ID: 1081252978

View in Genome Browser
Species Human (GRCh38)
Location 11:40858416-40858438
Sequence ATAGGCATGAACCATGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 854
Summary {0: 1, 1: 4, 2: 32, 3: 157, 4: 660}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081252978_1081252985 7 Left 1081252978 11:40858416-40858438 CCAGGCACATGGTTCATGCCTAT 0: 1
1: 4
2: 32
3: 157
4: 660
Right 1081252985 11:40858446-40858468 GCACTTTGGGAGGCTGAAGCAGG 0: 2688
1: 67947
2: 186014
3: 237634
4: 276237
1081252978_1081252979 -7 Left 1081252978 11:40858416-40858438 CCAGGCACATGGTTCATGCCTAT 0: 1
1: 4
2: 32
3: 157
4: 660
Right 1081252979 11:40858432-40858454 TGCCTATAATCCCAGCACTTTGG 0: 10529
1: 112818
2: 243046
3: 240273
4: 210047
1081252978_1081252987 26 Left 1081252978 11:40858416-40858438 CCAGGCACATGGTTCATGCCTAT 0: 1
1: 4
2: 32
3: 157
4: 660
Right 1081252987 11:40858465-40858487 CAGGCAGATAACTTGAGGTCAGG 0: 91
1: 5789
2: 23814
3: 55306
4: 101042
1081252978_1081252986 21 Left 1081252978 11:40858416-40858438 CCAGGCACATGGTTCATGCCTAT 0: 1
1: 4
2: 32
3: 157
4: 660
Right 1081252986 11:40858460-40858482 TGAAGCAGGCAGATAACTTGAGG 0: 5
1: 165
2: 3073
3: 12946
4: 35164
1081252978_1081252982 -3 Left 1081252978 11:40858416-40858438 CCAGGCACATGGTTCATGCCTAT 0: 1
1: 4
2: 32
3: 157
4: 660
Right 1081252982 11:40858436-40858458 TATAATCCCAGCACTTTGGGAGG 0: 26361
1: 319744
2: 258545
3: 142388
4: 133448
1081252978_1081252980 -6 Left 1081252978 11:40858416-40858438 CCAGGCACATGGTTCATGCCTAT 0: 1
1: 4
2: 32
3: 157
4: 660
Right 1081252980 11:40858433-40858455 GCCTATAATCCCAGCACTTTGGG 0: 20277
1: 245443
2: 271371
3: 174555
4: 143969

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081252978 Original CRISPR ATAGGCATGAACCATGTGCC TGG (reversed) Intronic
900162469 1:1230733-1230755 ATAGGCGTGAGCCATGCACCCGG + Intronic
900459331 1:2794135-2794157 ACAGGTATGCACCACGTGCCTGG + Intronic
900886208 1:5417319-5417341 ACAGGCATGAGCCACATGCCTGG - Intergenic
901298205 1:8177275-8177297 ACAGGCGTGAGCCATATGCCTGG - Intergenic
901910944 1:12457512-12457534 CTATGCATGAGCTATGTGCCAGG - Intronic
903555437 1:24189546-24189568 ATAGGCATGAGCCATGCACCCGG + Intergenic
903560876 1:24225967-24225989 ACAGGCATGAGCCACATGCCTGG + Intergenic
903604564 1:24566256-24566278 ACAGGTATGAGCCATGCGCCTGG + Intronic
903728911 1:25475066-25475088 ACAGGCGTGAGCCAAGTGCCCGG - Intronic
903980292 1:27181718-27181740 ACAGGCGTGAGCCATGTGCTTGG - Intergenic
904223215 1:28990693-28990715 ACAGGCATGACCACTGTGCCTGG + Intronic
904616278 1:31751904-31751926 TTAGGCATCTACCATGTGCCAGG + Intronic
904846625 1:33423820-33423842 ACAGGCATCAGTCATGTGCCCGG - Intronic
904874591 1:33644301-33644323 GTAGGCATGAACAAGGTGACTGG + Intronic
905194076 1:36260544-36260566 ACAGGCGTGAGCCAGGTGCCTGG - Intronic
905554506 1:38871687-38871709 ACAGGCATGAGCCACGTGCCTGG + Intronic
905716201 1:40152270-40152292 ACAGGCATGAGCCACGCGCCCGG - Intergenic
906094511 1:43212654-43212676 ACAGGCATGACCCACGTGCCAGG - Intronic
906453925 1:45977209-45977231 ACAGGCATGAGCCACGTGCCCGG - Intronic
906523969 1:46483848-46483870 AGGGGGATGTACCATGTGCCAGG - Intergenic
907121007 1:52007916-52007938 ATATGTATGAGCCACGTGCCTGG - Intergenic
907176505 1:52528216-52528238 ACAGGTGTGAGCCATGTGCCTGG - Intronic
907439132 1:54467983-54468005 ACAGGCATGAGCCTCGTGCCTGG - Intergenic
907525303 1:55050435-55050457 ATAGGCATCTACCATGTGCCCGG - Intronic
908015364 1:59827039-59827061 ACAGGCATGAGCCATGCGCCTGG + Intronic
908149987 1:61289970-61289992 ATAGACATGAACTAGGTGCCAGG + Intronic
908210321 1:61893976-61893998 ACAGGCATGAGCCACATGCCCGG - Intronic
908548539 1:65186403-65186425 ACAGGCACGAACCATCAGCCTGG + Intronic
908619348 1:65959985-65960007 ACGGGCATGAGCCACGTGCCTGG + Intronic
908758704 1:67492423-67492445 ATAGGATTTCACCATGTGCCAGG - Intergenic
909949779 1:81705522-81705544 ACAGGCGTGAGCCATGCGCCCGG + Intronic
910242590 1:85103608-85103630 AGAGGCATGAGCCATGCGCCCGG - Intronic
910582528 1:88844181-88844203 ACAGGCATGAGCCACGTGCCTGG + Intergenic
911220062 1:95236047-95236069 ACAGGCATGAGCCACGCGCCAGG - Intronic
911903714 1:103538119-103538141 ACAGGCATTAGCCACGTGCCTGG + Intronic
911941177 1:104049523-104049545 ACAGGCATGAGCCATGCACCTGG - Intergenic
912851295 1:113127506-113127528 ACAGGCATGAGCCACTTGCCTGG + Exonic
913027766 1:114863275-114863297 ACAGGCGTGAGCCCTGTGCCTGG - Intronic
914202756 1:145501229-145501251 GTAGGCATGAGCCATGGCCCTGG - Intergenic
914236686 1:145819157-145819179 GTAGGCATGAGCCATGGCCCTGG - Intronic
914481879 1:148074380-148074402 GTAGGCATGAGCCATGGCCCTGG - Intergenic
915434560 1:155894234-155894256 ACAGGCGTGAGCCCTGTGCCTGG + Intergenic
915652929 1:157332461-157332483 ATAGATATGAACCACATGCCTGG - Intergenic
915799209 1:158770804-158770826 ATGGGCATCAACCCTCTGCCTGG + Intergenic
916022947 1:160810019-160810041 ACAGGCATGCACCACATGCCTGG + Intronic
916077221 1:161208574-161208596 ACAGGCGTGAGCCACGTGCCCGG + Intronic
916688940 1:167172486-167172508 AACGGCTTGCACCATGTGCCTGG + Intergenic
917080715 1:171254364-171254386 ATAGGCATGAACCACCACCCCGG + Intronic
917103749 1:171471690-171471712 ACAGGCATGAGCCACATGCCAGG - Intergenic
917446797 1:175112897-175112919 ACAGGCATGAGCCCTATGCCCGG + Intronic
917876436 1:179291123-179291145 ACAGGCATGAGCCACGTGCCCGG - Intergenic
917882968 1:179357475-179357497 ATAGGCATGAGCCATGCTCCCGG + Exonic
918205655 1:182306758-182306780 ACAGGCGTGATCCACGTGCCCGG + Intergenic
919349328 1:196429118-196429140 ATAGGCATGAGCCCTGCACCTGG + Intronic
919495787 1:198266414-198266436 AAAGCCATGAACCATGCACCTGG - Intronic
919716702 1:200785664-200785686 ATAGGCGTGAGCCATGTGCCTGG + Intronic
920017213 1:202922289-202922311 ACAGGCTTGAGCCATGTGCCCGG - Intronic
920316436 1:205078771-205078793 ATGGGCATGAGCCACGTGCCCGG + Intergenic
920335593 1:205243105-205243127 ACAGGTGTGAGCCATGTGCCTGG - Intronic
920812438 1:209299477-209299499 GGGGGCATGTACCATGTGCCAGG - Intergenic
922431322 1:225557542-225557564 ACAGGCATGATCCACCTGCCTGG - Intronic
922654998 1:227374377-227374399 ACAGGCGTGAGCCATGCGCCTGG - Intergenic
922772016 1:228190538-228190560 AGAGGCATGTCCCATGTGCCTGG + Intergenic
923475941 1:234331097-234331119 ACAGGCATGAGCCATGTGCCTGG - Intergenic
924229062 1:241948096-241948118 ACAGGCATGAGCCATGTGCCTGG + Intergenic
924315840 1:242795457-242795479 ACAGGCATGAGCCATGTACTTGG + Intergenic
924333530 1:242964491-242964513 ACAGGCATCAGCCCTGTGCCTGG + Intergenic
924474775 1:244373355-244373377 ACAGGCATGTACCATATGCCTGG - Intronic
924762696 1:247003934-247003956 ACAGGCATGAGCCACATGCCCGG - Intronic
1063415648 10:5870660-5870682 ACAGGCGTGAGCCACGTGCCTGG + Intronic
1063782688 10:9344455-9344477 ATAGGCATCAACAATGCGCAGGG + Intergenic
1064464800 10:15568198-15568220 ATAGGCACGAGCCATGCTCCTGG + Intronic
1065028631 10:21563245-21563267 ATAGGCCTGAGCCACGCGCCGGG - Intronic
1065723801 10:28651014-28651036 TAGTGCATGAACCATGTGCCAGG - Intergenic
1065767745 10:29047405-29047427 ACAGGCATGAACCATGCATCTGG + Intergenic
1066118858 10:32264150-32264172 ACAGGCATGAGCCACTTGCCCGG + Intergenic
1066128416 10:32365534-32365556 ACATGCATGAACCACGTCCCCGG - Intronic
1067119647 10:43463259-43463281 ACAGGCATGAGCCATCCGCCTGG - Intronic
1068723521 10:60274247-60274269 ACAGGCATGAACACTGTGCTTGG + Intronic
1069452980 10:68532065-68532087 ACAGGTGTGAGCCATGTGCCCGG + Intergenic
1069533995 10:69239894-69239916 ATAGGCATAAGCCACATGCCTGG + Intronic
1069538813 10:69277754-69277776 ACAGGCGTGAGCCCTGTGCCTGG - Intronic
1069592012 10:69647995-69648017 ATAGGCAGGAAGAATGTGCCTGG - Intergenic
1069655663 10:70086137-70086159 ATAGGCATGAGCCCTGTGCCTGG + Intronic
1069692987 10:70366144-70366166 ACAGGCATGAGCCACGTTCCTGG - Intronic
