ID: 1081260682

View in Genome Browser
Species Human (GRCh38)
Location 11:40956537-40956559
Sequence GGGGATAATATTACCTTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 174}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081260682 Original CRISPR GGGGATAATATTACCTTTCT AGG Intronic
902588488 1:17456590-17456612 GGCTAAAATATTTCCTTTCTAGG + Intergenic
902648655 1:17822235-17822257 GGGGGTAAGATTACTTTCCTAGG - Intronic
904067167 1:27762241-27762263 GGGGATAGATTTACATTTCTAGG + Intronic
905721054 1:40202064-40202086 GGGGATAATAATACTTGCCTTGG + Intronic
907721859 1:56979638-56979660 GGGGATAATGCTATCTTTCTGGG + Intergenic
910655797 1:89616643-89616665 GGGGAAAAGACAACCTTTCTTGG + Intergenic
912488414 1:110047321-110047343 AGGAATAATAATACCTTTATAGG + Intronic
912974499 1:114315647-114315669 GGGGATAATAATGCTTTTCTAGG - Intergenic
914672089 1:149878496-149878518 GGGGGTAATATTTACTTTTTTGG + Intronic
916954266 1:169815408-169815430 GGGTAGATTATTCCCTTTCTGGG + Intronic
917123545 1:171665422-171665444 GGGAATCTTATTACCTTTCCAGG - Intergenic
917478488 1:175389360-175389382 AGGGAAAAAGTTACCTTTCTAGG - Intronic
918203603 1:182289788-182289810 TGGGAAAATACTACCTTTCTAGG + Intergenic
918709322 1:187706939-187706961 GGTGATATCATTACCTTTCAGGG - Intergenic
921278093 1:213538947-213538969 GGGGATAATAATATCTGTCCTGG - Intergenic
921569224 1:216758928-216758950 GGGGATAATAATACCTTCTTAGG - Intronic
923515337 1:234693107-234693129 GGGAATGATATTATCATTCTTGG - Intergenic
923643827 1:235794544-235794566 GGAGATAATATTTATTTTCTAGG - Intronic
924536841 1:244942461-244942483 GGGCCTAATATTTCCTTTCAAGG + Intergenic
1064013562 10:11755600-11755622 GGGAGTTAAATTACCTTTCTAGG - Exonic
1064838621 10:19563502-19563524 GAGGACAATATGACATTTCTTGG - Intronic
1068744077 10:60509693-60509715 GGGAATAATATTCACTATCTTGG - Intronic
1071583495 10:86795935-86795957 GGGGAAAAAAATAACTTTCTTGG + Intronic
1071870105 10:89784628-89784650 AGAGAAAATATTACCTTTTTCGG - Intergenic
1073759086 10:106611354-106611376 GTGGATAATAATTCCTTTTTGGG + Intronic
1073985198 10:109200297-109200319 GTTGATAATAATTCCTTTCTTGG - Intergenic
1075613886 10:123876857-123876879 GGGAATAATATTAACCTTATAGG - Intronic
1076382015 10:130030002-130030024 TGGGAATATATTACCTTTCATGG - Intergenic
1077795760 11:5489870-5489892 GAGAATATTATCACCTTTCTGGG - Intronic
1078081325 11:8206627-8206649 GGGCTTAATAGAACCTTTCTTGG - Intergenic
1078211865 11:9276341-9276363 GGGAATTATATTACCTTTTATGG - Intergenic
1079493917 11:21019521-21019543 GGGGGCAATTTTACCTTTCAGGG + Intronic
1080918900 11:36688851-36688873 GGTGATAATACAACCTATCTGGG + Intergenic
1081260682 11:40956537-40956559 GGGGATAATATTACCTTTCTAGG + Intronic
1081648670 11:44808171-44808193 GGGAATAATATCACTTTCCTGGG - Intronic
1083427944 11:62598712-62598734 AGGGAAAATATTTCCTATCTTGG + Intronic
1083562840 11:63687285-63687307 TGGGATAATAGTATCTATCTTGG + Intronic
