ID: 1081267956

View in Genome Browser
Species Human (GRCh38)
Location 11:41050107-41050129
Sequence GGGAGGCATCATAGTGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 212}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081267951_1081267956 27 Left 1081267951 11:41050057-41050079 CCTCAGATAATAAATGCAAACAC 0: 1
1: 0
2: 0
3: 30
4: 382
Right 1081267956 11:41050107-41050129 GGGAGGCATCATAGTGAGAAGGG 0: 1
1: 0
2: 3
3: 16
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081267956 Original CRISPR GGGAGGCATCATAGTGAGAA GGG Intronic