ID: 1081257834

View in Genome Browser
Species Human (GRCh38)
Location 11:40919232-40919254
Sequence TTCCAGCTGTATCACAGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 1, 2: 1, 3: 26, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081257833_1081257834 -1 Left 1081257833 11:40919210-40919232 CCTAAAAGCTAAAGATCATGGAT 0: 1
1: 0
2: 0
3: 17
4: 229
Right 1081257834 11:40919232-40919254 TTCCAGCTGTATCACAGTGTAGG 0: 1
1: 1
2: 1
3: 26
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081257834 Original CRISPR TTCCAGCTGTATCACAGTGT AGG Intronic
901364486 1:8734169-8734191 CTCCAGCTGTATCAAAGTAAAGG - Intronic
903666353 1:25009884-25009906 TTGCAGCTGCTACACAGTGTAGG - Intergenic
906681725 1:47731154-47731176 TGCCAGGTGTTTCACAGTGATGG - Intergenic
906995691 1:50791545-50791567 TTCCATCAGTATCACCCTGTAGG + Intronic
907343106 1:53751555-53751577 TTCCAGCTGTCTCTGAGAGTTGG - Intergenic
908405631 1:63811585-63811607 TTCCTGCTACATCTCAGTGTAGG - Intronic
908510406 1:64846389-64846411 TCCCAGGTCTAGCACAGTGTAGG + Intronic
908892030 1:68859332-68859354 TTCCTCCTGGCTCACAGTGTAGG + Intergenic
909022651 1:70449351-70449373 TTCCAGCTGGATCAGAGAGAAGG - Intergenic
909227432 1:73043922-73043944 TGTCACCTGTCTCACAGTGTGGG - Intergenic
909828126 1:80151791-80151813 TTCCAGTTTTATCCCACTGTGGG + Intergenic
910257664 1:85264502-85264524 TTCCAACTGTATAACATTCTGGG + Intergenic
910754297 1:90670408-90670430 TTCCTACTGTATGCCAGTGTTGG - Intergenic
911188983 1:94928814-94928836 TTCCAGTAGTATGACAGTGACGG + Intergenic
912511809 1:110194883-110194905 CTCCAGCTGTGTCCCAGTGTGGG - Intronic
913066941 1:115264733-115264755 CTCTAGCTGAATTACAGTGTTGG - Intergenic
917559295 1:176129235-176129257 TTCCAGACGAATCAAAGTGTAGG - Intronic
920276164 1:204806601-204806623 TTCCAGTAGTTTCACAGTTTCGG - Intergenic
1063335006 10:5203583-5203605 TTTCATCTGTCTCACAGTGTTGG + Intronic
1063678326 10:8161937-8161959 CTCCTTCTGTAGCACAGTGTGGG - Intergenic
1067271524 10:44795726-44795748 TTCCAGCTGTTTCACATGGTGGG + Intergenic
1068193497 10:53685188-53685210 TTCTAGCAGTATTACAGTTTTGG - Intergenic
1069275741 10:66588277-66588299 TTCCATCTGGTTCACAGTGTAGG + Intronic
1069718250 10:70534296-70534318 TTCCTTCTGAATCACATTGTGGG - Intronic
1070749002 10:78952970-78952992 CTCCAGCTGTCTCCAAGTGTTGG - Intergenic
1077853134 11:6095428-6095450 TTCTGCCTGGATCACAGTGTAGG - Intergenic
1078125064 11:8553343-8553365 TTCCAGTTGTATAAAAGTGTGGG - Intronic
1079665653 11:23102225-23102247 TTACAGCTCTATTACTGTGTTGG + Intergenic
1081257834 11:40919232-40919254 TTCCAGCTGTATCACAGTGTAGG + Intronic
1085465487 11:76720532-76720554 TTCTAGCTGTACCACTGTGGTGG - Intergenic
1085959974 11:81450279-81450301 TTCTAGCTGAAACACTGTGTTGG - Intergenic
1086788108 11:90997730-90997752 CTCCAGCTGTAACACAGTTATGG - Intergenic
1087364686 11:97203106-97203128 TTCCACCTGGCTCACAGTGTAGG + Intergenic