1083693780 11:64428974-64428996 GGGGATGATTTTACCTCCCTGGG + Intergenic
1084292351 11:68182226-68182248 GTGGATAAAAATACCTTACTAGG - Intronic
1084971847 11:72776409-72776431 GGGGGTCATTTCACCTTTCTGGG - Intronic
1086793475 11:91070555-91070577 GGGGATAATTTGACCTATCCAGG - Intergenic
1088341759 11:108776577-108776599 GGGAATAATATTATATTTATTGG - Intronic
1090960048 11:131548100-131548122 AGGGATAATAATACTTCTCTGGG + Intronic
1091153800 11:133354432-133354454 GGGGATAATATCTCCTTTATAGG - Intronic
1091441982 12:518039-518061 GGGGAGAATAGTACCTTACAGGG + Intronic
1093727069 12:22526364-22526386 GGGGATGATACTACCTTATTGGG - Intronic
1094324230 12:29219207-29219229 GGTAATAATAGTACCTATCTGGG - Intronic
1094430990 12:30368947-30368969 GGGGATTAGATTGCCTTTGTAGG - Intergenic
1095267724 12:40179992-40180014 GGGGATTAGATTGCCTTTGTAGG + Intergenic
1095407364 12:41881565-41881587 GGAGATAATAATACCTGCCTTGG - Intergenic
1098032373 12:66267817-66267839 GAGAATAATATTAACTTTATAGG + Intergenic
1098196346 12:68005917-68005939 TGAGATAATATTCCATTTCTTGG - Intergenic
1098623409 12:72634126-72634148 GGGGATAATAATTCCTTACAGGG - Intronic
1098976524 12:76908125-76908147 GAGGATACTATTACCTTTAGAGG + Intergenic
1099612263 12:84888980-84889002 AGGGAGAAGATGACCTTTCTAGG - Intronic
1099702206 12:86100466-86100488 GGGGAAAATATTGTCTTTTTTGG - Intronic
1100044734 12:90365783-90365805 GGAGATAATATTACCATACATGG + Intergenic
1107151024 13:37111585-37111607 GGTGATGTTATTCCCTTTCTGGG + Intergenic
1107525651 13:41228704-41228726 CAGGGGAATATTACCTTTCTTGG - Intronic
1108070213 13:46620874-46620896 GGACATATCATTACCTTTCTTGG + Intronic
1109009147 13:56917507-56917529 AGGGAAAAAATGACCTTTCTAGG - Intergenic
1109305974 13:60642116-60642138 GGGAATAATATTCCCTCACTTGG - Intergenic
1109550589 13:63893687-63893709 TGAAATAATATTTCCTTTCTAGG + Intergenic
1110518769 13:76448965-76448987 GTGGAAAATATTAACTTTGTGGG - Intergenic
1112196123 13:97228167-97228189 GGGGATAGTATTAACTTTGTGGG - Intronic
1112275031 13:98009264-98009286 GGGGATAAGAATCACTTTCTAGG + Intronic
1112309637 13:98306965-98306987 GGGGACAATAATAGGTTTCTGGG - Intronic
1114359004 14:21949463-21949485 GGAGAGAAAATAACCTTTCTAGG + Intergenic
1115478518 14:33839416-33839438 GGGGATAACATTACCTGCCTGGG - Intergenic
1116237843 14:42303518-42303540 GGGGTTAATATAATTTTTCTAGG + Intergenic
1117248798 14:53914784-53914806 TGGGATAATTTCACCTCTCTAGG - Intergenic
1118183093 14:63513058-63513080 GGGGGAAAAATTACCTTTTTTGG + Intronic
1119104456 14:71910991-71911013 AGGTATATTATTGCCTTTCTTGG + Intergenic
1120970617 14:90204105-90204127 GGGGATTAGATTGCCTTTGTAGG - Intergenic
1123797872 15:23791921-23791943 GGGGATTAAATTACATATCTAGG + Intergenic
1128687763 15:69699485-69699507 GTGGACAATACTTCCTTTCTAGG + Intergenic
1130833890 15:87630661-87630683 GGGGACAAGATTGCCTTTGTAGG + Intergenic
1131088484 15:89599222-89599244 GGGGAAAATATTTCCTTGCAGGG - Intronic
