ID: 1081254218

View in Genome Browser
Species Human (GRCh38)
Location 11:40872116-40872138
Sequence GAGATCTGACAACTAGGCAT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 105}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081254213_1081254218 2 Left 1081254213 11:40872091-40872113 CCTGTGTGAAGGATGCCCTGGTG 0: 1
1: 0
2: 4
3: 17
4: 184
Right 1081254218 11:40872116-40872138 GAGATCTGACAACTAGGCATCGG 0: 1
1: 0
2: 1
3: 3
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081254218 Original CRISPR GAGATCTGACAACTAGGCAT CGG Intronic
900269449 1:1779389-1779411 GAGAGCTGAGAACTGGGTATAGG - Intronic
903876267 1:26475554-26475576 GAGACCTGACCCCTAGTCATTGG + Exonic
908459247 1:64333291-64333313 GAGGTCTGAGAACCAGGCAGAGG - Intergenic
908568746 1:65386551-65386573 GAGATCTGCAAAGCAGGCATGGG + Intronic
909773487 1:79456112-79456134 GAGATCAGAGAAGTAGGGATGGG - Intergenic
910169414 1:84361533-84361555 GAGATCACACAACTAGAAATTGG + Intronic
911980169 1:104557391-104557413 GAAATCTGAAGAATAGGCATGGG + Intergenic
917051716 1:170932082-170932104 GTTATCTGAAATCTAGGCATTGG + Intergenic
919477082 1:198042296-198042318 GAGAACTGACAACCAAGCCTAGG + Intergenic
921819888 1:219605091-219605113 GATATCTGATATCTAGTCATAGG + Intergenic
923211602 1:231808654-231808676 CAGGTCAGACAACTAGGCATTGG - Intronic
1066600219 10:37096960-37096982 CAAATCTGACAAATAGCCATGGG + Intergenic
1075127012 10:119708507-119708529 GAGGTCTGAAATCAAGGCATTGG - Intergenic
1078075249 11:8153389-8153411 GAGAACTGACAAAAAGCCATTGG - Intronic
1081254218 11:40872116-40872138 GAGATCTGACAACTAGGCATCGG + Intronic
1081608267 11:44541307-44541329 GAGGTCAGACAACTAGGCGGGGG + Intergenic
1085890166 11:80569933-80569955 CAAATCTGACAAATAGCCATGGG - Intergenic
1090156636 11:124445018-124445040 GATATTTGAAAAATAGGCATTGG - Intergenic
1094141767 12:27188876-27188898 GAGATCAGAGAAGTAGGCAGGGG - Intergenic
1096603399 12:52746721-52746743 GAGCTCTGCCAACTTGGCCTGGG + Intergenic
1114535501 14:23419720-23419742 GGGATCTGAGAACCAGGCAGAGG + Intronic
1116510785 14:45743957-45743979 GAGCTCTGAGGACTAGGCACTGG - Intergenic
1117187060 14:53250809-53250831 GAGAACTGACAAATAACCATTGG - Intergenic
1119703571 14:76770700-76770722 GAGATGGGAGAGCTAGGCATGGG + Intronic
1120471969 14:84937284-84937306 GAAATCTGAAAATTAGACATTGG - Intergenic
1121683241 14:95811875-95811897 GACATCAGACAACTTGGCTTAGG - Intergenic
1124389464 15:29240802-29240824 TACTTCTGACAACTATGCATGGG - Intronic
1124445871 15:29731388-29731410 GAGACCTGACCCCTAGTCATTGG + Intronic
1124630891 15:31336413-31336435 GAGATCTAACAGGTATGCATGGG + Intronic
1127151973 15:56085054-56085076 GAGATATGTTAACTAGGAATGGG + Intergenic
1127796672 15:62444239-62444261 GAGATCTGAGAAATGGGCCTTGG + Intronic