1069712355 10:70497849-70497871 ATAGGCGGGAGCCATGTGCCTGG + Intronic
1070331470 10:75420579-75420601 ACAGGCTTGAGCCACGTGCCTGG - Intergenic
1070457340 10:76630452-76630474 ACAGGCATGAGCCACGCGCCTGG + Intergenic
1070910845 10:80116574-80116596 ACAGGCATGAGCCATGCGCCTGG + Intergenic
1071263014 10:83938173-83938195 AGAGGCATGAATCATGGGTCAGG - Intergenic
1071537990 10:86452313-86452335 ACAGGCATGAGCGCTGTGCCTGG - Intronic
1071879199 10:89876517-89876539 ACAGGAATGAGCCATGTGCCAGG - Intergenic
1071935863 10:90529700-90529722 GTAAGCATGCACCATGTTCCAGG + Intergenic
1072118811 10:92388275-92388297 ACAGGCGTGAGCCATATGCCTGG - Intergenic
1072133093 10:92515891-92515913 ATAGGCGTGAGCCATGCACCCGG - Intronic
1072369068 10:94745227-94745249 TTTGGCTTGTACCATGTGCCTGG + Intronic
1072967489 10:99986876-99986898 ATAGGTGTGAGCCACGTGCCCGG - Intronic
1073258103 10:102168292-102168314 AGGGGCATGAGCCATGTGTCTGG - Intergenic
1073370563 10:102984921-102984943 ATAGGCTTGACCACTGTGCCCGG + Intronic
1073774400 10:106769816-106769838 ACAGGCGTGAGCCCTGTGCCTGG - Intronic
1074245043 10:111681171-111681193 ATAGGCATGAGCCACGCACCCGG + Intergenic
1075225871 10:120628462-120628484 TTAGGCAGGCACCATGTGCCTGG - Intergenic
1075761093 10:124857404-124857426 ACAGGCGTGAGCCACGTGCCCGG + Intergenic
1075769262 10:124919266-124919288 ATAGGCATGAGCCACGGGCCCGG - Intergenic
1076002260 10:126921792-126921814 ATAGGCATGCACCACCTGCCTGG + Intronic
1076799819 10:132815642-132815664 ACAGGCATAAGCCACGTGCCGGG - Intronic
1077557874 11:3234722-3234744 TCAGGCATGCACCAAGTGCCAGG + Intergenic
1077728191 11:4698524-4698546 AGAGGCATGAACCAAATGCTTGG + Intergenic
1077738634 11:4819854-4819876 ACAGGCATGAACCCTGTGCCTGG + Intronic
1078335490 11:10459801-10459823 AGAGGCAGGAACCAGGTGCCTGG + Intronic
1079015511 11:16865445-16865467 ATAGGCATGAGCCACCCGCCTGG - Intronic
1079932411 11:26581410-26581432 ACAGGCGTGAACCAAGTGTCCGG - Intronic
1080123992 11:28710020-28710042 ATAGACATGCACTGTGTGCCAGG + Intergenic
1081252978 11:40858416-40858438 ATAGGCATGAACCATGTGCCTGG - Intronic
1081566021 11:44261824-44261846 ATAGCAATGAACCACGTGGCAGG + Exonic
1081838082 11:46174394-46174416 ACAGGCATGAGCCATGCACCCGG + Intergenic
1081955654 11:47090637-47090659 ATGAGCATTTACCATGTGCCAGG + Intronic
1082104158 11:48201847-48201869 ATAGGCAAAAACCTTGTGCAGGG - Intergenic
1083119827 11:60500593-60500615 TTAGGCATGAATTATGTGCTTGG - Intronic
1083437301 11:62651389-62651411 ACAGGCGTGAGCCACGTGCCCGG + Intronic
1083472068 11:62890699-62890721 ACAGGCGTGAGCCACGTGCCTGG + Intergenic
1083779995 11:64912867-64912889 ACAGGTGTGAACCCTGTGCCTGG + Intronic
1083814761 11:65126409-65126431 ATAGGCATGAGCCATGTGCCTGG + Exonic
1084183848 11:67460181-67460203 CCAGGCATGAGCCATGCGCCTGG - Exonic
1084376978 11:68784282-68784304 ACAGGCATGAACCATATGCCTGG - Intronic
1084907099 11:72356676-72356698 ACAGGCAGGAACCATGCCCCTGG + Intronic
1084922824 11:72485216-72485238 ACAGGCATGCACCACATGCCTGG - Intergenic
1085122463 11:73975918-73975940 ACAGGCATGCACACTGTGCCTGG - Intronic
1085167894 11:74419990-74420012 TTAAGCATCAACCATGTGCCAGG - Intergenic
1085551381 11:77376460-77376482 ACAGGCGTGAGCCATGTGCCTGG - Intronic
1085729202 11:78982201-78982223 GTTGGCAAGTACCATGTGCCAGG + Intronic
1086148538 11:83582230-83582252 ATAGGCATGAGCCACCTCCCCGG + Intronic
1086433378 11:86757816-86757838 ACAGGCATGAGCCACATGCCTGG - Intergenic
1087350997 11:97032044-97032066 ATAGGCAAGAAACTTGTGCAAGG + Intergenic
1087587002 11:100134479-100134501 TTAGGCATTAGCCATATGCCTGG - Intronic
1087640635 11:100751213-100751235 ATAGGTGTTAGCCATGTGCCTGG + Intronic
1088258170 11:107920519-107920541 ATAGGCGTGAGCCACCTGCCCGG + Intronic
1088269990 11:108024271-108024293 ACAGGCATGATCACTGTGCCTGG - Intronic
1088664275 11:112078824-112078846 ATAAGCATGAGCCACTTGCCTGG + Intronic
1088891551 11:114048720-114048742 ACAGGCGTGAGCCATGAGCCCGG + Intergenic
1089053532 11:115565962-115565984 ATAGGAGTGAGCCACGTGCCTGG + Intergenic
1089252672 11:117176347-117176369 ATAAGCATCCACGATGTGCCAGG - Intronic
1089594593 11:119569301-119569323 ACAGGCATGAGCCATATGCCTGG - Intergenic
1089746464 11:120620816-120620838 TTGGGCATGCACGATGTGCCGGG + Intronic
1090389318 11:126377750-126377772 ATAGGCGTGAGCCATGCGCTCGG + Intronic
1091464404 12:671119-671141 ACAGGCATGCACCATATGCCTGG - Intergenic
1091500627 12:1013996-1014018 ATAGGCATAAGCCATGTGCCTGG + Intronic
1091676638 12:2495721-2495743 AGAGGCATGTCCCATGAGCCTGG - Intronic
1092190131 12:6513262-6513284 ATAGGCGTGAGCCATGCACCCGG - Intronic
1092467620 12:8747412-8747434 TAAGGCATAAACCATGAGCCGGG - Intronic
1092695091 12:11162599-11162621 ATAGGCATGAAGTCTGTGGCAGG + Intronic
1092741778 12:11637363-11637385 ACAGGCGTGAGCCACGTGCCCGG + Intergenic
1093028553 12:14267072-14267094 ACAGGCGTGAGCCATGCGCCCGG + Intergenic
1093175110 12:15904754-15904776 AGAGGAAGGAACCATGAGCCAGG - Intergenic
1094014536 12:25848806-25848828 ATAGGCATGACCACTGTGCCTGG - Intergenic
1094205655 12:27837743-27837765 ATAGGCATGAGCCATCGCCCCGG + Intergenic
1094528264 12:31247766-31247788 ACAGGCATGGGCCACGTGCCTGG - Intergenic
1094545038 12:31396762-31396784 ACAGGCATGCACCACATGCCTGG + Intronic
1094552475 12:31465640-31465662 ACAGGCGTGAGCCATGCGCCTGG + Intronic
1094578887 12:31714602-31714624 ACAGGCATGAGCCTTGTGCTCGG + Intronic
1095797792 12:46239464-46239486 ACAGGCATGCACCACATGCCTGG + Intronic
1096219194 12:49817850-49817872 ATAGGCATGAGCACTGCGCCCGG - Intronic
1096402018 12:51315128-51315150 ATAGGCATGAGCCATTAGGCTGG + Intronic
1096410148 12:51371358-51371380 ACAGGCATGAGCCATGGGCCCGG + Intronic
1097020706 12:56018939-56018961 ACAGGCGTGAGCCACGTGCCTGG - Intronic
1097383733 12:58924484-58924506 ACAGGCATGAGCCACCTGCCTGG + Intergenic
1097647631 12:62255990-62256012 AAAGGCATGAGCCACGTGCCTGG - Intronic
1097679714 12:62637288-62637310 ACAGGCATGAGCCATATACCTGG + Intergenic
1097895143 12:64817784-64817806 ACAGGCATGAGCCATGTGCCAGG - Intronic
1097975849 12:65685110-65685132 ATAGGCATGACCACTGTGCCTGG - Intergenic
1098239581 12:68453217-68453239 TTGGGCACTAACCATGTGCCAGG + Intergenic
1099257438 12:80331480-80331502 ACAGGCATGCACCACATGCCCGG + Intronic
1099484901 12:83217034-83217056 ATGAGCATCAACTATGTGCCAGG - Intergenic
1100063134 12:90606193-90606215 ACAGGTGTGAGCCATGTGCCTGG - Intergenic
1100109139 12:91216398-91216420 ATAGGCACAACCCATGTTCCTGG - Intergenic
1100309594 12:93381978-93382000 ACAGGCATGAGCCACCTGCCTGG - Intronic
1100853237 12:98735697-98735719 ATTGAGATGTACCATGTGCCTGG + Intronic
1101190046 12:102323393-102323415 ACAGGCATGAGCCACATGCCCGG - Intergenic
1101978276 12:109381689-109381711 ATAGGCATGAACCAAGTAGCTGG - Intronic
1102284766 12:111646981-111647003 ATAGGCATGAGCCCTGCACCTGG - Intronic
1102417334 12:112775362-112775384 CTGTGCATGTACCATGTGCCAGG + Intronic
1102489501 12:113281314-113281336 ACAGGCGTGAGCCACGTGCCTGG + Intronic
1103178569 12:118887282-118887304 ATAGGCGTGAGCCACGCGCCTGG - Intergenic
1103204076 12:119114620-119114642 TTAGTCATTTACCATGTGCCAGG - Intronic
1103958748 12:124594310-124594332 ACAGGCACGAGCCATATGCCTGG + Intergenic
1103989983 12:124792453-124792475 ATAGGCATGAGCCCTGCGCTGGG - Intronic
1104947785 12:132424563-132424585 ACAGGCGTGGAACATGTGCCAGG - Intergenic
1105294283 13:19074539-19074561 ACAGGCACGAGCTATGTGCCAGG - Intergenic
1105455876 13:20541021-20541043 ACAGGCATGAACCAAGTGCCTGG - Intergenic
1105735924 13:23270148-23270170 ACAGGCGTGAGCCACGTGCCCGG + Intronic
1105830223 13:24157574-24157596 ACAGGCGTGAGCCACGTGCCCGG + Intronic
1106177296 13:27342240-27342262 GTAAGTATGAACCAAGTGCCAGG - Intergenic
1106328971 13:28721265-28721287 ACAGGCATGAGCCACATGCCTGG - Intergenic
1107126463 13:36851568-36851590 ATTGGCATGTCCCACGTGCCTGG + Intronic