1132209702 15:100010904-100010926 GGGAATAATATTACTTTTCAGGG - Intronic
1133699327 16:8294558-8294580 AGGAATAATATTAATTTTCTGGG - Intergenic
1135008651 16:18852671-18852693 GGAGATAATATAATCTTACTTGG - Intronic
1135496409 16:22955468-22955490 GAGGATAATAATACCTTCCTCGG - Intergenic
1137442769 16:48510625-48510647 GGGAATAATACCACCTATCTTGG - Intergenic
1139334549 16:66222748-66222770 GAGGATTGTATTAGCTTTCTAGG - Intergenic
1141827659 16:86492505-86492527 GGGGATAATACCACCTGCCTTGG + Intergenic
1142495471 17:304280-304302 GGGAATAATAATACCTATCTCGG - Intronic
1143020599 17:3915501-3915523 AGGGATGATAGTTCCTTTCTGGG - Intronic
1149725049 17:58884751-58884773 GGGGATAATACTTCCTTTGTAGG + Intronic
1163226546 19:15965523-15965545 GGGTTTAAAATTACTTTTCTTGG + Intergenic
1164668673 19:30060903-30060925 GGGGATAATTTTTCTTTTCCTGG - Intergenic
1167216372 19:48168291-48168313 GGGGATGATCTCACCTGTCTTGG - Intronic
1168420291 19:56197534-56197556 AGGAATAATATTAACTTTCTCGG - Intronic
928097974 2:28416924-28416946 GGGAATTTAATTACCTTTCTGGG + Exonic
928200264 2:29243379-29243401 GGGGATAATAATACCTACCTTGG + Intronic
928523869 2:32119201-32119223 GACAATAATATTCCCTTTCTTGG - Intronic
928813485 2:35258434-35258456 TGGTAAAATCTTACCTTTCTTGG - Intergenic
932379324 2:71268049-71268071 GGGGATATGATAGCCTTTCTAGG + Intergenic
932488339 2:72101548-72101570 GGTGATAATATTTCCTTCTTGGG + Intergenic
933384180 2:81589252-81589274 GGGGATAATGATACCTTTGTGGG + Intergenic
935937283 2:108200434-108200456 GGGTATAACATTTCTTTTCTGGG + Intergenic
936090070 2:109495835-109495857 GGGGATAATAATACATGTCTGGG + Intronic
937858231 2:126688014-126688036 GGGGAAAATAACACTTTTCTGGG + Intronic
941299257 2:163780802-163780824 TGATATAATATTACTTTTCTAGG + Intergenic
941887592 2:170544839-170544861 GAGGAAAATATTTCCTTTGTCGG - Intronic
944226422 2:197353108-197353130 GCCAATAATATTACCTTTATGGG + Intergenic
944752633 2:202726732-202726754 GGGAATAATAATACCTGTCTCGG + Intronic
945201406 2:207285371-207285393 GGTTATAATATTACCCATCTTGG - Intergenic
945565992 2:211400199-211400221 GGGGATAATAATGCCTGTGTTGG + Intronic
947000013 2:225443228-225443250 GGGCAAATTATTACTTTTCTAGG + Intronic
1169022280 20:2339325-2339347 GGGTTTAATATTACTTTCCTTGG - Intronic
1170468776 20:16647608-16647630 GGGGTTATGATTACTTTTCTTGG + Intergenic
1174777675 20:53360688-53360710 GGGGATAATGCTACATTTTTGGG - Intronic
1174871784 20:54189753-54189775 GAGGATAATATTATTTTTCTTGG - Intergenic
1178113185 21:29390403-29390425 GCTTATAATAATACCTTTCTTGG - Intronic
1178741069 21:35201869-35201891 GGGGATAATTCTACCTTATTAGG - Intronic
1182031682 22:27163892-27163914 GAGGGTAGAATTACCTTTCTGGG - Intergenic
1182904613 22:33924353-33924375 GGATACAATATTTCCTTTCTTGG - Intergenic
1184087358 22:42272859-42272881 GGAGATAATATTATCTCACTGGG + Intronic
949903872 3:8842429-8842451 GGGGACAATAATACCTTACAAGG + Intronic
