ID: 1081267731

View in Genome Browser
Species Human (GRCh38)
Location 11:41047654-41047676
Sequence CAAGGAGTCATGAGCATTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081267731_1081267735 20 Left 1081267731 11:41047654-41047676 CCAGAAATGCTCATGACTCCTTG 0: 1
1: 0
2: 3
3: 11
4: 149
Right 1081267735 11:41047697-41047719 CAATTCCTGGTAATGCCTTTTGG 0: 1
1: 0
2: 1
3: 10
4: 159
1081267731_1081267733 7 Left 1081267731 11:41047654-41047676 CCAGAAATGCTCATGACTCCTTG 0: 1
1: 0
2: 3
3: 11
4: 149
Right 1081267733 11:41047684-41047706 CAGAATTAAAATCCAATTCCTGG 0: 1
1: 0
2: 2
3: 26
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081267731 Original CRISPR CAAGGAGTCATGAGCATTTC TGG (reversed) Intronic
902512566 1:16974415-16974437 CAAGGGGTCAGGAGCCTCTCAGG + Intergenic
907499202 1:54866061-54866083 CATTGAGTCATGACCATTTAGGG - Intronic
909354576 1:74693505-74693527 CAAGGGGTCAAGAGAATATCAGG - Intergenic
914955542 1:152158820-152158842 CAATGAGACTTGAGCATTGCTGG + Intronic
917788253 1:178482719-178482741 CAAGGAGAGATGAGTATTTCCGG - Intergenic
920303592 1:205004713-205004735 CAAGAACTCGTGAGCATCTCTGG + Intronic
921632432 1:217451957-217451979 CAGGGAGTTATGAGTAGTTCAGG + Intronic
923039366 1:230308803-230308825 AAAGGAGTCAACAGCCTTTCTGG - Intergenic
923786408 1:237072449-237072471 CAAGGAGACATGAGCTGGTCTGG + Intronic
924058285 1:240144895-240144917 CATGGAGTCATGAGTATATCAGG - Intronic
924082029 1:240408152-240408174 CAATGAATCATGAGTTTTTCGGG + Intronic
924744414 1:246818663-246818685 CAAGGGGTCAGGAGCCTCTCAGG - Intergenic
1063987949 10:11527211-11527233 CAATGAGGCATGAGAATATCTGG + Intronic
1065535784 10:26713619-26713641 CACGGGGTCCTGAGCTTTTCAGG - Intronic
1066405232 10:35112016-35112038 CAAGGAGTAATGAGGCCTTCAGG - Intergenic
1067580270 10:47440440-47440462 CCAGGAATCATGAGCACTTACGG + Intergenic
1069296459 10:66851242-66851264 CAAAGAGTGATGGGCATTTCTGG - Intronic
1070646810 10:78207433-78207455 CAAGGAGCCATGTCCCTTTCGGG + Intergenic
1070720415 10:78753042-78753064 CAAGGAGTGCTGAGCATGGCTGG - Intergenic
1071047961 10:81406806-81406828 CAAGGAGCCATCATAATTTCTGG + Intergenic
1072654995 10:97323661-97323683 CAAGGGGTTATGAGCAATCCAGG + Intergenic
1073720819 10:106169321-106169343 TAAGAAGTCATGAATATTTCAGG - Intergenic
1074714909 10:116209453-116209475 CAAGAAGTCATGGGCAGTTGGGG - Intronic
1074739365 10:116470068-116470090 CAAGGAGTCAAGGACAATTCTGG + Intronic
1076453285 10:130571831-130571853 TAAGAAGTGAGGAGCATTTCTGG - Intergenic
1076465541 10:130678937-130678959 CAAGGAGGCATGAGAATTAGTGG + Intergenic
1077032521 11:475746-475768 CAAGCAGTCATTAAAATTTCGGG - Intronic
1078616728 11:12872788-12872810 CAAGGGCTCCTGAGTATTTCAGG + Intronic
1079007216 11:16800475-16800497 CAGGCAGTCATCTGCATTTCTGG - Intronic
1081267731 11:41047654-41047676 CAAGGAGTCATGAGCATTTCTGG - Intronic
1081403831 11:42673427-42673449 CACGGAGTCAAGAGCATTAGAGG + Intergenic
1081708819 11:45203930-45203952 CAAGTAGTAAGGAGAATTTCAGG + Intronic
1082978140 11:59095529-59095551 TAAGGGGTCAAGGGCATTTCAGG + Intergenic