1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG + Intergenic
1131583921 15:93673077-93673099 GAGATCTGAAAAACAGGCTTTGG - Intergenic
1136734769 16:32456054-32456076 GACAGCTGACAGCAAGGCATGGG - Intergenic
1140196711 16:72861276-72861298 GAGATCTTCCCACTAAGCATCGG + Intronic
1141315420 16:82958138-82958160 AAGATCTGACAGCCAGGAATGGG - Intronic
1203018311 16_KI270728v1_random:373542-373564 GACAGCTGACAGCAAGGCATGGG + Intergenic
1203036646 16_KI270728v1_random:646700-646722 GACAGCTGACAGCAAGGCATGGG + Intergenic
1143418074 17:6764874-6764896 GAGAACTGAGAACTGAGCATTGG - Intronic
1147217901 17:38911612-38911634 GGGATCTGAGAACAGGGCATGGG + Intronic
1148590430 17:48812451-48812473 GAGTTCAGACAACTAGGAAGTGG - Intronic
1153366987 18:4267742-4267764 GTCATCTGACAACTAGGCTGTGG + Intronic
1157132001 18:45015849-45015871 GAGATTTGACATTTAGTCATGGG + Intronic
1162386064 19:10361391-10361413 GAGAGTTGAGAAATAGGCATAGG + Intronic
1163275519 19:16281525-16281547 GAGATGTGACAAATGGGCACAGG + Intergenic
925730295 2:6915436-6915458 GAGATCAGAGATCTAGGGATGGG + Intergenic
926812913 2:16772351-16772373 GAGATCAAACATCCAGGCATTGG - Intergenic
928615870 2:33039008-33039030 GAGATTTCACAACTAGGCTGGGG - Intronic
929874834 2:45787716-45787738 GAGACCTGACAACTTGGCTCAGG + Intronic
932507915 2:72254441-72254463 GAAATCTGAAATCAAGGCATTGG - Intronic
933606115 2:84385806-84385828 GAGAAGAGAGAACTAGGCATTGG - Intergenic
937785554 2:125890367-125890389 GGGACCTGGCAACTAGGAATGGG - Intergenic
941686466 2:168453852-168453874 GTGATCTGACAAATTTGCATAGG + Intergenic
942361832 2:175181128-175181150 GAGGCCTGACAGCTAGGCCTCGG + Intronic
943123739 2:183770547-183770569 GATATCTGACAAATATGTATTGG - Intergenic
948327394 2:237136936-237136958 GAGATCTGACAACTAAACGTGGG - Intergenic
1171887534 20:30668966-30668988 GAGCTCTGATAACAAGGCAAGGG + Intergenic
1178553928 21:33569578-33569600 GAGATCTTACAAGAAGGCACAGG - Intronic
1179005735 21:37512443-37512465 GACATCTGACAATGAGGCAAGGG + Exonic
1182774468 22:32820582-32820604 AAGATGTGCCAACTAAGCATGGG - Intronic
1182802697 22:33044602-33044624 GAGAAATGACAACCAGGCAGAGG - Intronic
1182932617 22:34189582-34189604 GAGATCTGTCAAATGGCCATAGG - Intergenic
1183007495 22:34915591-34915613 GAGATCTCACAGCTAGGGAGTGG - Intergenic
1184885253 22:47341093-47341115 GAGATCTGAGAAGCACGCATGGG - Intergenic
950407461 3:12813676-12813698 GAGATAACACAACTAGGAATTGG + Intronic
955091357 3:55753743-55753765 GAGATCTGACAATAATCCATTGG + Intronic
955353498 3:58211210-58211232 CAGCTCTGACATCTAGTCATCGG + Exonic
958597250 3:96242827-96242849 CAGATCTGAAAACTAAGCAAGGG + Intergenic
962702401 3:138012317-138012339 GAGAACTGAGAACTAGGAGTTGG - Intronic
963086248 3:141439131-141439153 GAGAACTGTCAACTAATCATTGG - Intronic
