAAACATGGG - Intronic
937497116 2:122432323-122432345 ATGTACACAAAAGTAAATATGGG - Intergenic
937585681 2:123545886-123545908 GAGGACAAGATAGTAAAAACAGG - Intergenic
938768170 2:134477696-134477718 GAGAGCAAGAAAGAAAATATTGG + Intronic
939023319 2:136984067-136984089 GAGAGCAAGAAAGAAAATATTGG + Intronic
939281637 2:140073034-140073056 TTAGAAGAGAAAGTAAATATAGG - Intergenic
941427915 2:165371909-165371931 GTGGAAAAGAAGATACATATAGG - Intronic
941545346 2:166843152-166843174 GAGGGCAGGAAAGAAAATATGGG - Intergenic
942240664 2:173962223-173962245 GGGGAGAAGGAAGGAAATATGGG - Intronic
943200121 2:184812126-184812148 ATCTACAAGAAAGTTAATATAGG - Intronic
946872039 2:224092929-224092951 GTGGAGAAGAGAGTAAAGAGAGG + Intergenic
947036800 2:225868154-225868176 TTGGAGAAGAAAGTAAGTTTGGG + Intergenic
1169514887 20:6304825-6304847 GTAGAGAAGAGAGCAAATATTGG - Intergenic
1170789983 20:19499789-19499811 GTGTACATGTATGTAAATATAGG - Intronic
1170979935 20:21202624-21202646 CTGGAAAAGAAAGTAAGTCTAGG - Intronic
1171065024 20:22007144-22007166 ATAGAAATGAAAGTAAATATTGG + Intergenic
1171561355 20:26129389-26129411 GAGGAAGAGAAAGTAAATATGGG - Intergenic
1172421120 20:34818839-34818861 TTGGACGAGAAAGGAAATATAGG - Intronic
1172922108 20:38492635-38492657 GTGAACTAAAAAGTAAATACAGG - Intronic
1174346934 20:49936893-49936915 GTGGACTAGAAAGGAAACGTCGG - Intronic
1176649891 21:9535906-9535928 GAGGAAGAGAAAGTAAATATGGG + Intergenic
1178177652 21:30122305-30122327 GTGGACATGAAGATAAATAATGG + Intergenic
1178790417 21:35694488-35694510 CTCCTCAAGAAAGTAAATATGGG - Intronic
949570882 3:5291887-5291909 GTAGATAAGTAAGTAAATAAAGG - Intergenic
950854211 3:16090286-16090308 TTTGACAAGAAAGTATGTATGGG - Intergenic
951638779 3:24810794-24810816 GAGGAAAAGAAAGTAAAATTTGG + Intergenic
951889249 3:27553198-27553220 TTGGACAAGAGAGTAAAAATAGG + Intergenic
952251466 3:31659998-31660020 TTGAACTAGAAAGAAAATATTGG + Exonic
952527851 3:34231200-34231222 GTAAATAAGAAAGTAAATCTCGG + Intergenic
954273079 3:49524506-49524528 CTCTACAAAAAAGTAAATATTGG + Intronic
955846166 3:63164999-63165021 GTACATAAGAAAGTAAATCTGGG - Intergenic
957236816 3:77603530-77603552 CTATACAAGAAAGTTAATATGGG + Intronic
957300063 3:78380469-78380491 GGGGAAAAGAAAGTCAAGATGGG - Intergenic
958635980 3:96747129-96747151 GAGGAAAAGAAAGAAAATCTTGG + Intergenic
959246964 3:103882777-103882799 GTAAACCAGAAAATAAATATGGG - Intergenic
960312729 3:116136254-116136276 GTGGCTAAGAAAGTAGCTATCGG - Intronic
960328386 3:116325611-116325633 GAGGATAAGAAAGTAGAAATAGG - Intronic
962954454 3:140251546-140251568 GAGGAAAAGAAAGTCAATAACGG + Intronic
963424952 3:145113627-145113649 TTGGAGAAGAGAGTAAAAATAGG - Intergenic
965362054 3:167753424-167753446 GTGGTAAATAAAGAAAATATAGG + Intronic
965897228 3:173593339-173593361 GAAGACAAAAAAGTAACTATTGG - Intronic
966215712 3:177500133-177500155 GAGGACAGGAAAGAAAATAGTGG + Intergenic