1087637709 11:100721343-100721365 TTCCAACTGTATGACATTCTGGG - Intronic
1087641047 11:100753864-100753886 TTCCACCTGGCTCTCAGTGTAGG + Intronic
1087644274 11:100789167-100789189 TTCCATTTGGATGACAGTGTAGG - Intronic
1088026766 11:105194572-105194594 GTCCAGCTGCATCACAGTCCTGG + Intergenic
1088027630 11:105205395-105205417 TTCCAGATGTATAATAGAGTAGG - Intergenic
1089382465 11:118045193-118045215 TTCCAGCTGGAGAAAAGTGTAGG - Intergenic
1089863803 11:121614484-121614506 TTCCTGCTGTAACACTGTGATGG + Intronic
1090143626 11:124293789-124293811 TTCCAGCTTTCTCATAGTCTAGG + Intergenic
1090352708 11:126117340-126117362 TTCCAGCTTTAACAAAGGGTGGG - Intergenic
1092865709 12:12759034-12759056 GTCCAGCTGAACCACACTGTAGG - Intronic
1093121508 12:15276796-15276818 TTAGAGCTGTATCACAGTCTGGG - Intronic
1093267172 12:17016930-17016952 TTCCACCTGTATCACAGTGTAGG + Intergenic
1097987196 12:65796370-65796392 TTCCTGATGGTTCACAGTGTTGG + Intergenic
1099886342 12:88535931-88535953 TTCCAGCATTTTTACAGTGTGGG - Intronic
1103223091 12:119262737-119262759 TTCCAGCTGTGGGACAGTCTGGG + Intergenic
1105740100 13:23315103-23315125 TTACAGGTGAATCACAGTGGAGG + Intronic
1106237959 13:27881364-27881386 TTCCAGGAATATCACAGTGCAGG + Intergenic
1107377651 13:39821793-39821815 TTCTAGCTGTGTCCCAGTGCAGG - Intergenic
1108745017 13:53384476-53384498 TTCCAGTTCTACCACAGTGAAGG - Intergenic
1110209497 13:72954717-72954739 TTCCATCTGGTTCACAGTGTAGG + Intronic
1110314590 13:74091398-74091420 TTCCAACTGTATAACATTCTAGG - Intronic
1112381900 13:98899326-98899348 ATCCAGCTGTATGACTCTGTAGG + Intronic
1114882900 14:26808766-26808788 TTCCATCTGCATGACAGTTTAGG - Intergenic
1115936336 14:38557382-38557404 TTCCTCCTAAATCACAGTGTGGG + Intergenic
1117147723 14:52852061-52852083 TTCCAAATGGGTCACAGTGTTGG - Intergenic
1119194544 14:72707603-72707625 TTCCTGATGTATCACTGAGTGGG + Intronic
1121135715 14:91496688-91496710 TTTCAGCCATATCACAGTTTTGG + Intronic
1121723670 14:96130432-96130454 TCTCAGTTGTACCACAGTGTGGG - Intergenic
1123150711 14:106178993-106179015 TTCAAGATGTATGGCAGTGTGGG - Intergenic
1123399122 15:19966738-19966760 TTCAAGATGTATGGCAGTGTGGG - Intergenic
1124915678 15:33970520-33970542 GTTCAGCTGTTTCTCAGTGTAGG - Intronic
1127596687 15:60490120-60490142 TGGCAGCTGTATCAGAGTGCTGG - Intronic
1131413684 15:92232757-92232779 TTTCACCTGCCTCACAGTGTAGG - Intergenic
1132069038 15:98759242-98759264 TGCCATCTGTATCTCAGTGCAGG + Intronic
1135716268 16:24770983-24771005 TTCCAGAGGTGACACAGTGTGGG + Intronic
1138447462 16:57073384-57073406 TTCCAGCTGTATACCTGTGATGG + Intronic
1145927060 17:28655903-28655925 TTGCAGTTGTGTCACAGTGAAGG + Intronic
1147626038 17:41900777-41900799 TGCCTGCTGTCTCACAGTGATGG + Intronic
1149232317 17:54549293-54549315 TTCTAGCAGTTTCACAGTTTGGG + Intergenic
1149317555 17:55452876-55452898 TTCCCTCTCTATCAAAGTGTTGG - Intergenic