964684163 3:159376569-159376591 CAGGTCTGATAACTAGGCTTTGG + Intronic
970212548 4:13725420-13725442 TAGATCTAACAACCATGCATAGG - Intergenic
970656443 4:18235535-18235557 CAGATCTGAAAACTGGGCAAAGG - Intergenic
972130513 4:35827436-35827458 GAGATTTGAAAAATAGGAATAGG - Intergenic
973117775 4:46482833-46482855 GAAATCTGCAAACTAGGCAAGGG - Intergenic
975632411 4:76416764-76416786 TACATCTGACATCTAGGCAGAGG - Intronic
977153929 4:93549586-93549608 TAGGTCTGACCACTGGGCATTGG - Intronic
977217148 4:94296645-94296667 GAAATCTGACCACTAGGCCAAGG - Intergenic
983152346 4:164300370-164300392 TAGATCGGAAACCTAGGCATAGG - Intronic
983355045 4:166646153-166646175 GAGATCTGAGAACTGAGCCTTGG - Intergenic
988653281 5:33177777-33177799 GAGACATGACAAAAAGGCATTGG - Intergenic
989135376 5:38149275-38149297 GAGATGTGGTAACTAAGCATTGG + Intergenic
990208073 5:53451473-53451495 GAGATGGGACTACTAGGGATTGG - Intergenic
990342053 5:54833456-54833478 GGGATCAGACACCTAGGCCTGGG - Intergenic
995680399 5:114711794-114711816 GAAATCTGAGAACTAAGCACTGG - Intergenic
997978615 5:138454996-138455018 GGCATCTGACAACTTGGCAGTGG - Intergenic
1006990775 6:38212889-38212911 GAAATGTGAAGACTAGGCATGGG + Intronic
1009565751 6:65309496-65309518 GATATCTGATATCTAGTCATAGG - Intronic
1016814852 6:148293940-148293962 GAAATCTGAGAAATAGTCATTGG + Intronic
1018634101 6:165845857-165845879 GAGGTCTCATACCTAGGCATCGG - Intronic
1022441047 7:30433497-30433519 GAGAACTGAGAAGCAGGCATTGG - Intronic
1024950707 7:54857735-54857757 GTGATCTGAATACTAGGCAGTGG + Intergenic
1028323774 7:89496497-89496519 GAGCTCTTGCATCTAGGCATGGG + Intergenic
1028874485 7:95805597-95805619 ATGATATGACAACAAGGCATTGG - Intronic
1029999628 7:105045190-105045212 AAGATCTGAGAACTAGGCATGGG - Intronic
1033230039 7:139589654-139589676 GAGAGCTGACAGCTTGGCGTGGG + Intronic
1042602276 8:70510673-70510695 GAGTTCTGATATCTAGGCAGAGG - Intergenic
1042741268 8:72049873-72049895 AATATGTGACAACTAGGCACTGG + Intronic
1043861799 8:85326225-85326247 GAGGTATGTAAACTAGGCATTGG - Intergenic
1045824014 8:106375594-106375616 GACATCTGACTACTAGGAAAGGG + Intronic
1047560826 8:125986844-125986866 GAGAGCTGACAAGCAGGCGTCGG - Intergenic
1050215923 9:3323233-3323255 GAGAACTGACAATTGGTCATAGG + Intronic
1052414231 9:28157203-28157225 TACATCTGAAAACTAGGCAGAGG + Intronic
1059598385 9:115747912-115747934 GAAATCTGAGAACTATGGATTGG + Intergenic
1187841869 X:23497273-23497295 GAGATATGACAGTTAGGAATAGG - Intergenic
1188236613 X:27739507-27739529 AAGGTCTGAGAACTAGGCATTGG - Intronic
1198209197 X:134500726-134500748 GAGAAATGATAACTATGCATAGG - Intronic
1199942767 X:152641069-152641091 GAGATCTGAGGACTAGGCTGAGG - Intronic
1202303093 Y:23438433-23438455 GGGATTTGAGAACCAGGCATAGG - Intergenic
1202567718 Y:26232161-26232183 GGGATTTGAGAACCAGGCATAGG + Intergenic