ID: 1081252436

View in Genome Browser
Species Human (GRCh38)
Location 11:40851431-40851453
Sequence GAGGGTAAGCAGAAGCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3016
Summary {0: 7, 1: 218, 2: 640, 3: 931, 4: 1220}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081252436_1081252446 23 Left 1081252436 11:40851431-40851453 CCACCCTGCTTCTGCTTACCCTC 0: 7
1: 218
2: 640
3: 931
4: 1220
Right 1081252446 11:40851477-40851499 CTGGTCCCAGTGAGATGAACTGG 0: 2
1: 7
2: 140
3: 392
4: 551
1081252436_1081252443 4 Left 1081252436 11:40851431-40851453 CCACCCTGCTTCTGCTTACCCTC 0: 7
1: 218
2: 640
3: 931
4: 1220
Right 1081252443 11:40851458-40851480 GGCTGCACCCACTGTCTAACTGG 0: 1
1: 23
2: 19
3: 16
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081252436 Original CRISPR GAGGGTAAGCAGAAGCAGGG TGG (reversed) Intronic
Too many off-targets to display for this crispr