1149333137 17:55606985-55607007 CTACAGCTGTCTCACAGTTTGGG + Intergenic
1149547669 17:57516368-57516390 TACCAGCTGTATTCCATTGTAGG + Intronic
1157331213 18:46705124-46705146 TCTCAGCTATGTCACAGTGTAGG - Intronic
1158556408 18:58478256-58478278 ATCTAGCTGTATCTCAGTGTGGG - Intergenic
1161014505 19:1977095-1977117 ATCCAGCTGGGTCACCGTGTTGG - Intronic
1163200830 19:15767720-15767742 TTTCACCTGTCTCACAGAGTAGG + Intergenic
1164954887 19:32373771-32373793 TTCCAGCATTATCACTTTGTGGG + Intronic
1165430199 19:35767775-35767797 CTCCATCTGAATCCCAGTGTCGG + Intronic
1165461119 19:35944955-35944977 GTCCAGCTGGACCACGGTGTGGG - Exonic
1165849982 19:38844194-38844216 TTCCGTCTGTACCACAGTCTTGG - Intronic
1167728559 19:51235784-51235806 TTCCTCCTGTTTAACAGTGTAGG + Intronic
925855176 2:8122647-8122669 TTCCAGCTGCGTCACAGGGAGGG - Intergenic
926648016 2:15310962-15310984 TTCCTGCTGTATCATTCTGTTGG - Intronic
926784473 2:16506978-16507000 TTCCAGCTGCATCACGTTCTAGG - Intergenic
926976963 2:18525110-18525132 TTCCATCTGTAACACTGAGTTGG + Intergenic
929401649 2:41589509-41589531 TTCCGACTGAATCAGAGTGTGGG - Intergenic
929850001 2:45578016-45578038 TTCCAGCAGCATCACCATGTAGG + Intronic
930699427 2:54444633-54444655 TTCCTGCTGGATCACACTGCTGG - Intergenic
933526711 2:83450125-83450147 TTCCAACTATATGACATTGTAGG + Intergenic
936163414 2:110101458-110101480 CTCCCGCTGGATAACAGTGTTGG + Intronic
936822169 2:116535481-116535503 TTCCACCTGTACCACTGTTTAGG + Intergenic
938675110 2:133624846-133624868 TTACAGCTGTATCTCATAGTTGG - Intergenic
940616302 2:156053070-156053092 TTCCAACTATATCACATTCTGGG + Intergenic
941472290 2:165903031-165903053 GTCCAGATGTAAAACAGTGTAGG - Intronic
944097875 2:195990186-195990208 TTCTAGCAGTTTCACAGTTTTGG + Intronic
944900266 2:204206754-204206776 ATCCAGCTGTCTGACAGAGTGGG - Intergenic
945938987 2:215929680-215929702 TTCTAGCTGTGGCAGAGTGTGGG - Intergenic
946010057 2:216557408-216557430 TCCCAGCTGTCACACAATGTGGG + Intronic
948730533 2:239961080-239961102 CTCCAGCTGCATCACAGTGATGG - Exonic
1170200255 20:13735202-13735224 TTTCAGCTGTTTCAAACTGTTGG - Intronic
1171095209 20:22326285-22326307 TTCCTCATATATCACAGTGTGGG + Intergenic
1174391158 20:50219177-50219199 TTCCTGCTGCCACACAGTGTTGG + Intergenic
1174620525 20:51870917-51870939 TACCACCTATATCACAGTGGTGG - Intergenic
1175353509 20:58343769-58343791 GTCCAGCTGTATCCCAGATTAGG - Exonic
1178943563 21:36927423-36927445 TTCCAGTTATATCACAGTAACGG + Intronic
1179101331 21:38357670-38357692 TTTCAGCTGTATAACTCTGTGGG - Intergenic
1181329680 22:22080161-22080183 TTCAGGCTGTAGCACAGTGATGG - Intergenic
1181580943 22:23827757-23827779 TTGCAGCTGTCTTCCAGTGTGGG - Intronic
1181919523 22:26309873-26309895 TTGCACCTATATCAGAGTGTGGG - Intronic
949802261 3:7916644-7916666 TTCCATCTTTTTTACAGTGTAGG - Intergenic
949938080 3:9132482-9132504 TTCCAGCTGTATAACATGCTGGG - Intronic
951717934 3:25668383-25668405 TCCCAACTGAATCTCAGTGTTGG - Intergenic