967355369 3:188563889-188563911 GTGGCCAAGAGAGTAAATGTTGG + Intronic
969864370 4:10064196-10064218 GTGGAGAAGAAGGTAAACAAGGG - Intergenic
970723634 4:19016917-19016939 CTGGAGAAGAAAGTAAAAAGAGG - Intergenic
970905229 4:21208140-21208162 AATGACTAGAAAGTAAATATAGG - Intronic
972058440 4:34834273-34834295 GTGAACATGAAAGCAAAGATTGG - Intergenic
973934828 4:55833844-55833866 GTGAACAAGATACAAAATATAGG + Intergenic
975194159 4:71503614-71503636 GTAGATAAGAAAGTAAATTAAGG - Intronic
975240617 4:72053295-72053317 GTGGAGAACAAAGTGAATCTGGG + Intronic
976858786 4:89637647-89637669 GTAGACCAGAAAGTAAAACTGGG + Intergenic
977980808 4:103319359-103319381 ATGCACAAAAAATTAAATATAGG + Intergenic
977980866 4:103320064-103320086 ATGCACAAAAAAATAAATATAGG - Intergenic
977981713 4:103331017-103331039 GTAGTAAGGAAAGTAAATATAGG + Intergenic
978105153 4:104893176-104893198 GAGAAGGAGAAAGTAAATATGGG + Intergenic
978411787 4:108434014-108434036 CTGGACAAAAATGTAAACATTGG + Intergenic
978981335 4:114949828-114949850 GTAAGCAAGAAAGTAAACATTGG + Intronic
979986883 4:127326056-127326078 GTGAGAAAGAAAGTAAATGTTGG - Intergenic
981974565 4:150710064-150710086 GCGTAAAAGAAAGAAAATATAGG + Intronic
982033083 4:151320423-151320445 GGGGACAATAAAGGAAATATAGG + Intronic
983865273 4:172759096-172759118 GTGGGCAAGAAAGTAAATAGAGG - Intronic
984009193 4:174350060-174350082 GTAGACTAGAAAGAACATATGGG - Intergenic
984329072 4:178291997-178292019 GTAGAATAGAAAATAAATATGGG - Intergenic
984658397 4:182345263-182345285 ATGGACAATGTAGTAAATATTGG - Intronic
984970383 4:185183563-185183585 GTGGAAAATAAAGAAAACATAGG + Intronic
985316745 4:188666119-188666141 GGGGAGAAAAAAGGAAATATGGG - Intergenic
987204974 5:15615667-15615689 GTGAATAAGAAAGTACATGTGGG - Intronic
988258393 5:28850278-28850300 CTGGACTACAAAGGAAATATTGG + Intergenic
988722999 5:33897286-33897308 GTAGACAAGAAAGTAGACATGGG + Intergenic
990495312 5:56341705-56341727 GTGGCCAAGAAATTAGATCTGGG - Intergenic
990660050 5:58003133-58003155 GTGTACAAGAAAGTAAGAGTAGG - Intergenic
990704336 5:58511255-58511277 ATGTACATGAAAGTGAATATAGG + Intergenic
991158695 5:63469385-63469407 AAGGACAAGAAAATAAAAATAGG + Intergenic
991973068 5:72159488-72159510 GTGGACTAGCAAGTAAACACTGG + Intronic
992573774 5:78089905-78089927 GTGGAGAATAAAATAGATATAGG - Intronic
992592546 5:78310231-78310253 ATGGAAAAGAAAGGAAATAAAGG + Intergenic
992920660 5:81514266-81514288 GAGGACAAAAAAGTAAATAAGGG + Intronic
993559866 5:89392561-89392583 ATGAACAAGAAAGGCAATATTGG - Intergenic
993686207 5:90941426-90941448 GTGGGCAAGAAGGTGATTATAGG + Intronic
993804807 5:92392513-92392535 GCTGACAAGAAAGTACATACTGG + Intergenic
995205735 5:109478488-109478510 GTGGACTATAAAGAAATTATTGG - Intergenic
996478881 5:123950757-123950779 AAGGAAAAGAAAGTGAATATGGG + Intergenic
996858291 5:128035033-128035055 GTAGACAAGAAAGGAAAGTTAGG - Intergenic
996916294 5:128715624-128715646 GAGGACCAGCAAGTAAATACTGG - Intronic