1087885424 11:103476123-103476145 TAAGGAGTCATGACAATTACAGG + Intronic
1088777366 11:113098797-113098819 GAAAGTTTCATGAGCATTTCAGG - Intronic
1088873594 11:113913918-113913940 CAAGAGGTCAAGAGCATGTCAGG - Intronic
1089175369 11:116545163-116545185 CAAGGAGGCAGGAGGATTTATGG + Intergenic
1090525567 11:127531171-127531193 TAAGAATTGATGAGCATTTCAGG + Intergenic
1091128640 11:133124694-133124716 CAAGGGTGCATGAGCCTTTCAGG - Intronic
1092388801 12:8056604-8056626 CAACGAGTAATCAGCATTTCTGG - Intergenic
1094871352 12:34600902-34600924 CAAGGAATCCTGGGCGTTTCTGG + Intergenic
1095273584 12:40252104-40252126 CAAGGAGTTTTGTGCATATCAGG + Intronic
1097246019 12:57608053-57608075 CAAAGAGTAATGTGCAATTCTGG + Intronic
1098106308 12:67071031-67071053 CAAGGAGTCTTGTTCATTTTAGG - Intergenic
1101330365 12:103752935-103752957 CATGGAGTAATGATTATTTCTGG + Intronic
1104211380 12:126691946-126691968 CAGGGAGTCATGCCCACTTCAGG - Intergenic
1104651297 12:130536298-130536320 CTGGGGGTCATGGGCATTTCAGG - Intronic
1105366979 13:19774361-19774383 CAAGCTGTCATGAACATTTTAGG - Intronic
1106453845 13:29909742-29909764 CAACCAGCCAGGAGCATTTCAGG + Intergenic
1107410338 13:40152318-40152340 CAAGGAGTCATGCTCACTTATGG + Intergenic
1107933242 13:45323812-45323834 CCAGATGTGATGAGCATTTCTGG - Intergenic
1109016364 13:57020510-57020532 CATGGTGCCATGAGCATCTCTGG + Intergenic
1110774518 13:79393057-79393079 CAAAGACTCATGAGTAATTCTGG + Intronic
1112102865 13:96209488-96209510 CAAGGAGTCATGAGAATAGGTGG + Intronic
1113773034 13:112923993-112924015 GAAGGACACATCAGCATTTCTGG - Intronic
1113792884 13:113039820-113039842 CCAGAAGTCACGTGCATTTCTGG + Intronic
1115823495 14:37237675-37237697 CAAGGTGGCATGATCATTTAAGG - Intronic
1121610221 14:95273566-95273588 CAAGCACTGATGAGCCTTTCAGG - Intronic
1124457260 15:29855448-29855470 CAATGTGTCATGATCATATCAGG - Intronic
1128795897 15:70466381-70466403 CAAGGAGGCCTGTGCATTTGAGG - Intergenic
1136140727 16:28286742-28286764 CAAGGAATCAAGAGCATCACAGG + Intergenic
1143518001 17:7429647-7429669 CAAGGAGGCTTGAGCCTTTGAGG - Intergenic
1143758922 17:9087241-9087263 CAAGGAGCCAGGAGCATTCTGGG + Intronic
1151368891 17:73634962-73634984 CAGGGAGTCACCCGCATTTCAGG + Intronic
1154259745 18:12820186-12820208 CAAATAGTCATGAGCATTTCTGG - Intronic
1157553804 18:48599540-48599562 CATGGTGTCATGAGCAATCCCGG + Intronic
1166395690 19:42438906-42438928 CATGGACTCATGAGTATTTATGG - Intronic
1166863297 19:45821829-45821851 CAGGGGGTCATGGGCATTTGTGG + Intronic
925889313 2:8420937-8420959 CAAGGAGTGAATAGAATTTCAGG - Intergenic
927154247 2:20212593-20212615 CAAGGCAGCATCAGCATTTCCGG + Intronic
927313962 2:21660729-21660751 CTTGGTGTCATGAGCATTTTTGG + Intergenic
928371734 2:30744880-30744902 CAAGGAGCCATCAGCGTCTCAGG - Intronic
930101185 2:47604627-47604649 CAGGGAATGATGAGCCTTTCTGG + Intergenic
933101313 2:78261702-78261724 CAACAAGTCATCAGCAGTTCTGG + Intergenic
935118807 2:100161709-100161731 CAAAGAGACCTGTGCATTTCTGG - Intergenic
936465251 2:112742591-112742613 CAAGAAGTGAGAAGCATTTCAGG + Exonic
938049329 2:128152899-128152921 CGAGTAGTAAGGAGCATTTCAGG + Exonic