1107690635 13:42949311-42949333 ACAGGCGTGAGCCACGTGCCTGG - Intronic
1107800082 13:44098252-44098274 ACAGGCATGCACCACATGCCTGG + Intergenic
1108212849 13:48155795-48155817 ACAGGCGTGAGCCAAGTGCCTGG + Intergenic
1108338104 13:49466930-49466952 ACAGGGATGAACCTTGTGCTTGG + Intronic
1108805089 13:54144986-54145008 AAAAGCATGAAGCATGTTCCTGG - Intergenic
1108890860 13:55257460-55257482 ATGGAAATGTACCATGTGCCAGG + Intergenic
1109991253 13:70060565-70060587 ACAGGCATGAGCCATGCACCTGG - Intronic
1110204705 13:72898704-72898726 ACAGGCATGAGCCACATGCCCGG - Intronic
1110575702 13:77052473-77052495 ATTGGCATGAGCCACATGCCTGG + Intronic
1111128049 13:83937245-83937267 ATTGATGTGAACCATGTGCCAGG - Intergenic
1111240833 13:85472717-85472739 ACAGGCATGAGCCACCTGCCCGG - Intergenic
1112283122 13:98080087-98080109 ATAGGCGTGAGCCATGCGCCTGG + Intergenic
1112423412 13:99274600-99274622 ACAGGCATGAGGCACGTGCCTGG + Intronic
1112500319 13:99938209-99938231 ATAGGCATGAGCCACGCGCCCGG + Intergenic
1113466560 13:110517573-110517595 CTGAGCATCAACCATGTGCCAGG + Intergenic
1114202388 14:20534292-20534314 ATAGGCATGAGCCACCTGTCTGG + Intergenic
1114305928 14:21422943-21422965 AGAGGCGTGAGCCACGTGCCTGG - Intronic
1114477062 14:23003510-23003532 ATAGGCGTAAGCCACGTGCCTGG - Intronic
1115236236 14:31210771-31210793 ATAGGAATGAGCCACATGCCCGG + Intergenic
1115237571 14:31222519-31222541 ACAGGCTTGAACCACGTGCTTGG - Intergenic
1115523528 14:34256757-34256779 ACAGGCATGAGCCACATGCCTGG - Intronic
1115560839 14:34581426-34581448 ACAGGCACGAGCCACGTGCCTGG + Intronic
1115992637 14:39165516-39165538 ATAGGCATGAGCACTGCGCCTGG - Intronic
1116454479 14:45103043-45103065 ATAAGCATCTATCATGTGCCAGG - Intronic
1116627152 14:47280030-47280052 ATAGGCGTGAGCCATGTGCCTGG - Intronic
1116860261 14:49989590-49989612 ACAGGCATGAGCCATGTGCCTGG + Intronic
1116900778 14:50360681-50360703 ATAGGCTTGAGCCATGAACCCGG + Intronic
1117378044 14:55133496-55133518 ATAGGGATGATTCATGTCCCAGG + Intronic
1117580027 14:57142902-57142924 ATAGGCATGAGCCCCCTGCCCGG - Intergenic
1118089960 14:62463197-62463219 AAAGGGATGAATCATGTCCCAGG + Intergenic
1118220009 14:63846871-63846893 ATAGGTGTGAACCATGTACCTGG + Intergenic
1118624110 14:67641661-67641683 ATGGGCATGAGCCACCTGCCTGG - Intronic
1118920364 14:70144351-70144373 ACAGGCATGAGCACTGTGCCTGG - Intronic
1119049842 14:71356452-71356474 ACAGGCATGAGCCACGTGCCTGG - Intronic
1119644605 14:76339394-76339416 ATGGGCACTGACCATGTGCCTGG - Intronic
1120896702 14:89539116-89539138 ACAGGCGTGAGCCACGTGCCTGG + Intronic
1121481653 14:94282435-94282457 ATAAGCATGAACTTTGTCCCAGG - Exonic
1121657235 14:95605944-95605966 ACAGGCATGAGCCACATGCCCGG - Intergenic
1121682327 14:95804045-95804067 ACAGGCATGAACCACTTGCCCGG - Intergenic
1121725482 14:96145355-96145377 AGAAGCATCCACCATGTGCCAGG - Intergenic
1121743512 14:96270000-96270022 ATAGGCATGAGCACTGTGCCCGG - Intergenic
1121857841 14:97286601-97286623 ATAGGCACCAATGATGTGCCAGG - Intergenic
1121884529 14:97531375-97531397 ACAGGCATGAGACATGCGCCCGG + Intergenic
1122123336 14:99566243-99566265 GTTGGCATTTACCATGTGCCAGG + Intronic
1122584891 14:102798749-102798771 ATAGGCATGACCACTGTACCCGG + Intronic
1124457019 15:29852760-29852782 ACAGGCATGCACCACATGCCTGG - Intronic
1125246515 15:37647238-37647260 AACAGCATGTACCATGTGCCTGG + Intergenic
1125667220 15:41440763-41440785 AGAGGCGTGAGCCCTGTGCCTGG + Intronic
1125694637 15:41624863-41624885 ATAGACATGAGCCACGTGCCTGG - Intronic
1125737085 15:41934284-41934306 ATGCCCCTGAACCATGTGCCAGG + Intronic
1126620284 15:50632024-50632046 ACAAGCATGAGCCATGGGCCTGG - Intronic
1127219736 15:56866461-56866483 ACAGGCATGCACCACTTGCCTGG - Intronic
1127432807 15:58927545-58927567 ACAGGCGTGAGCCATGCGCCTGG + Intronic
1127509799 15:59629203-59629225 ATAGGTGTGAGTCATGTGCCTGG + Intronic
1127988018 15:64090064-64090086 ATAGGCCTGAACCACGCGCCCGG - Intronic
1128681449 15:69655052-69655074 ACAGGCGTGAGCCATGTGCCTGG + Intergenic
1129019784 15:72506070-72506092 ATAGGCGTGAGCCACGCGCCTGG - Intronic
1129809306 15:78494847-78494869 ACAGGCTTGAGCCATGTGCCCGG + Intronic
1129988502 15:79940348-79940370 ACAGGCATGAGCCACGCGCCTGG + Intergenic
1130294497 15:82635129-82635151 ACAGGCATGAGCCACATGCCTGG + Intronic
1130509105 15:84573646-84573668 ACAGGCATGAGCCACCTGCCCGG + Intergenic
1130512226 15:84599575-84599597 ACAGGCATGAGCCACGTGCCCGG - Intergenic
1130698799 15:86158155-86158177 ATATGCATGGACGATGTTCCAGG + Intronic
1130887546 15:88106653-88106675 ACAGGCATGAGCCACATGCCTGG - Intronic
1130950069 15:88579186-88579208 ATAGGCATGAGCCCTGTGCCCGG + Intergenic
1130969812 15:88723134-88723156 ACAGGCATGAGCCACCTGCCTGG + Intergenic
1131288330 15:91081546-91081568 ATAGGCATGGCCACTGTGCCCGG + Intergenic
1131317675 15:91354437-91354459 ATAGGCATGAACCCTTATCCGGG - Intergenic
1131353739 15:91724839-91724861 ACAGGCATGTGCCATATGCCTGG + Intergenic
1131781034 15:95859571-95859593 ATTGGCATATACCATGTTCCAGG + Intergenic
1132111993 15:99108249-99108271 ACAGGTGTGAGCCATGTGCCCGG + Intronic
1133024967 16:2985008-2985030 ATAGGCATGAGCACTGTGCCTGG + Intergenic
1133053641 16:3133902-3133924 CTAAGCATCTACCATGTGCCAGG + Intronic
1133084432 16:3350685-3350707 ACAGGCTTGAGCCACGTGCCCGG + Intergenic
1133192034 16:4141124-4141146 ACAGGCGTGAGCCCTGTGCCTGG - Intergenic
1133281079 16:4665643-4665665 ACAGGCGTGAGCCACGTGCCCGG + Intronic
1133681401 16:8123659-8123681 ATAGGCATGAGCCACGGCCCCGG - Intergenic
1133910367 16:10060289-10060311 CTAGGCACGAACCACATGCCGGG + Intronic
1134032226 16:11001360-11001382 ACAGGTGTGAGCCATGTGCCTGG + Intronic
1134480310 16:14613343-14613365 ATAGGCATGAGCCAGGCGCCCGG - Intronic
1134834700 16:17351236-17351258 ACAGGCATGAGCCACATGCCTGG - Intronic
1135064632 16:19299046-19299068 ATAGGCATAAGCCAAGTGCCTGG + Intronic
1135411221 16:22236077-22236099 ACAGGCATGACCACTGTGCCTGG + Intronic
1135725830 16:24853334-24853356 TTAGGCATCAACTATGTACCAGG - Intronic
1135772491 16:25227987-25228009 ACAGGCGTGAACCACATGCCCGG - Intronic
1136423554 16:30153189-30153211 ACAGGCATGAGCCATGTGCCCGG + Intergenic
1136423575 16:30153324-30153346 ACAGGCATGAGCCACGTGCCCGG + Intergenic
1136489591 16:30598096-30598118 ATAGGCGTGCACCCTGTGCCCGG + Intergenic
1136595773 16:31248895-31248917 ACAGGTATTAACTATGTGCCAGG - Intergenic
1136613091 16:31379090-31379112 ATAGGCGTGAGCACTGTGCCTGG + Intronic
1137232486 16:46579656-46579678 ACAGGCATGAGCCACGTGCCTGG - Intergenic
1138341709 16:56293939-56293961 CTAAGCATGAAATATGTGCCAGG - Intronic
1139277720 16:65743430-65743452 GTAGGCATCTACCACGTGCCAGG + Intergenic
1139405491 16:66714458-66714480 ATAGGCATAAGCCACATGCCTGG + Intergenic
1139816107 16:69673964-69673986 ATAGGCATGAGCCACACGCCTGG - Intronic
1140095679 16:71873793-71873815 ACAGGCATGAGCACTGTGCCTGG + Intronic
1140198140 16:72872733-72872755 AGAGGCATGGGCCACGTGCCTGG + Intronic
1140719300 16:77756722-77756744 ACAGGCATGAGCCACGCGCCCGG - Intergenic
1141015803 16:80448234-80448256 ACAGGCTTGAGCCACGTGCCCGG - Intergenic
1141161582 16:81632754-81632776 CTAGGTTTGCACCATGTGCCTGG + Intronic
1141447194 16:84068646-84068668 ATAAGAAGAAACCATGTGCCTGG + Intronic
1142007780 16:87697948-87697970 ATACGCAGGACCCCTGTGCCCGG + Exonic
1142309411 16:89303589-89303611 AGAGACAGGAGCCATGTGCCTGG + Intronic
1142615748 17:1134001-1134023 ACAGGCATGAGCCACGCGCCCGG - Intronic
1142824593 17:2500838-2500860 ACAGGTGTGAGCCATGTGCCCGG - Intronic
1143071075 17:4294137-4294159 ATAGGCGTGAGCCACGCGCCTGG - Intronic
1143171257 17:4932032-4932054 ACAGGCATGAGCCACGCGCCCGG + Intergenic
1143239863 17:5434740-5434762 ATAGGCGTGAGCCATGCGACTGG + Intronic
1143548991 17:7617323-7617345 ACAGGCATGAGCCCTGTGCCTGG - Intronic
1143749653 17:9019466-9019488 ATATGCATGTACTATGTGCCTGG + Intergenic