952734425 3:36674714-36674736 GGGGACTAGATTACCTTTCTAGG - Intergenic
953235821 3:41105096-41105118 GTGGATAATAATACCATTCTTGG - Intergenic
955946930 3:64204338-64204360 GGAGATAATATTTCCTTTCCTGG - Intronic
956973851 3:74557619-74557641 GGCGGAAATGTTACCTTTCTAGG - Intergenic
959141616 3:102492701-102492723 GGGGATAATAATAATTATCTTGG + Intergenic
962457462 3:135577908-135577930 GGGGAAAAAATTGCCTATCTCGG + Intergenic
963231539 3:142913240-142913262 GGGGAAATATTTACCTTTCTTGG - Intergenic
964396200 3:156248766-156248788 GGGGAAAATACTATCTTGCTGGG - Intronic
964760120 3:160127492-160127514 AGGGACAAAGTTACCTTTCTAGG + Intergenic
966757393 3:183384334-183384356 GGGGATTAGATTGCCTTTGTAGG + Intronic
967787382 3:193512325-193512347 AGGGATAAAATTTGCTTTCTGGG - Intronic
971441089 4:26686678-26686700 GGGGATACTATTGCCTCTGTGGG - Intronic
973689722 4:53414076-53414098 AGGGATAAAATTAACTTTTTTGG + Intronic
973739848 4:53909315-53909337 GGGGACAAGATTCCCTTTCTGGG - Intronic
976603081 4:86957193-86957215 GGGGATAACATTGTCTTTGTAGG + Intronic
978602219 4:110440565-110440587 GGTGATAATAGTACCTACCTCGG - Intronic
978792332 4:112675793-112675815 GGTGATAATGGTACCTTTCTTGG - Intergenic
979809910 4:125024387-125024409 GAGTATATTATTTCCTTTCTTGG + Intergenic
980267636 4:130539245-130539267 GAGCATAATGTTACCTTTCAGGG + Intergenic
980571475 4:134625731-134625753 GAGCATAATTTTACTTTTCTTGG + Intergenic
980989383 4:139725910-139725932 GGGGAAAACACTACCTTCCTCGG - Intronic
981892211 4:149752106-149752128 GTGGACAATATTTGCTTTCTTGG - Intergenic
982904420 4:161049691-161049713 GGGGACTAGATTACCTTTGTAGG + Intergenic
983545942 4:168964444-168964466 GGGGAGAAAAATACCTTTTTAGG - Intronic
983764831 4:171465516-171465538 GGAGAAAATATTTGCTTTCTTGG - Intergenic
987428134 5:17796685-17796707 GAGGGTAATATTAACATTCTGGG + Intergenic
987484020 5:18500846-18500868 GGGAATTATATTACCTTATTAGG + Intergenic
987609083 5:20178781-20178803 GGGGATATTTTTACCCTTCACGG + Intronic
991024707 5:62017106-62017128 GGGGATAAAATTTATTTTCTGGG - Intergenic
992125585 5:73636732-73636754 GTGGGTCATATCACCTTTCTCGG + Intronic
992217002 5:74536098-74536120 GGGGATTATTTTTCCTCTCTGGG + Intergenic
1001770730 5:174293940-174293962 GGTGAATATATTACCTTTCATGG + Intergenic
1005657474 6:27956281-27956303 GAGTATAATAATACCTTCCTGGG - Intergenic
1007311144 6:40946964-40946986 GGGGATCAGGTTGCCTTTCTTGG + Intergenic
1008118912 6:47587551-47587573 GGTAATATTATTACCATTCTGGG - Intronic
1009747858 6:67842628-67842650 GGGGTTACTATTACCATTTTGGG - Intergenic
1011026645 6:82876635-82876657 GGGGATAGTATTGACTTCCTAGG - Intergenic
1011653745 6:89531014-89531036 GGGGATAATAATGCCTGCCTCGG - Intronic
1011726788 6:90217889-90217911 GGGAAAAATAATACCTTACTTGG + Intronic
1011801894 6:91026311-91026333 TTGGAGAATATTACATTTCTTGG - Intergenic
1012321157 6:97847766-97847788 CAGGATAATATTACCTTCTTAGG - Intergenic
1019646826 7:2135093-2135115 GTGGCTAGTCTTACCTTTCTGGG - Intronic
