ID: 1081267391

View in Genome Browser
Species Human (GRCh38)
Location 11:41042532-41042554
Sequence GCACACTTCCTTGCCGCAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 51}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081267391 Original CRISPR GCACACTTCCTTGCCGCAAC TGG Intronic
901592151 1:10353544-10353566 GCACACTGCCTTCCCACCACAGG + Intronic
905242575 1:36590356-36590378 GTACACTGACTGGCCGCAACAGG - Intergenic
906293807 1:44636792-44636814 GCACACTCCTTTGTAGCAACTGG - Intronic
908391748 1:63689405-63689427 GCACAGTGCCTGGCCACAACAGG + Intergenic
908591324 1:65638596-65638618 GCTCACTTCATAGCCACAACTGG - Exonic
910631510 1:89360131-89360153 GCATTCTTCCTTGCTGCAGCAGG - Intergenic
911370585 1:96989939-96989961 GGACACTTCGTTGCCACCACTGG - Intergenic
911987730 1:104651454-104651476 GGATACTTCCTTGACGGAACTGG + Intergenic
1066515125 10:36150204-36150226 GCACACATCCTAGATGCAACAGG - Intergenic
1070606006 10:77898910-77898932 GCAAACCTCTTTGCCGCATCTGG - Intronic
1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG + Intronic
1078139081 11:8678914-8678936 GCACACTTGCCTGCCTCACCAGG + Intergenic
1081267391 11:41042532-41042554 GCACACTTCCTTGCCGCAACTGG + Intronic
1085715426 11:78868726-78868748 GCACACTTCCCTTCCAAAACTGG + Intronic
1098365285 12:69696716-69696738 ACATTCTTCCTTGCAGCAACAGG - Intronic
1107610766 13:42110661-42110683 GCACAAATCCTTCCCGTAACTGG - Intronic
1108162896 13:47661228-47661250 TCATACTTCCTTGCCCCCACTGG + Intergenic
1118395484 14:65332679-65332701 GCTCACTTCCTTGTAACAACAGG - Intergenic
1118837658 14:69487993-69488015 ACCCACTTCCTTCCTGCAACAGG + Intronic
1120063159 14:80009078-80009100 GCACACTTCCTTCTGGCAAGAGG + Intergenic
1125577147 15:40763878-40763900 GCACTCCACCTTCCCGCAACTGG + Intergenic
1127356077 15:58201295-58201317 TCACACTTCCTTCCCACAGCTGG - Intronic
1128941612 15:71792128-71792150 GCACATTTCCCTGCCCTAACAGG - Intergenic
1133441081 16:5821250-5821272 GCCCACTTCCCCGCCCCAACTGG - Intergenic
1135484710 16:22853891-22853913 GCACACTTATTGGCCTCAACAGG + Intronic
1149956272 17:61054314-61054336 GCACACTTTTTTTCCCCAACTGG - Intronic
1153284869 18:3448444-3448466 GCACAGTTCCTTCCCGGACCTGG - Intronic
1161362349 19:3857797-3857819 GCACAGTTCCTTCCAGCAACAGG - Intronic
1165381915 19:35487727-35487749 GGAAACTTCCTTTCCTCAACTGG - Exonic
926684944 2:15691181-15691203 GCACATTTCCTTGGCCCAGCAGG + Intronic
936428058 2:112436078-112436100 GCACACTTCCTTGCAAAATCCGG + Intergenic
936730105 2:115372603-115372625 GCACCCTTACTTGCGGTAACTGG + Intronic
1176374196 21:6079134-6079156 GCACACTTCCTTGCAAAATCCGG - Intergenic
1179749280 21:43459111-43459133 GCACACTTCCTTGCAAAATCCGG + Intergenic
1183270104 22:36856603-36856625 GCGCACTTCCCTGGCGGAACCGG - Intergenic
1184080221 22:42214096-42214118 GCACACTGCCTTGCCCACACTGG + Exonic
949665554 3:6334781-6334803 GCACACCTCCTTCCCGGACCAGG + Intergenic
952706414 3:36381672-36381694 GCAGTCTTCCTTGCCCCATCTGG - Intronic
955530804 3:59871189-59871211 ACACACTTCCTTGCCACTATAGG - Intronic
962786100 3:138769165-138769187 CCACACCTCCTTGCTGCAGCTGG + Intronic
965711477 3:171560067-171560089 CCCCACTTCCTTGCTGCATCTGG - Intergenic
978964702 4:114726099-114726121 GCACACCTCCCTGCTGCAGCTGG + Intergenic
985147794 4:186912106-186912128 GCCCCCTTCCTTGCCTCACCAGG + Intergenic
985773191 5:1825632-1825654 ACACGCTTCCTGGCCGCAAGCGG - Intergenic
1005032517 6:21524348-21524370 GCACACTGCCTTACAGCAACTGG - Intergenic
1010649812 6:78440073-78440095 GCACAGTTCCTTTCCTCAAATGG - Intergenic
1012888957 6:104877462-104877484 GCACATTTCCTTCCAGAAACAGG - Intergenic
1019191584 6:170254216-170254238 GCACACTTTCCTGCTGCCACAGG - Intergenic
1030291808 7:107880433-107880455 GGACACTACCTTGCCACCACTGG + Intergenic
1035025891 7:155825479-155825501 GCACACTTCCTTCCTGTACCAGG - Intergenic
1044725621 8:95192202-95192224 GCACTCTTTCTTGCTGCATCAGG + Intergenic
1058603011 9:106691416-106691438 CCACACTCCCTTGCCCCGACAGG - Intergenic
1062601626 9:137320990-137321012 GCACACTTCCTTGCCACCTGAGG + Intronic
1195289016 X:103413890-103413912 GCACACTGCTTGGCTGCAACAGG + Intergenic