1144253866 17:13446118-13446140 ACAGGCATGAGCCATGTGCATGG + Intergenic
1144280947 17:13726028-13726050 ACAGGCGTGAGCCACGTGCCCGG - Intergenic
1144324994 17:14170536-14170558 ATAGGTGTGAACCATGCACCTGG - Intronic
1144405582 17:14949867-14949889 ACAGGCGTGAGCCAGGTGCCCGG - Intergenic
1144680866 17:17193332-17193354 ACAGGCATGAACACAGTGCCAGG + Intronic
1145045040 17:19607210-19607232 ACAGGCGTGAGCCACGTGCCCGG - Intergenic
1146436403 17:32852401-32852423 ACAGGCATGACCACTGTGCCTGG + Intronic
1146807411 17:35875899-35875921 TTAAGCATCAACTATGTGCCAGG - Intronic
1146866760 17:36343195-36343217 ACAGGCGTGAACCACGTGCCTGG + Intronic
1147069628 17:37943804-37943826 ACAGGCGTGAACCACGTGCCTGG + Intergenic
1147081158 17:38023342-38023364 ACAGGCGTGAACCACGTGCCTGG + Intronic
1147097100 17:38147299-38147321 ACAGGCGTGAACCACGTGCCTGG + Intergenic
1147291096 17:39443850-39443872 ACAGGCATGAGCCACGTGCCTGG - Intronic
1147398010 17:40160214-40160236 ACAGGCATGAACACTGTACCTGG - Intronic
1147405232 17:40206737-40206759 ACAGGCGTGAGCCATGTGCCTGG + Intergenic
1147950088 17:44102633-44102655 ACAGGCATGAGCCATATGCCCGG + Intronic
1148038298 17:44685712-44685734 TTAAGCATTTACCATGTGCCAGG + Intronic
1148410558 17:47463002-47463024 ACAGGCGTGAACCACGCGCCTGG + Intergenic
1148925819 17:51084122-51084144 ATAGTCATGTTCCCTGTGCCTGG - Intronic
1149699785 17:58645632-58645654 ACAGGCATGAGCCACCTGCCCGG + Intronic
1149743915 17:59076262-59076284 ACAGGCATGAGCCATGGCCCCGG - Intronic
1149763672 17:59256040-59256062 ACAGGCATGAACCATGTACCCGG - Intronic
1149889779 17:60377181-60377203 ACAGACGTGAACCACGTGCCTGG - Intronic
1150064567 17:62098253-62098275 ACAGGCCTGAGCAATGTGCCTGG - Intergenic
1150381203 17:64721291-64721313 ACAGGCATGAACCCCGCGCCTGG + Intergenic
1150591043 17:66562871-66562893 ACAGGCATGAACACTGTGCCTGG + Intronic
1150592473 17:66575837-66575859 ACAGGCATGAGCCACGTGCCCGG - Intronic
1150929523 17:69569716-69569738 ACAGGCCTGAGCCACGTGCCCGG + Intergenic
1150973778 17:70060693-70060715 ATGAGCATGATCCAGGTGCCAGG + Intronic
1151214186 17:72566341-72566363 ATAAGCAGCAGCCATGTGCCAGG + Intergenic
1151787757 17:76283595-76283617 ACAGGCGTGAGCCACGTGCCTGG - Intronic
1151862118 17:76772142-76772164 ATAGGCGTGAGCACTGTGCCTGG - Intronic
1151883449 17:76909238-76909260 ACAGGCATGAGCCATGTGCCCGG + Intronic
1152391023 17:80003771-80003793 ACAGGCATGAGCCGCGTGCCCGG - Intronic
1152398054 17:80047121-80047143 ACAGGCATGAGCCACGTGCCCGG + Intronic
1152765477 17:82135376-82135398 ACAGGTGTGAGCCATGTGCCTGG + Intronic
1153069803 18:1092132-1092154 ACAGGCATGAGCCACGCGCCCGG + Intergenic
1154197331 18:12276268-12276290 ACAGGCATGAACCACATTCCAGG + Intronic
1154393664 18:13967276-13967298 ACAGGCATGAGCCACGTGCCTGG - Intergenic
1155189804 18:23419566-23419588 ACAGGCATGAGCACTGTGCCTGG + Intronic
1155222584 18:23698756-23698778 ATTGGCATCTACTATGTGCCAGG + Intronic
1155514175 18:26607305-26607327 ACAGGCATGAGCCACGTGCCTGG + Intronic
1155558941 18:27053807-27053829 ATAGGCAGGAGCCGTGTGACAGG - Intronic
1156248076 18:35322458-35322480 ATAGGCAAGAAAAATGTGTCAGG + Intergenic
1156272364 18:35547756-35547778 ATAAGCATGAGCCACATGCCTGG - Intergenic
1156401445 18:36743801-36743823 ACAGCCATGAGCCATGTCCCAGG - Intronic
1156571480 18:38258441-38258463 ATAGACATGCAACATGTCCCAGG - Intergenic
1157262431 18:46187616-46187638 ATAGGCGTGAGCACTGTGCCCGG + Intronic
1157859692 18:51129646-51129668 ATAGGCGTGAGCCACTTGCCGGG - Intergenic
1158660654 18:59384634-59384656 ATAGACGTGAGCCATGTGCCAGG - Intergenic
1158714372 18:59864630-59864652 ACAGGCATAAACCCCGTGCCTGG - Intergenic
1159024622 18:63171697-63171719 ACAGGCATGAGCTATGTGCCTGG - Intronic
1159047410 18:63382579-63382601 ACAGGCGTGAGCCACGTGCCTGG + Intergenic
1160746249 19:712298-712320 AAAGGCGTGAGCCACGTGCCTGG + Intronic
1160834577 19:1118590-1118612 ACAGGCGTGAGCCACGTGCCCGG - Intronic
1161261915 19:3342544-3342566 TTGTGCATGTACCATGTGCCAGG - Intergenic
1161289991 19:3488648-3488670 ATAGATATGAGCCACGTGCCTGG - Intergenic
1161359474 19:3839254-3839276 ACAGGTGTGAGCCATGTGCCCGG - Intronic
1161443073 19:4303549-4303571 ATAGGCATGCACCATCACCCTGG - Intergenic
1161460302 19:4392668-4392690 ACAGGCCTGAGCCACGTGCCCGG - Intronic
1161541840 19:4856573-4856595 ATAAGCATCTACCCTGTGCCAGG + Intronic
1162141417 19:8587653-8587675 ATAGGCGTGACCACTGTGCCCGG - Intronic
1162295970 19:9813778-9813800 ACAGGCATGAGCCACGCGCCTGG + Intronic
1162803632 19:13124801-13124823 AGAGGCATGAGCAATGTGCCTGG - Intronic
1162851274 19:13433015-13433037 ACAGGCATGAGCCAGATGCCTGG - Intronic
1163071128 19:14842525-14842547 ACAGGCATGAGCCATGTACCTGG + Intergenic
1163086627 19:14985685-14985707 ATAGGCGTGAGCCAAGTGCCCGG - Intronic
1163171426 19:15534182-15534204 ATGAGCATCTACCATGTGCCAGG + Intronic
1163297761 19:16423287-16423309 ACAGGCATGAGCACTGTGCCTGG - Intronic
1163506704 19:17711650-17711672 ACAGGCGTGAGCCATGCGCCCGG - Intergenic
1163516201 19:17765373-17765395 CTTTGCATGAACCTTGTGCCCGG + Intronic
1163525065 19:17815903-17815925 ACAGGCATGAGCCACGTGCCTGG - Intergenic
1163671912 19:18634416-18634438 ACAGGCATGTACCACATGCCTGG - Intergenic
1163687757 19:18721769-18721791 ATAGGCGTGAGCCATGCACCTGG + Intronic
1164580985 19:29434876-29434898 GCAGGCATGAACACTGTGCCTGG - Intergenic
1164657174 19:29930982-29931004 ACAGGCATGAGCCATCTGCCTGG + Intronic
1164832409 19:31332827-31332849 ACAGGTGTGAGCCATGTGCCTGG - Intronic
1165015931 19:32879967-32879989 ATTGGCCTGGCCCATGTGCCGGG + Intronic
1165195817 19:34102346-34102368 ATAGGCATGCAGCACATGCCTGG - Intergenic
1165232729 19:34397085-34397107 ATAGGCATGAGCCACCTTCCTGG + Intronic
1165379712 19:35470023-35470045 ACAGGCATGAGCCATGTGCCTGG - Intergenic
1165567510 19:36743902-36743924 ACAGGCAGGATCCACGTGCCCGG - Exonic
1165933457 19:39375148-39375170 AGAGGCATGAACCAAGTGGTGGG + Intronic
1165997674 19:39856110-39856132 ACAGGCGTGAGCCACGTGCCTGG - Intergenic
1166015368 19:39975380-39975402 ACAGGCGTGAGCCATGTGCCTGG + Intronic
1167123047 19:47530460-47530482 ACAGGCGTGAGCCATGCGCCTGG + Intronic
1167256392 19:48432329-48432351 ACAGGCATGAGCCATGCGCATGG + Intronic
1167529114 19:50003922-50003944 ATAGGCGTGAGCACTGTGCCCGG - Intronic
1167876660 19:52419640-52419662 ACAGGCATGAGCCATGTACCTGG + Intergenic
1168483689 19:56742693-56742715 ACAGGCATGAGCCTCGTGCCTGG + Intergenic
1168533333 19:57147869-57147891 ATAGGCATAAGTCATGTGCCTGG - Intergenic
1168696502 19:58406847-58406869 ACAGGCATGTACCATGAGCTTGG + Intronic
925035770 2:684467-684489 TTAGGCATGTGCCATGTGCCTGG - Intergenic
925203266 2:1986087-1986109 ACAGGCATCTACCATGGGCCAGG - Intronic
925509278 2:4606884-4606906 ATAGACATCAAACATTTGCCTGG + Intergenic
925946744 2:8871272-8871294 ACAGGTATGAGCCACGTGCCCGG + Intronic
926043342 2:9692069-9692091 ACAGGCATGAGCACTGTGCCTGG + Intergenic
926667885 2:15544733-15544755 ACAGGCATGAGCCCTGAGCCTGG - Intronic
926730034 2:16029728-16029750 ATAGGCATGAGGCACATGCCTGG + Intergenic
927486604 2:23492296-23492318 AGAGGCATGAACAGTGTGCAAGG - Intronic
927539356 2:23893938-23893960 ACAGGCATGAGCCACATGCCTGG + Intronic
927763010 2:25777361-25777383 ATAGGTGTGAGCCATGTGCCAGG - Intronic
927820988 2:26264731-26264753 ACAGGCATGAGCCACGTGCCTGG - Intronic
927889230 2:26738171-26738193 ATAGATATGAAGCATGTGCGAGG + Intergenic
928092512 2:28383858-28383880 ACAAGCATGAGCCACGTGCCTGG - Intergenic
928744051 2:34390382-34390404 ACAGGCATGCACCACATGCCCGG - Intergenic
928953462 2:36836387-36836409 ACAGGCATGAGCCATGCACCTGG + Intergenic
929538291 2:42799022-42799044 ATAGGCATGAGCCACGTGCCCGG + Intergenic
929677704 2:43953891-43953913 ACAGGCATGAACCACCGGCCTGG - Intronic
929883356 2:45856505-45856527 ACAGGCGTGAGCCATGTGCCTGG + Intronic
