ID: 1081266211

View in Genome Browser
Species Human (GRCh38)
Location 11:41025496-41025518
Sequence TCATTTCTATAAAGGCCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 220}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081266209_1081266211 -5 Left 1081266209 11:41025478-41025500 CCAATGTTCTAATTGTCTTCATT 0: 1
1: 0
2: 1
3: 38
4: 490
Right 1081266211 11:41025496-41025518 TCATTTCTATAAAGGCCTGAAGG 0: 1
1: 0
2: 0
3: 13
4: 220
1081266207_1081266211 18 Left 1081266207 11:41025455-41025477 CCTAAATGAAAGACTAATCCAGA 0: 2
1: 0
2: 2
3: 40
4: 281
Right 1081266211 11:41025496-41025518 TCATTTCTATAAAGGCCTGAAGG 0: 1
1: 0
2: 0
3: 13
4: 220
1081266205_1081266211 29 Left 1081266205 11:41025444-41025466 CCACAACATTCCCTAAATGAAAG 0: 1
1: 0
2: 3
3: 26
4: 296
Right 1081266211 11:41025496-41025518 TCATTTCTATAAAGGCCTGAAGG 0: 1
1: 0
2: 0
3: 13
4: 220
1081266206_1081266211 19 Left 1081266206 11:41025454-41025476 CCCTAAATGAAAGACTAATCCAG 0: 2
1: 0
2: 17
3: 168
4: 785
Right 1081266211 11:41025496-41025518 TCATTTCTATAAAGGCCTGAAGG 0: 1
1: 0
2: 0
3: 13
4: 220
1081266208_1081266211 0 Left 1081266208 11:41025473-41025495 CCAGACCAATGTTCTAATTGTCT 0: 1
1: 0
2: 1
3: 17
4: 206
Right 1081266211 11:41025496-41025518 TCATTTCTATAAAGGCCTGAAGG 0: 1
1: 0
2: 0
3: 13
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081266211 Original CRISPR TCATTTCTATAAAGGCCTGA AGG Intronic