952319471 3:32262492-32262514 TTCTACCTGGATCACTGTGTTGG + Intronic
955863374 3:63355880-63355902 TTACAGCTGTAACCCTGTGTTGG + Intronic
958768045 3:98394872-98394894 TTTTGGCTGTTTCACAGTGTAGG - Intergenic
959006695 3:101027560-101027582 TTCCATCTGGTTCACAGTATAGG + Intergenic
960115276 3:113886268-113886290 TTCCACCTGTGTCCCAGTCTGGG - Intronic
960166554 3:114409292-114409314 TTCCACCTGTAGCTAAGTGTAGG - Intronic
966837935 3:184063901-184063923 TTACAGGTGTTTCACAGTTTGGG + Intergenic
967268470 3:187713188-187713210 CACCACCTGCATCACAGTGTAGG - Intronic
969357155 4:6635443-6635465 TTCCAACTGTATGACATTCTAGG - Intergenic
970197823 4:13570367-13570389 TTCCAGCTCTACCACACTCTAGG + Intronic
971613748 4:28760573-28760595 TTCCAGTTGTCCCACAGTCTTGG - Intergenic
972056985 4:34815486-34815508 TTCCAGTTTTCTGACAGTGTGGG - Intergenic
972474580 4:39438378-39438400 TTCTTGCTGTTTCACAGAGTTGG + Intronic
972643141 4:40943498-40943520 TTCCCCCTGTACCACAGTGGGGG - Intronic
975024215 4:69529519-69529541 TTCCAGCTTGCTCACAGTGGGGG - Intergenic
976702449 4:87985857-87985879 CTCCAGCAGTATCACAGAGCAGG + Intergenic
977404114 4:96574568-96574590 TTCCAAATGAAACACAGTGTGGG + Intergenic
979453596 4:120901541-120901563 TTCCAGATGTAACACAATGTGGG - Intronic
981515700 4:145607090-145607112 TTCCAGCTGTATGGCAGGCTGGG - Intergenic
981924015 4:150117747-150117769 TTCCACCTGGCTCATAGTGTAGG + Intronic
986104424 5:4646081-4646103 ATCCCTCTGTATCACAGTGGAGG - Intergenic
987782131 5:22452601-22452623 TTCTAGCAGTTTCACAGTTTTGG - Intronic
988354817 5:30160545-30160567 TCCCATCTGTTCCACAGTGTAGG - Intergenic
988388940 5:30602311-30602333 CACCAGCTGCATCTCAGTGTTGG + Intergenic
989000693 5:36757247-36757269 TTCCTGCTGTCTCATAGTTTCGG + Intergenic
990278109 5:54221092-54221114 TTCAATCTGTATCACAGTTTGGG + Intronic
991582700 5:68173366-68173388 TTCCAGTTGTATTACAGTGCTGG + Intergenic
992136772 5:73753581-73753603 TTCCAGGTGTTTCACAGAGTTGG - Intronic
994656620 5:102602193-102602215 TTCCAGCTGGAACACAGACTTGG - Intergenic
996437350 5:123449501-123449523 TGACAGCTGTAACACACTGTTGG + Intergenic
996498438 5:124188686-124188708 GACCAGCTGTCTCACAGTCTAGG + Intergenic
1000533648 5:162454234-162454256 TTCTAGCAGTTTCACAGTTTTGG - Intergenic
1002936080 6:1673760-1673782 TTCCAGCTATATGACATTCTGGG - Intronic
1003126095 6:3356897-3356919 CACCACCTGCATCACAGTGTCGG - Intronic
1004089409 6:12485377-12485399 TTCCATCGTTATTACAGTGTTGG - Intergenic
1006692591 6:35902336-35902358 TTACAGCTGCATCACACTGCTGG - Intronic
1008813720 6:55537662-55537684 TGCCTGCAGTATCAGAGTGTTGG - Intronic
1010004918 6:70985369-70985391 TTCCAGTTGTTTAAAAGTGTGGG - Intergenic
1010253811 6:73735363-73735385 TTTCAGATGGATCACACTGTTGG + Intronic
1012345177 6:98176893-98176915 TTCCAGCTTTTTCCCAATGTTGG - Intergenic
1013439748 6:110151244-110151266 TTCCAGCTGTTTGACATTCTTGG + Intronic