999047786 5:148487891-148487913 GTGGACAAGGAAGTATTTATTGG + Intronic
999968626 5:156836358-156836380 GTGGAAGAGTAATTAAATATTGG - Intergenic
1001218436 5:169877527-169877549 GTGTTGAACAAAGTAAATATGGG + Intronic
1002531304 5:179847466-179847488 GCTGACAAGAAAGTAACTCTCGG - Intronic
1005131178 6:22510249-22510271 GTGAGGAAGAAAGTATATATGGG - Intergenic
1007158139 6:39766177-39766199 GTGGAAAAGAATTTACATATGGG - Intergenic
1007438927 6:41840850-41840872 CTGGAAAAAAAATTAAATATTGG + Intronic
1008183423 6:48362788-48362810 GTTGACAAGAAAATAAATGAAGG + Intergenic
1008301928 6:49851477-49851499 GTGGCCAGGTAAATAAATATTGG - Intronic
1008362226 6:50633700-50633722 GTGTACCACAAAGTGAATATTGG + Intergenic
1009354749 6:62728504-62728526 GTGGGGAAGAAAGTAAAAACAGG - Intergenic
1009545299 6:65012004-65012026 GGGTACCAGAAAGAAAATATAGG - Intronic
1009562503 6:65266240-65266262 ACTGACAGGAAAGTAAATATAGG - Intronic
1009962669 6:70542656-70542678 GGGGACATAAAAGTATATATGGG - Intronic
1010834232 6:80567128-80567150 GTGGAAAACAAAATTAATATTGG + Intergenic
1011045248 6:83074768-83074790 GTGGTTAAGATAGTAAATTTTGG + Intronic
1012689254 6:102293315-102293337 TTGGAGAAGAGAGTAAAAATAGG - Intergenic
1013341127 6:109217122-109217144 GTGAACAAGGAAGAAAATTTAGG - Intergenic
1015006953 6:128294732-128294754 GTGGATAAAAAAGCAAAAATTGG - Intronic
1015733679 6:136374686-136374708 GTTGACATGATACTAAATATGGG + Intronic
1016215686 6:141599591-141599613 GTGGTCCATAAAATAAATATAGG - Intergenic
1017621467 6:156303735-156303757 GTGAACATGAAAGCAGATATTGG - Intergenic
1018304527 6:162441304-162441326 TTGGACAAAAAATAAAATATGGG - Intronic
1020662766 7:11002248-11002270 GTTTAGAAGAAAGTAAAAATGGG + Intronic
1023329039 7:39093796-39093818 GTGCCTAAGAAAGAAAATATAGG - Intronic
1023600069 7:41873922-41873944 ATGGCCAAGAAAATAAATCTTGG - Intergenic
1025276476 7:57585979-57586001 GAGGAAGAGAGAGTAAATATGGG + Intergenic
1025566737 7:62444549-62444571 ATGGACTAGAAAGTAATCATTGG - Intergenic
1026187907 7:68097718-68097740 GTGGGGAAGGAAATAAATATGGG - Intergenic
1027392748 7:77721900-77721922 GTGGAAAGGAAAGAAACTATAGG + Intronic
1027451446 7:78335959-78335981 TTCTAAAAGAAAGTAAATATAGG + Intronic
1027766727 7:82353339-82353361 GTGGTATAGAAAGTAAGTATAGG + Intronic
1028003800 7:85536255-85536277 GAGGACAGGAAGTTAAATATTGG - Intergenic
1028124752 7:87099997-87100019 GTGAACAAGAAAGCAGAGATTGG - Intergenic
1028359308 7:89948737-89948759 GTGAAGAAGAAATGAAATATTGG - Intergenic
1028693668 7:93682956-93682978 CTGGTCAAGAAAATAAATCTGGG - Intronic
1029836413 7:103316895-103316917 GTGGAAATGGAAGTAAAAATTGG - Exonic
1030437022 7:109535162-109535184 GTGGACAAATAAGGAAATACTGG - Intergenic
1032691341 7:134290314-134290336 GTTGGCAAGAAAGCAAATAAGGG - Exonic
1033808802 7:144985577-144985599 CTGGAGAAGAAAATCAATATTGG + Intergenic
1033944901 7:146704903-146704925 GTTGACAGGAAAGAAAATTTAGG - Intronic
1035852496 8:2934404-2934426 TTGGATAAGAAAGGGAATATTGG + Intergenic
