ID: 1081258626

View in Genome Browser
Species Human (GRCh38)
Location 11:40930125-40930147
Sequence ACTACCTTCTGGACTAGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081258626_1081258634 30 Left 1081258626 11:40930125-40930147 CCACTTCTAGTCCAGAAGGTAGT 0: 1
1: 0
2: 0
3: 12
4: 110
Right 1081258634 11:40930178-40930200 CTGCATGTTTCATGGCTAGAAGG 0: 1
1: 0
2: 2
3: 10
4: 134
1081258626_1081258632 -3 Left 1081258626 11:40930125-40930147 CCACTTCTAGTCCAGAAGGTAGT 0: 1
1: 0
2: 0
3: 12
4: 110
Right 1081258632 11:40930145-40930167 AGTAGGGGAGGAAGCTGTTCAGG 0: 1
1: 0
2: 1
3: 23
4: 216
1081258626_1081258633 22 Left 1081258626 11:40930125-40930147 CCACTTCTAGTCCAGAAGGTAGT 0: 1
1: 0
2: 0
3: 12
4: 110
Right 1081258633 11:40930170-40930192 AGCAGTGTCTGCATGTTTCATGG 0: 1
1: 0
2: 2
3: 16
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081258626 Original CRISPR ACTACCTTCTGGACTAGAAG TGG (reversed) Intronic
900366122 1:2312643-2312665 ACTTCCTTCTGGCCAGGAAGAGG + Intergenic
908109502 1:60881369-60881391 AAAACTTTCTGAACTAGAAGAGG + Intronic
912687733 1:111780102-111780124 ACTACCTTTTGGATCTGAAGGGG + Intronic
913162705 1:116159485-116159507 ACTGCTTTCTGGACCAGCAGAGG + Intergenic
920898766 1:210085400-210085422 AATACATTGTTGACTAGAAGTGG + Intronic
921331078 1:214036998-214037020 ACTAGCTTCTGAATTGGAAGAGG - Exonic
923968642 1:239173739-239173761 ACTACCTTGTTGATTGGAAGTGG - Intergenic
1065388040 10:25153266-25153288 GATAACCTCTGGACTAGAAGTGG + Intergenic
1065653882 10:27925805-27925827 AGTACCTTCTTGAATAGTAGTGG - Intronic
1067910077 10:50337559-50337581 ACTACCTTTGGGAACAGAAGAGG + Intronic
1071614181 10:87059538-87059560 ACTAACTTCTGGTAGAGAAGAGG - Intronic
1073763618 10:106657583-106657605 AATACCTTTTGGAGTACAAGTGG - Intronic
1075863362 10:125696560-125696582 ACTACACTCAGGACAAGAAGGGG - Intergenic
1075879381 10:125837299-125837321 ACTACTTGCTGGAATAGTAGTGG + Intronic
1076537740 10:131192984-131193006 AATAGCTTCTGGAGTACAAGTGG - Intronic
1080437133 11:32255418-32255440 ACCACCTTTTGGGGTAGAAGTGG + Intergenic
1081258626 11:40930125-40930147 ACTACCTTCTGGACTAGAAGTGG - Intronic
1082798049 11:57392711-57392733 ACTTCCTTCTGAATTAGCAGAGG - Intronic
1087661222 11:100990698-100990720 ACTACCTTCTGTTCCAGCAGAGG - Exonic
1087695740 11:101373878-101373900 ACTACCTTCTTGAATGCAAGTGG + Intergenic
1092325433 12:7526909-7526931 ACTACCTTTTGGAGGAGAAGAGG + Intergenic
1093227069 12:16497896-16497918 ACTATCATCTAGACTAGAACTGG - Intronic
1095895717 12:47278587-47278609 ACTACCCTCTGGGGAAGAAGAGG - Intergenic
1096031794 12:48423863-48423885 ACTACAGTCTTGAATAGAAGTGG + Intergenic
1097125788 12:56773887-56773909 ACTACCTTCTGCACTGGTACCGG + Exonic
1097134599 12:56841219-56841241 ACTACCTTCTGCGCTGGTAGTGG - Intergenic
1097148351 12:56957406-56957428 ACTACCTTCTGCACTGGTACCGG - Exonic
1097151978 12:56985904-56985926 ACTACCTTCTGCACTGGTACTGG - Intergenic
1097207363 12:57334088-57334110 ATGACCTTCTGGACTAGAGGAGG - Intronic
1102148164 12:110670137-110670159 ACTACCATCTGGGAGAGAAGGGG + Intronic
1103095914 12:118132245-118132267 CCAAGCTTCTGGCCTAGAAGAGG + Intronic
1103192910 12:119017624-119017646 AATATCTTGGGGACTAGAAGAGG + Intronic
