ID: 1081258626

View in Genome Browser
Species Human (GRCh38)
Location 11:40930125-40930147
Sequence ACTACCTTCTGGACTAGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081258626_1081258633 22 Left 1081258626 11:40930125-40930147 CCACTTCTAGTCCAGAAGGTAGT 0: 1
1: 0
2: 0
3: 12
4: 110
Right 1081258633 11:40930170-40930192 AGCAGTGTCTGCATGTTTCATGG 0: 1
1: 0
2: 2
3: 16
4: 202
1081258626_1081258632 -3 Left 1081258626 11:40930125-40930147 CCACTTCTAGTCCAGAAGGTAGT 0: 1
1: 0
2: 0
3: 12
4: 110
Right 1081258632 11:40930145-40930167 AGTAGGGGAGGAAGCTGTTCAGG 0: 1
1: 0
2: 1
3: 23
4: 216
1081258626_1081258634 30 Left 1081258626 11:40930125-40930147 CCACTTCTAGTCCAGAAGGTAGT 0: 1
1: 0
2: 0
3: 12
4: 110
Right 1081258634 11:40930178-40930200 CTGCATGTTTCATGGCTAGAAGG 0: 1
1: 0
2: 2
3: 10
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081258626 Original CRISPR ACTACCTTCTGGACTAGAAG TGG (reversed) Intronic