1021208844 7:17818577-17818599 GGGGATTATATTACTTTTCAGGG - Intronic
1021459230 7:20866559-20866581 TGGAATAATAAGACCTTTCTAGG + Intergenic
1021765046 7:23940372-23940394 GGGGATATCATTACATTTTTAGG + Intergenic
1022380003 7:29850922-29850944 GGAAATAATAATACCTTTATGGG + Intronic
1022550300 7:31232421-31232443 GGGGATAATTAGACCTTTCTTGG + Intergenic
1023678786 7:42661427-42661449 GGCTATAAGATTAACTTTCTTGG - Intergenic
1025622129 7:63183058-63183080 GGTGATAATAGTACCTACCTTGG - Intergenic
1026496378 7:70907217-70907239 GGGGACTAGATTACCTTTGTAGG + Intergenic
1027869247 7:83685626-83685648 GGAGATAATTTTACCTCTCTGGG + Intergenic
1030628849 7:111873287-111873309 GGGAATAAATTTATCTTTCTTGG + Intronic
1031059375 7:117033047-117033069 GGGGATAATATTAACCTCATGGG + Intronic
1033627557 7:143125405-143125427 GGGGACAAGATTGCCTTTGTAGG + Intergenic
1033633144 7:143181340-143181362 GGGGATGAAATAACCTTTCTGGG - Intergenic
1035811588 8:2496029-2496051 GGGGATTAGATTGCCTTTATAGG - Intergenic
1035831949 8:2705201-2705223 AGGGATATAATTACCTTTCATGG + Intergenic
1037106943 8:15120356-15120378 GGGGAAAATACTACCTGTATAGG - Intronic
1037706320 8:21318075-21318097 GAGGATGATACTACCTTTCAGGG - Intergenic
1040517999 8:48150061-48150083 GGGTTTAATTTTACCTTTGTGGG - Intergenic
1040640253 8:49325591-49325613 GGGTCTAATATTTCCATTCTGGG - Intergenic
1041539364 8:58965678-58965700 GGGAAAAATCTTACATTTCTGGG + Intronic
1043762648 8:84087713-84087735 GATGATTATATTAGCTTTCTGGG + Intergenic
1043990506 8:86747378-86747400 GGGGAAAATATAACCTTAGTTGG - Intergenic
1044949561 8:97422305-97422327 GAGGCTAAGAATACCTTTCTGGG - Intergenic
1045991847 8:108316947-108316969 GGGGATTAGATTGCCTTTGTAGG + Intronic
1046997065 8:120535181-120535203 GGGGACAATATTAATATTCTAGG + Intronic
1048786889 8:138060223-138060245 GTGGATAATATTACCTTACAAGG + Intergenic
1051061574 9:13051493-13051515 GAGGCTAATAATACCTTCCTAGG + Intergenic
1052033844 9:23658037-23658059 GGGGATAACAATACCTAGCTTGG - Intergenic
1052101976 9:24458871-24458893 AAGGATAATAATACCTATCTAGG + Intergenic
1052344532 9:27396000-27396022 GGGGGTTATGTTACCTTTTTTGG + Intronic
1052399386 9:27981284-27981306 GGAGATAATATTATCTTACAAGG - Intronic
1053267419 9:36725306-36725328 GGGAATAATATTTCCTTCATAGG + Intergenic
1058264200 9:102877063-102877085 GAGGACAATTTTTCCTTTCTTGG - Intergenic
1061019227 9:128003321-128003343 GGGGATACTAGTACTTATCTGGG + Intergenic
1186704356 X:12126334-12126356 GAGGAGAATACTACATTTCTTGG + Intergenic
1193431973 X:81418901-81418923 GGGGTCAATATTGGCTTTCTGGG + Intergenic
1195521614 X:105836826-105836848 GGGGCTAATAATACCTACCTTGG + Intronic
1198496887 X:137202263-137202285 GGGGATAAGTTGATCTTTCTAGG + Intergenic
1199922707 X:152426105-152426127 GGAGAGAATCTGACCTTTCTTGG - Intronic
1202353728 Y:24023230-24023252 GGGTATCATAATACTTTTCTAGG + Intergenic
1202517051 Y:25646885-25646907 GGGTATCATAATACTTTTCTAGG - Intergenic