1038835649 8:31119100-31119122 GGTGAGAAAAAAGTAAATATAGG - Intronic
1039835229 8:41250547-41250569 ATGGACAAGAAAGAAAAGACGGG + Intergenic
1040649973 8:49436470-49436492 GTGGACTAGTAAGTAGACATTGG + Intergenic
1041504384 8:58578711-58578733 GTAGACAAGAAAATAAATGGAGG - Intronic
1042051016 8:64707214-64707236 GAGGCCAAGAAAATGAATATTGG + Intronic
1042215097 8:66423242-66423264 GTGGACAACCATGTAAAAATGGG - Intergenic
1042507903 8:69580551-69580573 TTGGACAAGAAAGAAAACTTAGG - Intronic
1043586395 8:81774740-81774762 GTGGTTAAGAATGTAGATATTGG - Intergenic
1044276989 8:90312738-90312760 GTGGAGAAGAGAGAAATTATTGG + Intergenic
1046723624 8:117651187-117651209 GAGGAGAAAAAAGAAAATATGGG + Intergenic
1047067893 8:121306946-121306968 GGAGTCAAGAAACTAAATATTGG - Intergenic
1047769552 8:128019845-128019867 GTGGACAAAAAAGTAAACTTTGG + Intergenic
1048692008 8:136976892-136976914 GTGGATAAGTGAGTAAATAACGG - Intergenic
1050782478 9:9354960-9354982 GTGGACAAAAAAGAAAATAAAGG + Intronic
1052497186 9:29242124-29242146 GGGGAAAATAAAGTAAAAATTGG - Intergenic
1054895985 9:70311864-70311886 ATGCACAAGAAAGAAAAGATTGG - Intronic
1055232494 9:74083121-74083143 CTGGACAATAAAATAAAAATTGG - Intergenic
1055348019 9:75356985-75357007 TTGGAGAAGAAAGTAAAAAGAGG + Intergenic
1056398868 9:86207958-86207980 GTGAACAAGAAAAAAATTATAGG + Intergenic
1057434328 9:95025371-95025393 GTGGACAAGGAAGTAGCAATGGG - Intronic
1057610118 9:96535009-96535031 GTAGGTAAGTAAGTAAATATTGG - Intronic
1057715858 9:97495009-97495031 TGGGACAAGAAAGTACACATTGG - Intronic
1057812822 9:98270834-98270856 TTGGAGAAGAAAGTAAAAACAGG + Intergenic
1203627633 Un_KI270750v1:39454-39476 GAGGAAGAGAAAGTAAATATGGG + Intergenic
1186529732 X:10282859-10282881 GAGGACAAGAAAGCAAATCAGGG - Intergenic
1187170082 X:16842376-16842398 GTGGACAAAATAGTACATAGAGG + Exonic
1188430807 X:30104169-30104191 GTGGAGAAGAGAGTAAAAAGAGG - Intergenic
1188930544 X:36104803-36104825 GTAGAACAGAAAGTAAATGTTGG - Intronic
1189032036 X:37460683-37460705 GTGGAGAAGAGAGTAAAAAGAGG + Intronic
1189159665 X:38799150-38799172 GTGGTCAAGAAGAAAAATATAGG + Intergenic
1190052254 X:47158861-47158883 ATGTACATGAATGTAAATATTGG - Intronic
1190804161 X:53819177-53819199 CTGTACAAGAAAAGAAATATAGG + Intergenic
1193801476 X:85942110-85942132 GTGAATAAGAAAGTATATTTTGG - Intronic
1194293874 X:92105262-92105284 TTGGAGAAGAGAGTAAAAATAGG + Intronic
1194663069 X:96647572-96647594 GGGGAAAAGAAAGTAAAGAATGG + Intergenic
1195997625 X:110746872-110746894 GTGAACAAGAAAGTTGATATGGG - Intronic
1196634963 X:117991769-117991791 GTGGAGAAGAAAGGAAAATTAGG + Intronic
1196756271 X:119160154-119160176 GTGGCAAAGATAGTAAATCTGGG - Intergenic
1197235040 X:124052234-124052256 TTGTACAACAACGTAAATATAGG - Intronic
1197742165 X:129903578-129903600 GTGGAAAAGATAGAAATTATTGG + Intergenic
1199656752 X:150003875-150003897 GGGAATAAGAAAGGAAATATTGG + Intergenic