930130765 2:47847846-47847868 ACAGGCATGAGCACTGTGCCTGG - Intronic
930394979 2:50810703-50810725 ACAGGCATGAGCCACCTGCCTGG - Intronic
930635743 2:53803850-53803872 ATAGGCGTGGGCCATGTGCCTGG - Intronic
931657122 2:64519556-64519578 ATCGCCATCAACCATGTACCAGG + Intergenic
931664916 2:64603392-64603414 ATAAGCACGTACTATGTGCCAGG + Intergenic
931678827 2:64725721-64725743 ACAGGCGTGAACCATGCGCCTGG - Intronic
931798070 2:65731073-65731095 TTAAGCATTAACCATGTGCAAGG - Intergenic
932002834 2:67900262-67900284 ATAGGCATGAGCGACGTACCTGG - Intergenic
932322759 2:70834196-70834218 ATGGGCACCTACCATGTGCCAGG + Intronic
932694075 2:73939474-73939496 ATGAGCATGTACTATGTGCCAGG + Intronic
932947240 2:76249665-76249687 ATAGGCATGAGGCCCGTGCCTGG - Intergenic
933150983 2:78915041-78915063 ATGAGCATTAACTATGTGCCAGG - Intergenic
933459811 2:82567796-82567818 ATAGACATGAACTCTGGGCCAGG - Intergenic
934069434 2:88370311-88370333 ACAGGCATGAGCCATATGTCTGG + Intergenic
934769231 2:96897275-96897297 CTAGACATGTACCATGTGCCAGG - Intronic
935359064 2:102232387-102232409 ACAGGCATGAGCCACATGCCTGG + Intronic
935974420 2:108563780-108563802 ACAGGCATGAGCTATGCGCCTGG - Intronic
936035713 2:109109303-109109325 AAAGGCCCGAATCATGTGCCTGG - Intergenic
936043776 2:109170724-109170746 TTGGGCATTGACCATGTGCCAGG + Intronic
936593615 2:113826956-113826978 ATAGGTATATACTATGTGCCAGG + Intergenic
937157502 2:119731434-119731456 ACAGGCATGAGCCACGCGCCTGG - Intergenic
937217447 2:120321653-120321675 ATAGGCATGAGCCACATGCCCGG + Intergenic
937758865 2:125575363-125575385 ATAGGCGTGAGCACTGTGCCTGG - Intergenic
937821125 2:126312297-126312319 CTAGGCATGGCCCATGTCCCTGG + Intergenic
938035272 2:128029566-128029588 ACAGGCATGAGCCACGTGCCTGG - Intergenic
938717495 2:134034301-134034323 ACAGGCATGAGTCATGTGCCTGG + Intergenic
939154194 2:138504574-138504596 ATGAGCATCTACCATGTGCCAGG + Intronic
939258047 2:139770674-139770696 AGAGGCATGAACTCTGTGTCTGG + Intergenic
940510059 2:154602369-154602391 ACAGGCGTGAGCCATGCGCCTGG + Intergenic
940841985 2:158594388-158594410 ATAGGCATGTACCATTTTCAGGG + Intronic
941385425 2:164844846-164844868 ACAGGCATGTGCCACGTGCCCGG + Intergenic
941598740 2:167511903-167511925 TTGGGCATCCACCATGTGCCAGG + Intergenic
942873278 2:180762202-180762224 ACAAGCATGAGCCATGTGCCAGG - Intergenic
943338298 2:186645689-186645711 ACAGGCGTGAACCACGCGCCCGG - Intronic
943389231 2:187242662-187242684 ATAGGAATAGACCATTTGCCAGG + Intergenic
943651599 2:190463541-190463563 ATAGGCATGAGCCATCCACCTGG - Intronic
943755038 2:191548779-191548801 ACAGGCATGAGCCCTGTGTCTGG - Intergenic
943760466 2:191602270-191602292 ACAGGCATGAGCCACTTGCCCGG + Intergenic
943966370 2:194339004-194339026 ATATGTATGTATCATGTGCCAGG - Intergenic
944173415 2:196803117-196803139 ACAGGCGTGAGCCACGTGCCAGG - Intergenic
944184343 2:196930418-196930440 ACAGGCGTGAGCCCTGTGCCTGG - Intergenic
944207287 2:197169911-197169933 ACAGGCATGAACCACGTACCTGG - Intronic
944454633 2:199880258-199880280 ACAGGCATAAGCCATGGGCCCGG + Intergenic
945282811 2:208052058-208052080 ACAGGCATGAGCCACATGCCCGG - Intergenic
945720978 2:213418147-213418169 ACAGGCATGAGCCATGTGCCCGG + Intronic
946152035 2:217782026-217782048 ACAGGCATGAGCACTGTGCCTGG - Intergenic
946738042 2:222774103-222774125 AAGACCATGAACCATGTGCCAGG - Intergenic
947716349 2:232340826-232340848 ATAGGCATGAGCAGTGTGACTGG - Intronic
948919966 2:241060664-241060686 ATAGGCATGAGCCATGTGCCCGG - Intronic
949008462 2:241664685-241664707 ACAGACATGAGCCATGTGCCTGG - Intronic
1169161923 20:3387763-3387785 ACAGGCATGAACCACCTGCCTGG - Intronic
1169595642 20:7195207-7195229 ACAGTCATGAGCCATGTGCCTGG + Intergenic
1169680550 20:8207855-8207877 ACAGGCATGAGCCACCTGCCTGG + Intronic
1170054804 20:12189890-12189912 ACAGGCTTGAGCCAGGTGCCTGG + Intergenic
1170219770 20:13929774-13929796 ATAGGAGTGAGCCACGTGCCCGG + Intronic
1171488752 20:25501903-25501925 ACAGGCATGAGCACTGTGCCGGG + Intronic
1172020481 20:31910309-31910331 CTGAGCATGTACCATGTGCCAGG + Intronic
1172085268 20:32376957-32376979 ACAGGCATGAGCCACGTGCCTGG - Intronic
1172085292 20:32377260-32377282 ACAGGCGTGAGCCACGTGCCTGG + Intronic
1172141925 20:32728840-32728862 ATAGGCATAAGCCATGCACCTGG + Intronic
1172421055 20:34818211-34818233 ATAGGCACAAGCCATATGCCTGG - Intronic
1172737946 20:37142437-37142459 ATAGACATGAGCCACATGCCAGG - Intronic
1172868326 20:38117918-38117940 AAAGGCACCAATCATGTGCCTGG - Intronic
1173469804 20:43314303-43314325 ACAGGCATGAGCCACATGCCCGG + Intergenic
1173572374 20:44085769-44085791 ACAGGTATGAGCCACGTGCCTGG + Intergenic
1173728912 20:45315462-45315484 ACAGGCATGAGCCATTGGCCCGG - Intronic
1173974019 20:47173697-47173719 AGAGGCATGCACCACCTGCCTGG + Intronic
1174085831 20:48006610-48006632 ATAGGCATGAGTCACGTGCCTGG + Intergenic
1174260597 20:49292032-49292054 ACAGGCATGACCCACGTGCCTGG + Intergenic
1174491439 20:50899485-50899507 ATAGGCATGAGCCCAGCGCCCGG + Intronic
1175379732 20:58554531-58554553 CTAAGCATGCACCATGTGCCTGG + Intergenic
1177021406 21:15863758-15863780 ACAGGCGTGAGCCACGTGCCTGG - Intronic
1177156298 21:17504596-17504618 ACAGGCATGAATACTGTGCCTGG + Intergenic
1178091266 21:29165836-29165858 ACAGGCATGAGCCATGCGCCTGG + Intronic
1178603685 21:34016657-34016679 ACAGGGATGAGCCACGTGCCTGG + Intergenic
1179143580 21:38748607-38748629 ACAGGCGTGAGCCACGTGCCCGG + Intergenic
1179230740 21:39501894-39501916 ATAGGCGTGAGCCATGCGCCCGG - Intronic
1179663731 21:42895079-42895101 ACAGGCATGAGCCACCTGCCAGG - Intronic
1179722376 21:43323020-43323042 ATGAGCATGTACTATGTGCCAGG - Intergenic
1180757790 22:18174870-18174892 ATAGGCATGAACACTGCGCCTGG + Intronic
1180768074 22:18358659-18358681 ATAGGCATGAGCACTGCGCCTGG + Intergenic
1180778232 22:18503727-18503749 ATAGGCATGAGCACTGCGCCTGG - Intergenic
1180810956 22:18761038-18761060 ATAGGCATGAGCACTGCGCCTGG - Intergenic
1181197106 22:21195291-21195313 ATAGGCATGAGCACTGCGCCTGG - Intergenic
1181615071 22:24048694-24048716 ATAGGCGTGAGCCCTGTGCCTGG + Intronic
1182139626 22:27942480-27942502 ATAGGCATGCACCACCCGCCTGG + Intergenic
1182323155 22:29491439-29491461 CTGGGCACAAACCATGTGCCAGG + Intergenic
1182389128 22:29975880-29975902 ACAGGCATGAGCCGTGTACCTGG + Intronic
1182412584 22:30199831-30199853 ACAGGCATAAGCCACGTGCCCGG - Intergenic
1182592560 22:31393288-31393310 ACAGGCATGAGCCCCGTGCCTGG - Intergenic
1182626208 22:31648399-31648421 ACAGGCGTGAGCCATGTGCCTGG - Intronic
1183148435 22:36017251-36017273 ACAGGCATGAGCCACGTGCCCGG - Intronic
1183201691 22:36389251-36389273 ACAGGCATGAGCCACGCGCCCGG - Intergenic
1183441590 22:37825853-37825875 ACAGGCATGAGCCAAGCGCCTGG - Intergenic
1183461129 22:37951328-37951350 ACAGGCATGAGCCACGTGCCCGG + Intronic
1183699350 22:39441766-39441788 ACAGGCGTGAGCCATGCGCCTGG - Intergenic
1183911444 22:41082479-41082501 ACAGGCATGACCACTGTGCCTGG - Intergenic
1184043000 22:41955453-41955475 ATAGGCATGAGCCATTGGCCTGG + Intergenic
1184574578 22:45352514-45352536 ATTGGCATAAACCGTTTGCCTGG + Exonic
1185125697 22:49009557-49009579 ATTGGCATGAACCGTGTGCCAGG + Intergenic
1203229693 22_KI270731v1_random:99544-99566 ATAGGCATGAGCACTGCGCCTGG + Intergenic
949590705 3:5491365-5491387 TTAGGCATTTACTATGTGCCCGG - Intergenic
949912196 3:8921373-8921395 ACAGGCATGAACATTGTGCCTGG - Intronic
950363894 3:12469448-12469470 ACAGGCATGAGCCACCTGCCTGG + Intergenic
950955463 3:17048163-17048185 ATGTGCATGAACCAAGTGACAGG - Intronic
951209341 3:19957388-19957410 ACAGGCATGAGCCATGCACCCGG - Intronic
951844614 3:27072224-27072246 ATATTTATAAACCATGTGCCTGG - Intergenic
952353758 3:32565882-32565904 ATAGGCAGGAGCCATGGGGCCGG + Intronic
952397868 3:32937170-32937192 ACAGTAATGAGCCATGTGCCTGG - Intergenic
952464282 3:33564864-33564886 ACAGACGTGAGCCATGTGCCTGG + Intronic
