ID: 1081267956 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:41050107-41050129 |
| Sequence | GGGAGGCATCATAGTGAGAA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 232 | |||
| Summary | {0: 1, 1: 0, 2: 3, 3: 16, 4: 212} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1081267951_1081267956 | 27 | Left | 1081267951 | 11:41050057-41050079 | CCTCAGATAATAAATGCAAACAC | 0: 1 1: 0 2: 0 3: 30 4: 382 |
||
| Right | 1081267956 | 11:41050107-41050129 | GGGAGGCATCATAGTGAGAAGGG | 0: 1 1: 0 2: 3 3: 16 4: 212 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1081267956 | Original CRISPR | GGGAGGCATCATAGTGAGAA GGG | Intronic | ||