ID: 1081247863

View in Genome Browser
Species Human (GRCh38)
Location 11:40791676-40791698
Sequence ACTCATAGATCACGATGAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 78}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081247863_1081247870 -7 Left 1081247863 11:40791676-40791698 CCAATTCATCGTGATCTATGAGT 0: 1
1: 0
2: 0
3: 2
4: 78
Right 1081247870 11:40791692-40791714 TATGAGTGGGAGGGGGATTGTGG 0: 1
1: 0
2: 1
3: 30
4: 380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081247863 Original CRISPR ACTCATAGATCACGATGAAT TGG (reversed) Intronic
900723198 1:4193910-4193932 ACTCACAGTTCAGGATGACTGGG - Intergenic
910336292 1:86135609-86135631 TCTCATAAATCAAGATGAAATGG - Intronic
916974050 1:170055369-170055391 ACTCATTGTTCACTATGAAGTGG - Exonic
919089521 1:192961305-192961327 ACTCATAGTTCAGCATGACTGGG - Intergenic
920571542 1:207021855-207021877 ACTCAGGGCTCAAGATGAATGGG - Exonic
920768163 1:208853353-208853375 ACTCAAAAATCACAATAAATAGG + Intergenic
921318855 1:213917898-213917920 ACTCATAGTTCAGGATGGCTTGG - Intergenic
1069226624 10:65953296-65953318 ATTCATACATCAAGATGACTAGG + Intronic
1069676732 10:70254100-70254122 ACTCATAGACAACGAGGAAGGGG - Exonic
1081247863 11:40791676-40791698 ACTCATAGATCACGATGAATTGG - Intronic
1082850965 11:57764462-57764484 AAGCATAGATCACTATCAATTGG + Intronic
1082992507 11:59220181-59220203 GGTCAGAGATCAAGATGAATAGG + Intergenic
1087333066 11:96807667-96807689 AATTATAGATCACAATGAAGTGG - Intergenic
1089058812 11:115609179-115609201 ACTTATAGAGCACTATGAAAGGG + Intergenic
1091979117 12:4851260-4851282 ACACATAGATCACCAGGAAGAGG + Intronic
1095374257 12:41507383-41507405 GCTCACAGAACACAATGAATTGG - Intronic
1095810249 12:46366910-46366932 ACTCATATTTCACTATGAAGAGG + Exonic
1107080766 13:36372413-36372435 AGTCATAGATAACTGTGAATGGG - Intergenic
1112942958 13:104888569-104888591 ACTCATAGTTCAGCATGATTAGG - Intergenic
1113180093 13:107615157-107615179 ACTGAAAGAGGACGATGAATAGG - Intronic
1114767169 14:25386589-25386611 ACTTATAGAACACAATGAAAAGG - Intergenic
1120003537 14:79330901-79330923 ACTCAAAGATGAAGATGAAGGGG - Intronic
1125801718 15:42454460-42454482 ATTCCTAGATCATCATGAATTGG + Intronic
1131558081 15:93416326-93416348 ACTCGTACATCACAATGACTTGG + Intergenic
1135601217 16:23785250-23785272 ACTCAAACATCACTATGAGTGGG + Intergenic
1136063838 16:27745686-27745708 ACTCCTAGATTGAGATGAATAGG - Intronic
1136379453 16:29885700-29885722 AATCATAGATCACGGGGGATAGG + Exonic
1136570043 16:31091235-31091257 AATCATAGAGCACGAAGAACAGG + Exonic
1142069162 16:88080816-88080838 ACGCATAGTTCATCATGAATGGG - Intronic
1150448493 17:65246137-65246159 GCTCACATATCACCATGAATTGG + Intergenic
1157436369 18:47673096-47673118 GCACATGGATCACCATGAATTGG - Intergenic
1158376368 18:56873809-56873831 CATCTTAGATCAAGATGAATTGG - Intronic
1159717842 18:71848332-71848354 ACTCATAGTTCAGCATGGATGGG - Intergenic
1161302775 19:3551075-3551097 ACTGGAAGATCACGATGAACGGG + Exonic
1164281200 19:23770226-23770248 ACTCATAGTTCTCTATGGATTGG + Intronic
925688519 2:6496245-6496267 AGTCATAGGTGAGGATGAATGGG + Intergenic