1103762935 12:123264587-123264609 GCTACCTTCTGAAATAAAAGGGG - Intronic
1107742691 13:43468999-43469021 AGTACATTATTGACTAGAAGTGG + Intronic
1110051671 13:70909842-70909864 TATACTTTCTAGACTAGAAGTGG + Intergenic
1111811522 13:93097868-93097890 CCTACATCCTGTACTAGAAGTGG - Intergenic
1112048208 13:95618214-95618236 ACTCCCTTCTGTACTGTAAGCGG + Intronic
1124028427 15:25988149-25988171 ACAACATTCGGGGCTAGAAGTGG + Intergenic
1124949441 15:34303098-34303120 ACTATCTTCTTAACAAGAAGGGG + Intronic
1126950704 15:53877498-53877520 ACTTCCTCAGGGACTAGAAGAGG + Intergenic
1133087330 16:3375114-3375136 ACTACCTTTGGTGCTAGAAGTGG - Intronic
1134770663 16:16806247-16806269 TCAACCTTCTGGACTAGACCAGG + Intergenic
1135311846 16:21411304-21411326 ACTATCTTCTGGTCTCGAAATGG - Intronic
1135364795 16:21843756-21843778 ACTATCTTCTGGTCTCGAAATGG - Exonic
1135447045 16:22527581-22527603 ACTATCTTCTGGTCTCGAAATGG + Exonic
1135632557 16:24047564-24047586 ACTGCCTTAGGGACTAGAGGCGG - Intronic
1136151014 16:28349204-28349226 ACTATCTTCTGGTCTCGAAATGG - Exonic
1136167248 16:28463044-28463066 ACTATCTTCTGGTCTCGAAATGG - Exonic
1136195729 16:28651972-28651994 ACTATCTTCTGGTCTCGAAATGG + Exonic
1136212067 16:28766097-28766119 ACTATCTTCTGGTCTCGAAATGG + Exonic
1136256786 16:29046025-29046047 ACTATCTTCTGGTCTCGAAATGG + Exonic
1136308550 16:29390311-29390333 ACTATCTTCTGGTCTCGAAATGG - Exonic
1136321965 16:29491837-29491859 ACTATCTTCTGGTCTCGAAATGG - Exonic
1136436646 16:30231810-30231832 ACTATCTTCTGGTCTCGAAATGG - Exonic
1139856252 16:69982720-69982742 ACTATCTTCTGGTCTCGAAATGG - Intergenic
1140366478 16:74385357-74385379 ACTATCTTCTGGTCTCGAAATGG + Exonic
1144420745 17:15095821-15095843 TTTACCATCTGTACTAGAAGTGG + Intergenic
1152997064 18:417591-417613 CCTACCTTCTGGGCAGGAAGGGG + Intronic
1153416716 18:4853791-4853813 AATATCTTCTGGACCACAAGAGG + Intergenic
1156888913 18:42167194-42167216 ACTACCTACTGGAATGAAAGAGG + Intergenic
1158947641 18:62461219-62461241 ACTACATTCAGGACTAGCAGTGG + Intergenic
1159083113 18:63757843-63757865 ACTAGATTCTGGACTTGAAGGGG - Intronic
1159830945 18:73277964-73277986 ACTCTCTTCTGGACCACAAGGGG - Intergenic
1160183923 18:76660285-76660307 CCTACCTTCTGGAGGAGAAGAGG + Intergenic
1161249211 19:3271270-3271292 ACCAGCTTCTGGGCTGGAAGCGG - Intronic
928467270 2:31533680-31533702 ACTGCCTTCTGCACTGGAAATGG - Exonic
941485827 2:166081069-166081091 ATTACGTTCTGGACTTGAGGAGG + Intronic
943469595 2:188276843-188276865 ACTAATTTCTGAACTAAAAGTGG + Intergenic
944638049 2:201693835-201693857 ATTACTTTCTGGTCTAGAAAAGG + Intronic
945561511 2:211346342-211346364 ACTACCTTCTAGAATGGCAGAGG + Intergenic
945672955 2:212824036-212824058 ACTACCTTTTGGAAGGGAAGGGG + Intergenic
946536197 2:220631752-220631774 GATACCTTCTGGACTAGCACAGG - Intergenic
948364920 2:237448591-237448613 AATACTTTCTGGATTAGATGTGG - Intergenic
948620082 2:239228778-239228800 ACTACCTTGTTCACTAGATGTGG - Intronic
1173038767 20:39439861-39439883 ACTACCTTCAGGAATAAGAGGGG - Intergenic
1174246995 20:49188602-49188624 GCTGCCTGCTGGACTCGAAGCGG + Intergenic
1177044603 21:16153455-16153477 ACTGCCTTCTGGAATTGTAGCGG + Intergenic