939114060 2:138040476-138040498 TAAGGAATCTGGAGCATTTCTGG + Intergenic
939236266 2:139497816-139497838 CAAGGAGTGTTAAGAATTTCTGG - Intergenic
939533267 2:143391643-143391665 CACAGAGTCAAGAGCAGTTCAGG - Intronic
941470611 2:165881308-165881330 TAAGGAGTCATTAACATTTTAGG - Intronic
941584501 2:167340611-167340633 CAAGGTGACATGACCATTTTTGG - Intergenic
942600942 2:177640445-177640467 CACGAATTCATGAGAATTTCAGG - Intronic
942625120 2:177892632-177892654 CAAGGAGACATGCACCTTTCTGG + Intronic
943357883 2:186881213-186881235 GAAGGACTCTTTAGCATTTCTGG + Intergenic
945054368 2:205855345-205855367 CAATGGGTCAAGAGCATTTCTGG + Intergenic
946305536 2:218855090-218855112 CAGGGAGGGAAGAGCATTTCAGG - Intergenic
948875203 2:240822772-240822794 CAAGGAGTATGGTGCATTTCGGG + Intergenic
1169160324 20:3372175-3372197 AAAGGAGGCAAGAGCCTTTCTGG + Intronic
1173090030 20:39961744-39961766 CATGGAGTCATTAGCATTCTTGG + Intergenic
1173092714 20:39989145-39989167 CAAGGAGTCAATAGCATTTCAGG + Intergenic
1174515638 20:51090349-51090371 TAAAGAGCCATGAGCATGTCAGG + Intergenic
949917965 3:8979616-8979638 CATTGAGTGATGAGCATTTTTGG + Intergenic
950116249 3:10451973-10451995 CAAGGAGCCAAGTGCTTTTCTGG - Intronic
950377760 3:12585563-12585585 CTAGGGGTCATGTGGATTTCGGG + Intronic
951589037 3:24243489-24243511 GTTGGAGGCATGAGCATTTCAGG - Intronic
960053313 3:113258081-113258103 CAAGGATTCATTTCCATTTCAGG + Intronic
966872696 3:184301637-184301659 CATGGGGTCATGAGTATGTCAGG + Exonic
967329633 3:188277486-188277508 TAAAGAGTCATGAGACTTTCCGG - Intronic
968641123 4:1715588-1715610 CAAGGAGTGAGCAGCCTTTCCGG - Intergenic
968681039 4:1920022-1920044 TAAGGAGCCATGAGTAGTTCAGG + Intronic
969683467 4:8656142-8656164 TAATGAGTAATGAGCATTTATGG + Intergenic
969884638 4:10204447-10204469 CAAGGAGTCATCAGGAGATCTGG - Intergenic
970870726 4:20814030-20814052 CAAGAAGTCTTGAGGTTTTCTGG - Intronic
971848514 4:31950880-31950902 TAAGGATTCATGAGCATTCAAGG - Intergenic
975379283 4:73679637-73679659 CAAGGAGTTTATAGCATTTCAGG + Intergenic
979604945 4:122628093-122628115 CAAGGAGTCATGTTTAATTCAGG + Intergenic
981313187 4:143316422-143316444 CAAGTAGACAAGAGCAGTTCTGG + Intergenic
981576751 4:146213591-146213613 CACTGAGTCATGAGAAATTCTGG - Intergenic
986095491 5:4549850-4549872 CAAGGAGTCATGAAGCCTTCTGG + Intergenic
986956344 5:13155269-13155291 CAAGGAGTAATCAGGATTTAAGG - Intergenic
988589046 5:32533038-32533060 CAAGGAGGCTTTAGCATCTCAGG - Intronic
992014470 5:72561476-72561498 GAGTGAGTCATGAGGATTTCCGG - Intergenic
994758869 5:103828416-103828438 CAAGTATTAATGAGCATGTCAGG - Intergenic
996163169 5:120192318-120192340 CAAGGAGCCTTAAGCATTGCTGG + Intergenic
1001889328 5:175326153-175326175 CAAGGTCCCATGAGCAATTCTGG - Intergenic
1002675985 5:180913190-180913212 CAAAGACTCATCAGCATTTGAGG - Intronic
1004362496 6:14983656-14983678 AAAGGAGGCGTGAGCATTTGGGG + Intergenic
1004863746 6:19833997-19834019 TAAGGGGTTATCAGCATTTCCGG + Intergenic
1006615074 6:35320814-35320836 CATGGAGTCTTGATCTTTTCAGG - Intronic
1008182624 6:48351363-48351385 CAAGCAGTGATGGGCACTTCGGG + Intergenic