952530647 3:34258736-34258758 AGAGGCCTGAGCCAAGTGCCTGG - Intergenic
953119076 3:40022178-40022200 ATTGGCCTGAATCATGTGGCTGG - Intronic
953170385 3:40501641-40501663 ACAGGCATGAAACACCTGCCCGG + Intergenic
953617859 3:44508135-44508157 ACAGGCATGTACCACATGCCTGG - Intronic
953706393 3:45234326-45234348 AAAGACATGAACTATATGCCTGG + Intergenic
953756584 3:45651772-45651794 ACAGGCATGCACCACATGCCTGG + Intronic
954093286 3:48301810-48301832 CTGGGCATCAACCATGTTCCAGG - Intergenic
954441143 3:50522763-50522785 ACAGTCATGAACAATGTCCCGGG + Intergenic
954441407 3:50524287-50524309 AGAGTCATGAACAATGTCCCGGG + Intergenic
954551831 3:51488399-51488421 ACAGGCGTGAGCCATGTGCCTGG - Intronic
954819528 3:53313645-53313667 ATAGGCATGAGCACTGTGCCTGG - Intronic
955165326 3:56505473-56505495 ACAGGCATGCACCACATGCCTGG + Intergenic
955213248 3:56961764-56961786 ACAGGCATGAGTCTTGTGCCTGG - Intronic
955229235 3:57084382-57084404 ACAGGCATGAGCCATGTGCCCGG - Intergenic
955665241 3:61343283-61343305 ACAGACAGGAACCATGTGCAGGG + Intergenic
955801938 3:62695829-62695851 ATAGGCATGAGCCACCAGCCTGG + Intronic
955820799 3:62893656-62893678 ACAGGCATGAGCCACATGCCTGG - Intergenic
956507787 3:69961106-69961128 ACAGGCGTGAGCCACGTGCCCGG - Intronic
956865451 3:73364464-73364486 ACAGGCGTGAGCCATGCGCCCGG + Intergenic
957415031 3:79890607-79890629 ACAGGCGTGAGCCACGTGCCTGG + Intergenic
957978244 3:87474548-87474570 AAAAGCTTGCACCATGTGCCTGG + Intergenic
958943079 3:100335725-100335747 ACAGGCGTGAGCCACGTGCCGGG - Intronic
959176104 3:102912842-102912864 ACAGGCGTGAGCCCTGTGCCCGG - Intergenic
959772955 3:110121987-110122009 ATAGGCATGAGCCACTGGCCTGG - Intergenic
960046419 3:113203200-113203222 TTGGGCATCCACCATGTGCCAGG + Intergenic
960057741 3:113287202-113287224 CTCGTGATGAACCATGTGCCTGG - Exonic
960671814 3:120161705-120161727 CTGGGCATTGACCATGTGCCAGG + Intergenic
961156881 3:124687089-124687111 ATAGGCATGAGCCATGGCACTGG + Intronic
961273339 3:125706799-125706821 ATAAGGATGCAGCATGTGCCAGG - Intergenic
961547072 3:127642013-127642035 ACAGGCGTGAGCCACGTGCCCGG - Intronic
961595909 3:128016288-128016310 ACAGGTATGAGCCATGTGCCTGG - Intergenic
961991355 3:131195476-131195498 ATAGGCATGAACTAGGTACATGG - Intronic
962679148 3:137780803-137780825 ATAGGCATTTACTATATGCCAGG - Intergenic
962926723 3:140000390-140000412 ATGGGCACAAACTATGTGCCAGG - Intronic
963488929 3:145974234-145974256 ATGAGCATCAACCATGTGTCAGG + Intergenic
964187679 3:153966165-153966187 ATAGGCATGAGCCACATGCTTGG + Intergenic
964446580 3:156765446-156765468 ACAGGCGTGAGCCACGTGCCTGG + Intergenic
965578410 3:170242298-170242320 ACAGGCATGAGCCCTATGCCTGG - Intronic
966236718 3:177709434-177709456 TTGAGCATCAACCATGTGCCAGG - Intergenic
967426687 3:189335301-189335323 ACAGGCATGAGCCATGGGCCTGG + Intergenic
967661777 3:192120126-192120148 ATTGGCATGTACTATGGGCCAGG + Intergenic
967960452 3:194917757-194917779 ACAGGCCTGAGCCATGCGCCCGG - Intergenic
968196453 3:196711587-196711609 ATAGGCGTGAGCCACCTGCCCGG + Intronic
968267174 3:197371125-197371147 ACAGGCATGAGCCACGTGCCCGG - Intergenic
968969429 4:3785879-3785901 ACAGGCATGAGCCATGCACCTGG + Intergenic
969063092 4:4454886-4454908 CTAAGCATTTACCATGTGCCAGG - Intronic
969357572 4:6639442-6639464 ACAGGCATGAGCCGTGCGCCTGG - Intergenic
969647881 4:8443623-8443645 TTAGGCACTTACCATGTGCCAGG - Intronic
970543195 4:17100092-17100114 ACAGGCATGAGCCACATGCCTGG - Intergenic
971409450 4:26354724-26354746 ACAGGCATGAGCCACATGCCTGG + Intronic
972486434 4:39545479-39545501 ACAGGCGTGAGCCAAGTGCCTGG - Intergenic
972772344 4:42209123-42209145 AAAGGCGTGAGCCACGTGCCCGG + Intergenic
973937556 4:55863359-55863381 ACAGGCATGAGCCCTGTTCCTGG - Intronic
974310948 4:60209428-60209450 ATTGGCTTGCACCATGTGCCTGG - Intergenic
974862287 4:67537377-67537399 ACAGGCATGAGCACTGTGCCTGG - Intronic
975620639 4:76292834-76292856 AAAGCCAGGAACAATGTGCCTGG - Intronic
975795124 4:77998699-77998721 ATAGGCATGAGCCACCGGCCCGG + Intergenic
975839263 4:78456417-78456439 ACAGGCATGAGCCATGTACCAGG + Intronic
976180818 4:82397072-82397094 ACAGGCATGAACACTGCGCCCGG - Intergenic
976206003 4:82624103-82624125 ATAGGCATGGCCACTGTGCCTGG + Intergenic
976361714 4:84186911-84186933 ATACGCATGAGCCACATGCCTGG - Intergenic
976606425 4:86987675-86987697 ACAGGCATGACCACTGTGCCTGG - Intronic
976630714 4:87233309-87233331 ATAGGCATGAGCCACGCACCCGG - Intronic
978069742 4:104452857-104452879 ACAGGCATGAACCATGCTCCCGG - Intergenic
978127989 4:105157951-105157973 ACAGGCATGAGCCATCGGCCTGG + Intronic
978329719 4:107599306-107599328 AAAGGGATGATCCATGTCCCAGG + Intronic
978447624 4:108795354-108795376 ACAGGCATGAGCCACATGCCTGG - Intergenic
979066903 4:116149219-116149241 ACAGGCATGCACCCTATGCCTGG + Intergenic
979319982 4:119311914-119311936 ATATGCAGGCACTATGTGCCAGG - Intergenic
979502472 4:121456086-121456108 ATAGGCATGCACCACCAGCCTGG + Intergenic
980101688 4:128547671-128547693 ACAGGCATGAGCCATATGCTTGG - Intergenic
980228836 4:130021733-130021755 ACAGGCATGAGCCACCTGCCTGG + Intergenic
980308921 4:131101321-131101343 AATGGCTTGCACCATGTGCCTGG + Intergenic
980426208 4:132630708-132630730 AATGGCTTGCACCATGTGCCAGG + Intergenic
981621140 4:146700070-146700092 ATAGGCAACAAACATGGGCCAGG - Intergenic
981938864 4:150260770-150260792 ACAGGCGTGAGCCACGTGCCTGG - Intergenic
982327505 4:154143983-154144005 ATAGGGAGGAAGCATGTGCCTGG - Intergenic
983541790 4:168919245-168919267 ACAGGCGTGACCCACGTGCCTGG - Intronic
983730360 4:170985798-170985820 ATAGGGGTGAGCCACGTGCCCGG + Intergenic
983878733 4:172908094-172908116 AGAGGAATGACCCATGTCCCAGG + Intronic
984348827 4:178565893-178565915 CTAGGCATGAGGCGTGTGCCAGG - Intergenic
984374095 4:178905292-178905314 ATAGGTGTGAACCATGTACCCGG - Intergenic
985513766 5:326780-326802 ACAGGCGTGAACCATGCGCCGGG - Intronic
986335804 5:6754543-6754565 AAAGGCAAGAACCATGTACCAGG - Intronic
987143961 5:14973315-14973337 ATAGGCATGAACATTGTGCCTGG + Intergenic
987941566 5:24545536-24545558 ATAGGTATGAGCCACATGCCAGG - Intronic
988598562 5:32617925-32617947 ACAGGCATGAGTCCTGTGCCTGG - Intergenic
988792029 5:34617694-34617716 ACAGGCATGAGCCCTGTGCTCGG - Intergenic
989039517 5:37212934-37212956 ATAGGCGTGCGCCACGTGCCCGG - Intronic
989550592 5:42731473-42731495 ACAGGCATGAGCCACTTGCCTGG - Intergenic
990049507 5:51480122-51480144 ATAGGCACTAACCAAGAGCCTGG + Intergenic
990390350 5:55313158-55313180 ACAGAAATGAGCCATGTGCCTGG - Intronic
990408283 5:55514100-55514122 ATAGGCATGAGCCATGTGCCTGG - Intronic
990597541 5:57326536-57326558 ACAGGCATGAACACCGTGCCTGG + Intergenic
990646919 5:57855719-57855741 ACAGGCATGCACACTGTGCCTGG + Intergenic
992043443 5:72861052-72861074 ACAGGCATGCACCACATGCCCGG + Intronic
992476578 5:77108405-77108427 AAGGGCATGAGCCATGTGCCTGG - Intergenic
992815618 5:80434745-80434767 ATAGGCATGAGTCATGTACTTGG + Intronic
993015620 5:82531841-82531863 AACGGCTTGCACCATGTGCCTGG - Intergenic
993706503 5:91177646-91177668 ACAGGCATGCACCACATGCCCGG + Intergenic
993924099 5:93844165-93844187 ACAGGCGTGAGCTATGTGCCTGG - Intronic
994174971 5:96701526-96701548 ACAGGCATGAGCCATGCACCCGG - Intronic
994289503 5:98011914-98011936 ATTTGAAAGAACCATGTGCCAGG + Intergenic
994376817 5:99024490-99024512 ATAGGCATGGCCACTGTGCCTGG + Intergenic
994379044 5:99048573-99048595 GCAGGCATGAGCCACGTGCCCGG + Intergenic
994485489 5:100383252-100383274 ATAGGCGTGAGCCACATGCCCGG - Intergenic
994647203 5:102484973-102484995 ACAGGCATGAGCCATGCTCCTGG - Intronic
994649116 5:102504571-102504593 AAGAGCATGCACCATGTGCCTGG + Intergenic
994755845 5:103792106-103792128 ACAGGTGTGAACCACGTGCCCGG + Intergenic
995842730 5:116459197-116459219 ATAGGCAAGAAGCATCTACCAGG + Intronic
995850955 5:116545291-116545313 ACAGGCATGACCCACGTGCCTGG - Intronic