926468414 2:13220889-13220911 ACTCAAAGATCAGAATGACTGGG - Intergenic
929474477 2:42232052-42232074 ACTCAAATATCTGGATGAATAGG + Intronic
932506927 2:72243132-72243154 ACTCAGAGTTCAGCATGAATGGG + Intronic
941464089 2:165804905-165804927 CCTCACAGACCACGATGAACTGG + Intergenic
943787124 2:191890011-191890033 ACTCATAGTTCAGCATGACTGGG + Intergenic
948357964 2:237395425-237395447 ACTCAGAGACCATCATGAATGGG + Intronic
1175970749 20:62685487-62685509 ACACATAGATCTCCTTGAATTGG + Intronic
1178402570 21:32299213-32299235 ACTCATAGATATAAATGAATGGG + Intronic
951430012 3:22596069-22596091 ACCCATAGCTCATGCTGAATTGG + Intergenic
955912347 3:63870137-63870159 ACTCATAGATATAAATGAATGGG + Intronic
958695390 3:97521400-97521422 ACTCATAGTTCAGCATGACTGGG + Intronic
973042821 4:45494357-45494379 ACTCATAGTTCAGGATGGCTGGG + Intergenic
980303934 4:131031795-131031817 ACTCAAAGTTCACGTTGGATTGG + Intergenic
985217462 4:187669474-187669496 GCTCATAGATCACAATGCAAGGG - Intergenic
986003710 5:3650122-3650144 ACTCATAGTTCACTATGTTTGGG - Intergenic
990751458 5:59021364-59021386 TCTCATAAATCACCATGACTGGG + Intronic
992777600 5:80102195-80102217 ACTCATAGAGCACTTTCAATAGG + Intergenic
995908819 5:117160535-117160557 ACTTATAAAAAACGATGAATAGG - Intergenic
999148025 5:149408529-149408551 GCACATAGAGCAGGATGAATGGG + Intergenic
1000679127 5:164161108-164161130 TCTCATATATCCAGATGAATTGG - Intergenic
1011493688 6:87917962-87917984 ACCCATAGATCATGATGATTTGG + Intergenic
1012032519 6:94090132-94090154 ACTCAGAGATAACAATGATTGGG + Intergenic
1012163401 6:95917058-95917080 ACCCATAGATCACAATCACTTGG - Intergenic
1013237869 6:108214642-108214664 ACTCCTTGATCATGATGACTGGG + Intronic
1014503023 6:122216222-122216244 TCTCATAATTCACGAGGAATTGG + Intergenic
1014973790 6:127852778-127852800 ACTCCTAGATAATGATGAAAGGG - Intronic
1017446045 6:154508842-154508864 ACACATAGACCACGTGGAATAGG - Intronic
1019886025 7:3906223-3906245 AATAATAGAACACGATGAAAAGG - Intronic
1030860480 7:114618647-114618669 GCTCATAGAACACTATGAACAGG + Intronic
1031293105 7:119964881-119964903 ACTCAGAAATAACAATGAATTGG - Intergenic
1032735935 7:134692553-134692575 ACTCATAGGTCCCGATGACTAGG + Intergenic
1040554674 8:48468309-48468331 ACTCACAGTTCAGCATGAATGGG + Intergenic
1041076318 8:54173318-54173340 ACTCATGGACCACAATGAACAGG + Intergenic
1041208988 8:55527837-55527859 ACTCATAGAGCAAAATAAATTGG - Exonic
1041564370 8:59260527-59260549 ACTAATATATTATGATGAATAGG - Intergenic
1041987646 8:63944951-63944973 ACTCATAATTCACAAGGAATTGG - Intergenic
1050232700 9:3544665-3544687 ATTCAGAGATCAAGATGAAATGG - Intergenic
1050760045 9:9057739-9057761 GCTCATAGATAACCAAGAATTGG - Intronic
1051058059 9:13011118-13011140 ACTTGTAGATTACGAGGAATGGG + Intergenic
1052638220 9:31129913-31129935 ACTGACAGCTCAAGATGAATAGG - Intergenic
1185596296 X:1308876-1308898 CCTCATAGTTGACGATGAACAGG - Intronic
1189936063 X:46069294-46069316 ACTCAGATATCAGTATGAATAGG - Intergenic
1191696305 X:63994317-63994339 ACTCATAGTTCAGCATGATTAGG + Intergenic
1191972536 X:66832826-66832848 ACTCATAGTTCAGGATGGCTGGG - Intergenic
1193641760 X:84017618-84017640 ACTCAAAGATCTCAATGAAAAGG + Intergenic