1014303296 6:119710639-119710661 CAAGGAGTCATCAGCACCACTGG - Intergenic
1017125834 6:151063927-151063949 CAGGAAGTTATGAGCATTTCTGG + Intronic
1017213175 6:151879537-151879559 CAATGAGTAAGGAGCATTTGAGG + Intronic
1017545874 6:155450367-155450389 CAGGGAGTCATGAGCAGTCTGGG - Intronic
1018030370 6:159836887-159836909 CAAGGGGCCATGGGGATTTCGGG - Intergenic
1021283839 7:18754426-18754448 CTGGGAGTCATGAGCATTTCTGG - Intronic
1021911625 7:25390868-25390890 CAAGGACTCAGGAGGCTTTCAGG - Intergenic
1028014872 7:85695708-85695730 GAAGTAGTCATGGGCATTTTTGG + Intergenic
1030320385 7:108161367-108161389 CACAGAATAATGAGCATTTCGGG + Intronic
1032314572 7:130823360-130823382 GATGGTGTCAAGAGCATTTCTGG - Intergenic
1032708673 7:134443891-134443913 CTAGGAGACCTGAGCATGTCAGG + Intronic
1033351693 7:140567362-140567384 CATGGACTCATGGTCATTTCAGG - Intronic
1035027466 7:155835489-155835511 AAAGGAGTTATGAGAATTCCAGG - Intergenic
1036395740 8:8369509-8369531 CAAGGAGTCAGGTGCCTTTCTGG + Intronic
1037516853 8:19640386-19640408 CAAGGAGTCTGGAGAATTTCAGG - Intronic
1039819416 8:41122872-41122894 AAAGGGGTCAGGAGCATGTCGGG - Intergenic
1045900379 8:107271955-107271977 CAAGTAGTCATGAGAATTAAAGG - Intronic
1045943454 8:107766435-107766457 CAATGAACCATGATCATTTCTGG + Intergenic
1046918263 8:119700125-119700147 GAGGCAATCATGAGCATTTCAGG + Intergenic
1047468592 8:125144502-125144524 CATGGACTCATGAGCTTATCCGG - Intronic
1048247726 8:132827091-132827113 CAGAGAGTCTTGAACATTTCCGG + Intronic
1048250211 8:132859521-132859543 CAAGAAGCCAAGAGCATTTAGGG - Intergenic
1050146897 9:2578175-2578197 CAAAAGGTCATGAGAATTTCAGG + Intergenic
1050756421 9:9009888-9009910 CAAGGAGTTATGAGAATTTTAGG + Intronic
1051064330 9:13083891-13083913 AAAGTAGTCATTGGCATTTCAGG - Intergenic
1055247885 9:74268750-74268772 CAAGTAGTCAAGAGCATGTGTGG + Intergenic
1056182108 9:84095013-84095035 AAAGTAGTTATGAGTATTTCTGG + Intergenic
1057059239 9:91988483-91988505 TAGGGAGTCATGAGCATTTGTGG + Intergenic
1057280928 9:93711076-93711098 CAGGCAGCCATGAGCAGTTCTGG + Intergenic
1058445645 9:105052567-105052589 GAAGGAGCCATGAGTATCTCAGG + Intergenic
1060638314 9:125217690-125217712 AAAGGAGTCCTGAGCATTTGAGG - Intronic
1185943560 X:4348567-4348589 CCAGGTGTAATGATCATTTCAGG + Intergenic
1186980294 X:14951350-14951372 CAAGCAGTCATGAGCAACCCAGG + Intergenic
1188528637 X:31113289-31113311 AAAGGAGTCAAGAGTATTTAAGG + Intronic
1192699777 X:73456383-73456405 CAAAGATTCATAAGCGTTTCTGG - Intergenic
1195365401 X:104119796-104119818 CAAGGACTTATGGGAATTTCTGG - Intronic
1195980244 X:110569586-110569608 GAAGGAGTCATGTGAATATCTGG + Intergenic
1197449599 X:126594996-126595018 CATGGTGCCAAGAGCATTTCTGG - Intergenic
1197922736 X:131612583-131612605 CCAGAGGTTATGAGCATTTCTGG - Intergenic
1198632022 X:138650686-138650708 CAAGGTGTAATGATCATATCAGG + Intronic
1199551700 X:149068318-149068340 CAAGGTGTCATGGGCATTATGGG + Intergenic
1199821960 X:151458358-151458380 TAAGGAGTCTTGACCTTTTCTGG + Intergenic
1199870438 X:151893630-151893652 CTAGGAGGCAGGAGCATTTGTGG + Intergenic