996673103 5:126142647-126142669 ACAGGCATAAGCCATGTGCCTGG - Intergenic
997553415 5:134773211-134773233 ACAGACATGTACCATGTGCCTGG + Intronic
998232622 5:140370948-140370970 ATCGGCATGAAACATGTGAAAGG + Intronic
998234989 5:140390901-140390923 ACAGGCGTGAGCCATGTGCCCGG - Intergenic
998524335 5:142828647-142828669 TGAGGCATCAACCATGTGCAGGG + Intronic
998765986 5:145487846-145487868 ACAGGCATGAGCCACGCGCCCGG - Intronic
999207645 5:149861370-149861392 ACAGGCGTGAGCCCTGTGCCTGG - Intronic
1000003110 5:157158793-157158815 ACAGGCATGCACCACCTGCCTGG + Intronic
1000018588 5:157300014-157300036 ATAGCCATCTACTATGTGCCAGG - Intronic
1001038191 5:168313312-168313334 ACAGGCATGAGCACTGTGCCCGG - Intronic
1001069785 5:168575520-168575542 ACAGGCATGAGCCATGTTCCTGG - Intronic
1001520873 5:172391745-172391767 ATAGGCATGAGCCACTGGCCTGG + Intronic
1001850950 5:174964604-174964626 ATAAGCTGGAAACATGTGCCTGG + Intergenic
1001968670 5:175936155-175936177 ACAGGCGTGAGCCACGTGCCTGG - Intronic
1002499047 5:179635352-179635374 ACAGGCATGTACCACATGCCCGG + Intergenic
1002502629 5:179657171-179657193 ACAGGCATGTACCACATGCCCGG - Intergenic
1002532353 5:179855405-179855427 AAAGGCATGAACCACCAGCCCGG + Intronic
1002564911 5:180105994-180106016 AAAGGGATGAATCATGTCCCAGG + Intronic
1003151461 6:3554814-3554836 ACAGGCATGAGCCACATGCCCGG - Intergenic
1003514992 6:6810400-6810422 GTAGGCAAGAACCCTGTGCTAGG - Intergenic
1003877233 6:10449465-10449487 ATAGGCATGAGCCACATGCCTGG + Intergenic
1004805675 6:19201555-19201577 AACAGCTTGAACCATGTGCCTGG - Intergenic
1005215902 6:23527705-23527727 ACAGGCATGAGCACTGTGCCTGG - Intergenic
1005600014 6:27417082-27417104 ATAGGCATGGACTAAATGCCTGG - Intergenic
1005953962 6:30650506-30650528 ATAAGCGTGAGCCATGTGCCAGG - Intronic
1006347160 6:33491867-33491889 ATAGGCATGAGTCACGTTCCCGG - Intergenic
1006367949 6:33626601-33626623 TTAGGCATCTACCATGTGCTAGG + Intronic
1006943405 6:37767880-37767902 ACAGGCATGAGCCACTTGCCCGG + Intergenic
1007015238 6:38459292-38459314 ACAGGCGTGAGCCATGTGCCTGG + Intronic
1007100937 6:39246167-39246189 ACAGGCGTGAGCCACGTGCCCGG + Intergenic
1007426477 6:41749339-41749361 ACAGGCATGAGCCACGCGCCTGG + Intronic
1008376309 6:50795840-50795862 ACAGGCGTGAGCCCTGTGCCAGG - Intergenic
1008904241 6:56658727-56658749 ATATGCATTTACCATGTTCCAGG + Intronic
1009051629 6:58283124-58283146 AACAGCTTGAACCATGTGCCTGG + Intergenic
1009377504 6:62990709-62990731 AACAGCTTGAACCATGTGCCTGG - Intergenic
1009699779 6:67161176-67161198 AGCAGCTTGAACCATGTGCCTGG + Intergenic
1011262270 6:85482216-85482238 ATAGGCATGAGCCACGCACCTGG - Intronic
1011378603 6:86718671-86718693 AACAGCATGCACCATGTGCCTGG - Intergenic
1011459470 6:87588649-87588671 ATAGGCATGAACCACATGCCAGG + Intronic
1011561569 6:88622806-88622828 ATACTGATCAACCATGTGCCCGG + Intronic
1011585097 6:88916196-88916218 ACAGGCATGAGCCACCTGCCTGG - Intronic
1011660868 6:89592810-89592832 ACAGGTGTGAGCCATGTGCCTGG - Intronic
1012235203 6:96805951-96805973 ATAGCCATGTACCAGATGCCAGG - Intronic
1012747004 6:103104026-103104048 ACAGGCATGAGCACTGTGCCTGG + Intergenic
1013246390 6:108291105-108291127 ATAGGCATGAGCCATGGTGCTGG + Intergenic
1013339547 6:109200192-109200214 ACAGGCATGAACCACACGCCTGG - Intergenic
1013672076 6:112415534-112415556 ACAGGTGTGAGCCATGTGCCCGG - Intergenic
1013674716 6:112445028-112445050 ACAGGCATGAGCCACATGCCCGG + Intergenic
1013790108 6:113826930-113826952 ACAGGCATGCACCACATGCCTGG + Intergenic
1014473486 6:121844616-121844638 ACAGGCATGCACCATATGCCTGG - Intergenic
1014567302 6:122965313-122965335 ATATGCATGAACCATCTCTCTGG + Intergenic
1015233566 6:130944630-130944652 ATAGGCAGGAATCATGTGATGGG + Intronic
1015557674 6:134479807-134479829 ACAGGCATGACCACTGTGCCCGG + Intergenic
1016940324 6:149477890-149477912 ACAGGCATGAGCCCCGTGCCCGG - Intronic
1017100434 6:150845167-150845189 AGAGGCATAAGCCACGTGCCTGG + Intergenic
1018358517 6:163042139-163042161 ACAGGCTTGAGCCATGCGCCTGG + Intronic
1018399844 6:163411828-163411850 ACAGGCGTGAGCCACGTGCCTGG - Intergenic
1018544325 6:164918934-164918956 ACAGGCATTAACCCGGTGCCTGG + Intergenic
1019374261 7:680778-680800 ACAGGCATGGGCCCTGTGCCTGG - Intronic
1019574744 7:1731924-1731946 ATAAGCATGAGCCAGGTGCCTGG + Intronic
1019677044 7:2320077-2320099 ACAGGCGTGAGCCATGTGCCTGG - Intronic
1019949848 7:4362491-4362513 ACAGGCATGAGCCATGCACCCGG - Intergenic
1020216445 7:6194698-6194720 ACAGGCGTGAGCCACGTGCCCGG - Intronic
1020449928 7:8309275-8309297 ACAGGCATGAACCATGTGCCTGG + Intergenic
1020555764 7:9667983-9668005 ACAGGCGTGAGCCAGGTGCCTGG - Intergenic
1020784730 7:12558721-12558743 ATAGGCGTGCACCACATGCCTGG + Intergenic
1020963968 7:14842929-14842951 ATAGGCATTAGCCACCTGCCTGG - Intronic
1021449433 7:20769157-20769179 ATAGGCATGAGCACTGTGCCCGG + Intronic
1021522863 7:21554449-21554471 ATAGGCATGAGCCCTGCACCTGG + Intronic
1021688420 7:23210044-23210066 ACAGGTATGGGCCATGTGCCTGG - Intergenic
1021713115 7:23436031-23436053 ACAGGCATGAGCCACATGCCCGG + Intronic
1021895405 7:25230329-25230351 ACAGACATGAGCCACGTGCCTGG - Intergenic
1021981988 7:26064342-26064364 ACAGGCATGAGCCACCTGCCTGG - Intergenic
1021999844 7:26215874-26215896 ACAGGCATGATCCACTTGCCAGG + Intergenic
1023055525 7:36286944-36286966 ATAGGCATGAGCTACGTACCCGG - Intronic
1023827947 7:44022093-44022115 ATAGGCATGAGCCCTGCCCCTGG + Intergenic
1023931002 7:44706596-44706618 ACAGGCGTGAGCCATGCGCCCGG + Intronic
1024719754 7:52121964-52121986 ACAGGCATGCACCACATGCCAGG + Intergenic
1025170012 7:56748064-56748086 ACAGGCATGACCCACATGCCTGG + Intergenic
1025701877 7:63827659-63827681 ACAGGCATGACCCACATGCCTGG - Intergenic
1025722369 7:64028172-64028194 ATAGGTATGACTCATGTGCCTGG - Intergenic
1026621198 7:71951312-71951334 ACAGGCATGAGCCATGCGCCCGG - Intronic
1026719939 7:72821967-72821989 ACAGGCTTGAGCCACGTGCCTGG - Intronic
1026860330 7:73782752-73782774 ATAGAAATGAAACATGGGCCTGG - Intergenic
1027134478 7:75614315-75614337 ACAGGCATGAGCCATGCGCTGGG + Intronic
1027752900 7:82173764-82173786 ACAGGCATGAGCCATGTGCCTGG - Intronic
1028257054 7:88611706-88611728 ATATTCATGAACCATGGCCCTGG - Intergenic
1028530037 7:91828275-91828297 ACAGGCAGGAGCCACGTGCCTGG + Intronic
1029143644 7:98430069-98430091 AAAGGCGTGAGCCACGTGCCTGG - Intergenic
1029243639 7:99182609-99182631 ATAGGCATGAACCCCCTGCCCGG + Intronic
1029449464 7:100632887-100632909 ACAGGAAAGAACCATGTGGCTGG - Intronic
1029454311 7:100660465-100660487 ACAAGCATGAGCCCTGTGCCTGG + Intergenic
1029473243 7:100767615-100767637 ATAGGCATGCACCACCTGCACGG + Intronic
1029704199 7:102267255-102267277 ACAGGCATGAGCCACATGCCCGG - Intronic
1029756250 7:102575538-102575560 ATAGGCATGAGCCCTGCCCCTGG + Intronic
1029774190 7:102674611-102674633 ATAGGCATGAGCCCTGCCCCTGG + Intergenic
1029964832 7:104728532-104728554 ATTGGCATGAAAGATGTTCCAGG - Intronic
1030047600 7:105511483-105511505 TCAGGCATGAGCCATGCGCCTGG - Intronic
1030859773 7:114610909-114610931 ATAAGCATGAGCCATCAGCCTGG + Intronic
1031089902 7:117341563-117341585 ATAGGTATGAGCTATGTGCCTGG + Intergenic
1032102574 7:128994932-128994954 ATAGGCATGAGCCACGTGCCTGG + Intronic
1032186826 7:129733879-129733901 ATAGGCATGAGCCCAGTGCTGGG - Intronic
1032322661 7:130898782-130898804 ACAGGCATGAGCCACGCGCCCGG + Intergenic
1032362605 7:131270196-131270218 ACAGGCATGAGCCATGCACCCGG + Intronic
1032784893 7:135193271-135193293 AAGGGCATGAACCAGGTTCCTGG - Exonic
1033065864 7:138153382-138153404 ACAGGCATGAGCCACGTGCCCGG + Intergenic
1033080444 7:138291790-138291812 ACAGGTGTGAGCCATGTGCCTGG - Intergenic
1033135865 7:138783448-138783470 TCAGACATGAGCCATGTGCCTGG - Intronic
1033260309 7:139838335-139838357 TTAGGCACCAACTATGTGCCAGG - Intronic