1019951623 7:4377754-4377776 TTGCAGCTGTGGCTCAGTGTGGG - Intergenic
1020450609 7:8316574-8316596 TTCCATCTGGTTCACAGTGTAGG + Intergenic
1022444355 7:30457616-30457638 TTCCATCTCTATCCCAGTATAGG - Intronic
1028331910 7:89605268-89605290 TTCCAGCTGCAGCACAGAGTGGG + Intergenic
1028804722 7:95012011-95012033 TACCAGCTTTATCATATTGTTGG - Intronic
1029376710 7:100181759-100181781 TTACAGGTGTTTCACCGTGTTGG - Intronic
1029924350 7:104299870-104299892 TTCCAGTTGTACAAGAGTGTGGG - Intergenic
1030697899 7:112606025-112606047 TGCCAGATGTATAACAATGTGGG + Intergenic
1032204819 7:129853155-129853177 TTAAAGCTGTATCGCAGTGAAGG + Intronic
1035063656 7:156089702-156089724 TTCAAGCTGTGTCACTGTGTTGG - Intergenic
1036544924 8:9758698-9758720 TTCAAGCTCTCTCACAGTGTTGG + Intronic
1036918405 8:12828042-12828064 TTCCAGCTGTGTAACAGTGTGGG + Intergenic
1037297407 8:17415368-17415390 TTCCAGCAGTTTCACAGTTTTGG - Intergenic
1037315684 8:17596948-17596970 TTCCAGGGCTATGACAGTGTTGG + Intronic
1038448053 8:27617533-27617555 TTCCAGCTGTATCAGACTGCTGG - Intergenic
1039580169 8:38659276-38659298 TTCCAACTTGATCACAGTATAGG - Intergenic
1040102387 8:43517162-43517184 TTCCAGCTTTGTCACAGCCTGGG - Intergenic
1041449671 8:57994204-57994226 ATCCAGCGGTATCACCGGGTGGG + Intergenic
1045410824 8:101916220-101916242 TTCCAGATGTATCAAAGTTTAGG + Intronic
1049510982 8:143026552-143026574 TTCCTGGTACATCACAGTGTTGG + Intergenic
1050148156 9:2591916-2591938 TTTCAGATGTATCAAAGTCTGGG - Intergenic
1055606989 9:77980794-77980816 TTACATATGTATCAAAGTGTGGG - Intronic
1055981451 9:82006595-82006617 TCTGAACTGTATCACAGTGTTGG + Intergenic
1056399545 9:86213182-86213204 TTCCAGCTCTAACACTGTGAGGG - Intergenic
1058120650 9:101135091-101135113 TTGCAACTGCATCACAGTGTGGG + Intronic
1058383153 9:104401800-104401822 CTCCAGCTGAATCTCAGTGTTGG + Intergenic
1059549867 9:115218053-115218075 TTCCAGCTCTGCCACAGTGCTGG + Intronic
1062636017 9:137492399-137492421 TTCAAACTGTATCTCAATGTGGG - Intronic
1062685602 9:137811405-137811427 TTCCTGCTGGCTCACAGTGCTGG - Intronic
1186232418 X:7469983-7470005 TGCAAGCTGTAACACAGTTTTGG + Intergenic
1186517196 X:10174724-10174746 GTCCAGCTATATGGCAGTGTAGG - Intronic
1189588778 X:42489711-42489733 TTCCAGCTCTATCATTGTGTGGG - Intergenic
1189994005 X:46621544-46621566 TACCACCTGGAGCACAGTGTAGG - Intronic
1192981518 X:76349718-76349740 TTTCACCTGTCTCACAGAGTAGG - Intergenic
1193308415 X:79976246-79976268 TTCTACCTGTCTCACAGTGTAGG + Intergenic
1193585173 X:83311988-83312010 ATCCAGCACAATCACAGTGTTGG + Intergenic
1196748236 X:119090854-119090876 TTCCATCTGGTTCACAGTGTAGG - Intronic
1197110091 X:122762840-122762862 TTCCAGCAGACCCACAGTGTGGG - Intergenic
1198512051 X:137361937-137361959 GTACAGCTATACCACAGTGTTGG + Intergenic
1200703491 Y:6421975-6421997 TTCCAGCTGTATCAGTGGTTTGG + Intergenic
1201030620 Y:9742732-9742754 TTCCAGCTGTATCAGTGGTTTGG - Intergenic