1177052268 21:16251340-16251362 AGTACCATTTGGACTAGAATTGG + Intergenic
1178666633 21:34553042-34553064 ACTACCTTCTAGACCATAAATGG + Intronic
1180660139 22:17460097-17460119 ACTGCCTTCTGGGCTGGAAGAGG - Intronic
953189774 3:40674086-40674108 AGTACCATGTGGAATAGAAGTGG - Intergenic
953318269 3:41948882-41948904 TATACCTTCTTGACTAGAAGTGG - Intronic
953833203 3:46320679-46320701 ACTACCATGTTGAATAGAAGTGG + Intergenic
956280786 3:67554557-67554579 ATTTCCTTCTTGTCTAGAAGGGG + Intronic
963253338 3:143121028-143121050 TCAACCTCCTGGACTACAAGTGG + Exonic
969184262 4:5463800-5463822 ACTGCCTTGTGGACAAGGAGAGG - Intronic
972980407 4:44692931-44692953 ACTACTTTCTGAATTATAAGTGG + Intronic
973661750 4:53114556-53114578 ACTTCCTTCTGGACTCCAAGAGG - Intronic
976126313 4:81837096-81837118 GCAATGTTCTGGACTAGAAGGGG + Intronic
977314541 4:95429137-95429159 GCTACCTAATGAACTAGAAGAGG - Intronic
977502651 4:97860804-97860826 ACTACTATGTGGAATAGAAGTGG + Intronic
980142232 4:128932578-128932600 AGTACCATATGGAATAGAAGTGG - Intronic
981024167 4:140059623-140059645 ACTATCTTCTGGCCTAGATGTGG - Intronic
986599218 5:9454764-9454786 ACTACCTTTTGGAATGGAATTGG + Intronic
987118111 5:14742421-14742443 AGTCCCATCTGGGCTAGAAGTGG - Intronic
989056814 5:37373828-37373850 ACTATCTTATGTACTGGAAGAGG + Intergenic
996259255 5:121445849-121445871 ACTTCCTTCTGCTCTAGGAGAGG + Intergenic
999388728 5:151174506-151174528 ATTTCCTTCTGGACTGGCAGAGG - Intergenic
1002456913 5:179350513-179350535 TCTCCCTTCTGGAGGAGAAGTGG - Intergenic
1006900118 6:37494490-37494512 TCCACCTTCTGGAGTAGAGGTGG - Intronic
1007952122 6:45881807-45881829 ACAACCTTCTGCACTTGAAGAGG - Intergenic
1015861030 6:137680028-137680050 ACTGGCTTCTGGACTGGAAAGGG + Intergenic
1017866691 6:158450160-158450182 ACTGGCTTCTTGATTAGAAGTGG + Intronic
1018384342 6:163289677-163289699 ACTCCCTCCTGGACTAGTACAGG - Intronic
1021080176 7:16355204-16355226 ACTACCTTCTTAACTAAAAATGG + Intronic
1022215177 7:28252634-28252656 ATTACCTTGGGGACTAGAAAAGG + Intergenic
1030666933 7:112288771-112288793 ACAACCATCTCCACTAGAAGAGG + Intronic
1032651255 7:133881061-133881083 ATTATCTTCTGTACTTGAAGTGG + Intronic
1034329436 7:150269712-150269734 TCTACCCTCTGGAATAAAAGGGG + Intronic
1034668620 7:152840149-152840171 TCTACCCTCTGGAATAAAAGGGG - Intronic
1042222732 8:66489512-66489534 AGTACCTACTGCAATAGAAGTGG - Intronic
1047298095 8:123588901-123588923 ACAACCTTCTCACCTAGAAGAGG + Intergenic
1052048135 9:23819050-23819072 ACTTGCTTCTAGAATAGAAGTGG + Intronic
1052923219 9:33990096-33990118 ACTACATTCTTGACTATAAGTGG + Intronic
1054897757 9:70333037-70333059 AGTACAATGTGGACTAGAAGTGG - Intronic
1058495977 9:105559341-105559363 ACTTTCTTCTGGACTGGGAGAGG + Intronic
1186283983 X:8024484-8024506 TCTTCCTTCTGATCTAGAAGTGG + Intergenic
1187642334 X:21307719-21307741 GGTACCTTCTGCCCTAGAAGTGG - Intergenic
1188575183 X:31640472-31640494 ACTAGAGTTTGGACTAGAAGGGG + Intronic
1192176596 X:68890082-68890104 TCTTCCTTCTGGACAAGACGAGG - Intergenic
1192336287 X:70223004-70223026 ACTACCTTTTGGGCTAGATGAGG - Intergenic
1198629731 X:138622565-138622587 AGTACCATGTGGAATAGAAGTGG - Intergenic
1200755138 Y:6984098-6984120 ACTACCTTATGGCCCAGAACTGG + Intronic