1033307544 7:140236051-140236073 TTGGGCATCTACCATGTGCCTGG - Intergenic
1033321132 7:140340650-140340672 ACAGGCATGAGCCACTTGCCTGG - Intronic
1033370350 7:140701654-140701676 ACAGGCGTGAGCCACGTGCCCGG - Intronic
1033632214 7:143170118-143170140 ACAGGCATGAACAACATGCCTGG - Intergenic
1034122997 7:148644326-148644348 ATAGACATGAGCCACTTGCCTGG - Intergenic
1034123984 7:148654641-148654663 ACAGGCAAGAAACCTGTGCCTGG + Intergenic
1034384486 7:150727897-150727919 TTAGGCATGCCCTATGTGCCTGG - Intronic
1038185756 8:25273319-25273341 ACAGGTATGAGCCATGTGCCTGG - Intronic
1038389883 8:27186739-27186761 ACAGGCATGAGCACTGTGCCTGG + Intergenic
1038964703 8:32558802-32558824 ACAGGCATGAGCCACGTGCCTGG - Intronic
1039180384 8:34860019-34860041 ACAGGCATGAGCCACTTGCCTGG + Intergenic
1039203633 8:35124620-35124642 ACAGGCATGAGCCACGTGCCTGG - Intergenic
1039387125 8:37146017-37146039 ATGGGCATGATCCAAGTGGCTGG - Intergenic
1039478192 8:37852512-37852534 ACAGTCATGAGCCACGTGCCTGG - Intergenic
1039812208 8:41059228-41059250 ATAGGCATGAGCTACATGCCTGG - Intergenic
1039939886 8:42081044-42081066 ACAGGCATGAGCCACATGCCCGG + Intergenic
1040036571 8:42876122-42876144 ACAGACATGAACCACGTGACTGG + Intronic
1041228600 8:55726682-55726704 ATAGGCATGGCCACTGTGCCTGG - Intronic
1042323340 8:67502185-67502207 ATAGGCATGAGCCATGCACCTGG - Intronic
1042538139 8:69879891-69879913 TCAGGCATGAACCACATGCCTGG + Intergenic
1042556768 8:70039861-70039883 ACAGGCATGAGCCATGCACCCGG + Intergenic
1042829948 8:73015976-73015998 ACAGGTGTGAGCCATGTGCCTGG - Intronic
1043001089 8:74760267-74760289 TTAAGCATTTACCATGTGCCAGG - Intronic
1043768264 8:84164307-84164329 ACAGGCATGAGCACTGTGCCTGG + Intergenic
1044278545 8:90330026-90330048 ACAGTCATGAGCCATGTGCCCGG - Intergenic
1044705787 8:95007385-95007407 ATGGGCATGAGTCATGTGCCTGG - Intronic
1045677945 8:104628891-104628913 ATTGGCATCAACTAGGTGCCAGG - Intronic
1045913752 8:107441807-107441829 ACAGGCATGAGCCATGCGCCTGG - Intronic
1045956757 8:107917206-107917228 ACAGGCATGAGCCACCTGCCTGG - Intronic
1045988216 8:108275143-108275165 ACAGGCATGAGCCCTGTGTCTGG - Intronic
1047578360 8:126183677-126183699 AGAGAGATGAACGATGTGCCAGG - Intergenic
1047981467 8:130187696-130187718 ATAGGCATGACCACTGTGCCTGG + Intronic
1047990366 8:130279938-130279960 ATAAACATCAACTATGTGCCAGG + Intronic
1048404826 8:134108611-134108633 ATGGGCATGAGCCATCTGGCTGG - Intergenic
1048821676 8:138385942-138385964 ACAGGCATGAGCCACGTGCCTGG - Intronic
1049630821 8:143655731-143655753 ACAGGCATGAGCCACGGGCCTGG - Exonic
1049903846 9:197238-197260 ACAGGCATGAGCCACGTGCCCGG + Intergenic
1050102843 9:2136462-2136484 ACAGGCGTGAACACTGTGCCTGG + Intronic
1050458853 9:5859749-5859771 GTAAGCATCAACTATGTGCCAGG - Intergenic
1052446082 9:28563121-28563143 ATAGGCCTGAACCACATGCCTGG + Intronic
1052512038 9:29434602-29434624 ATAGGAGTCAGCCATGTGCCTGG - Intergenic
1052774449 9:32719493-32719515 ATTTGCTTGTACCATGTGCCAGG - Intergenic
1052835993 9:33250517-33250539 TTAAGCCTGAACAATGTGCCAGG + Intronic
1053091799 9:35285440-35285462 ACAGGAGTGAACCATGTGCCTGG - Intronic
1053098438 9:35349278-35349300 TTAGCCATGAACAATGTTCCTGG - Intronic
1053153980 9:35761392-35761414 ACAGGCATGAGCCATGCACCTGG - Intergenic
1053233680 9:36433461-36433483 ATAGGCATGAGCACTGTGCCTGG - Intronic
1053458547 9:38250674-38250696 TTAGGCATCTGCCATGTGCCAGG + Intergenic
1053746852 9:41207537-41207559 ACAGGCATGAGCCATGTGCCCGG + Intergenic
1054480431 9:65657822-65657844 ACAGGCATGAGCCATGTGCCCGG - Intergenic
1054681492 9:68223744-68223766 ACAGGCATGAGCCATGTGCCCGG - Intergenic
1054755901 9:68957435-68957457 ATAGGCATGAACCTAGTGATGGG - Intronic
1055027997 9:71742940-71742962 ACAGGCATAAGCCATGTGCCCGG - Intronic
1055944227 9:81678478-81678500 ATAGGCATGAGCCACATGCCTGG + Intronic
1056133816 9:83610804-83610826 ACAGGCATGAGCTCTGTGCCCGG + Intergenic
1056420302 9:86419152-86419174 ATAGGCATGAGCGCTGCGCCTGG - Intergenic
1056524454 9:87430210-87430232 ATAGGCATGTGCCACGTGCCCGG + Intergenic
1057594247 9:96401382-96401404 ACAGGCTTGAGCCACGTGCCCGG - Intronic
1057778721 9:98032923-98032945 ATAAAAATGAAACATGTGCCAGG + Intergenic
1058088262 9:100774633-100774655 TTAAGCATCTACCATGTGCCAGG + Intergenic
1058476616 9:105341056-105341078 ATAGGTGTGAGCCATGCGCCTGG - Intronic
1059099394 9:111455206-111455228 ACAGGCGTGAACCATGTGCCAGG - Intronic
1059114475 9:111588504-111588526 ACAGGCGTGAGCCACGTGCCTGG + Intronic
1059207576 9:112481038-112481060 ACAGGTATGAACCACATGCCTGG + Intronic
1059224831 9:112662516-112662538 ATAGGCGTGAGCCACGCGCCAGG - Exonic
1060559917 9:124534347-124534369 ACAGGCATGAGCCACGTGCCTGG + Intronic
1060652321 9:125339121-125339143 ATAGGCATGCACCACATGCCTGG + Intronic
1061016598 9:127984492-127984514 GCAGGCATGCACCATGCGCCTGG + Intergenic
1061112941 9:128588270-128588292 ATAGGTATGAGCACTGTGCCCGG + Intronic
1061487361 9:130926921-130926943 ATAGGCCTATACCATGTGCTGGG - Intronic
1061631660 9:131875884-131875906 ACAGGCATGACCCACGCGCCCGG + Intronic
1061738600 9:132681844-132681866 ACAGGCATGACCACTGTGCCCGG - Intronic
1062283445 9:135762165-135762187 ACAGGCATGAGCCCTGCGCCTGG - Intronic
1062531202 9:137001217-137001239 ACAGGCGTGAGCCATGTGCCTGG - Intergenic
1202782983 9_KI270718v1_random:18317-18339 ACAGGCATGAGCCATGTGCCCGG + Intergenic
1186443741 X:9608076-9608098 ACAGGCATGAGCCATGTGCCTGG + Intronic
1186593963 X:10960589-10960611 ATAGGCATGAGCACTGAGCCTGG + Intergenic
1187151731 X:16687221-16687243 ACAGGAATGAGCCATATGCCTGG - Intronic
1187246856 X:17560623-17560645 ATAGTGCTGAACCATGTGCTGGG - Intronic
1187377359 X:18767268-18767290 AGAGGCATGAGCCACGCGCCTGG - Intronic
1188184667 X:27099056-27099078 ACAGGCCTGAGCCATCTGCCAGG + Intergenic
1189161653 X:38815356-38815378 ACAGGCATGAGCCACGCGCCTGG + Intergenic
1189540350 X:41981086-41981108 ATAGGAATGAGCCAAGTGCAAGG + Intergenic
1189747121 X:44180547-44180569 ATAGGGTTTCACCATGTGCCAGG - Intronic
1189955465 X:46273066-46273088 ACAGACATGAGCCATGCGCCTGG - Intergenic
1189997452 X:46652426-46652448 ATAGGCATGCGCACTGTGCCTGG + Intronic
1190022059 X:46887952-46887974 ACAGGCATGAGCCCTGTGTCTGG - Intronic
1190299303 X:49047218-49047240 AAAGGCATGAGCCACATGCCCGG + Intergenic
1190741762 X:53293365-53293387 CTGAGCATGTACCATGTGCCAGG - Intronic
1190784908 X:53636578-53636600 ACAGGCATGCACCACATGCCTGG - Intronic
1192278213 X:69655250-69655272 ACAGGCATGCACCACATGCCAGG - Intronic
1192729668 X:73790513-73790535 ATAGGAATGAGCCCTGTGCCTGG - Intergenic
1193719849 X:84974112-84974134 ACAGGCGTGAGCCACGTGCCCGG + Intergenic
1193749961 X:85329200-85329222 TTAAGCATCCACCATGTGCCAGG - Intronic
1195050768 X:101094681-101094703 ATCGTCATGACCCTTGTGCCTGG + Exonic
1195641567 X:107181190-107181212 ACAGGCATGAGCCATGCACCTGG + Intronic
1196558608 X:117120813-117120835 ATCAGCTTGAACCATGTGCCTGG - Intergenic
1197512459 X:127386956-127386978 ACAGGCTTGAGCCACGTGCCCGG + Intergenic
1198077734 X:133210657-133210679 ACAGGCATGAGCCACGTGCCTGG - Intergenic
1198460566 X:136859157-136859179 ACAGGCATGATCCATGTGCCAGG - Intronic
1198894910 X:141443055-141443077 ACAGGCATGAGCCACGTGCCTGG - Intergenic
1199151275 X:144489815-144489837 ATAGGGATATACCATGTGCTAGG - Intergenic
1199545398 X:149003246-149003268 ACAGGCATGACCACTGTGCCTGG + Intergenic
1200406751 Y:2819739-2819761 ACAGGCATAAGCCACGTGCCCGG - Intergenic
1201219464 Y:11754064-11754086 ACAGGCATGAGCCATGTACTTGG + Intergenic
1201313808 Y:12622964-12622986 ATAGGCATGAGCCACATGCCCGG - Intergenic
1201591992 Y:15625782-15625804 AGAGGTAAGACCCATGTGCCCGG - Intergenic
1201610559 Y:15838656-15838678 ATAGGCATGAGCCACATGCCTGG - Intergenic
1202391272 Y:24372910-24372932 ACAGGCATCAGCCCTGTGCCTGG - Intergenic
1202479513 Y:25297207-25297229 ACAGGCATCAGCCCTGTGCCTGG + Intergenic