ID: 1081273712

View in Genome Browser
Species Human (GRCh38)
Location 11:41120667-41120689
Sequence CCTTTCCCCTTTCAGATCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 1, 2: 1, 3: 35, 4: 232}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081273709_1081273712 30 Left 1081273709 11:41120614-41120636 CCTAGTCTTTTCTGAAGCTACAG 0: 1
1: 0
2: 2
3: 11
4: 264
Right 1081273712 11:41120667-41120689 CCTTTCCCCTTTCAGATCTAAGG 0: 1
1: 1
2: 1
3: 35
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081273712 Original CRISPR CCTTTCCCCTTTCAGATCTA AGG Intronic
902164329 1:14557742-14557764 CAATTCACCTTTCAGATCTTGGG - Intergenic
903107462 1:21094978-21095000 CCTTTTACCATTGAGATCTAGGG + Intronic
903966852 1:27096062-27096084 CTCTTGCCCTTTCAGGTCTATGG + Intergenic
904213214 1:28899319-28899341 CCCTTCCCCTTCCTGATCTAGGG + Intronic
906181373 1:43822627-43822649 GCTTTCCCCTTGCAGCCCTAGGG - Intronic
906830973 1:49031494-49031516 CCAGTCCCTTTTCAGATATATGG - Intronic
907340393 1:53731282-53731304 CCTCTCCCCCTGCAGAACTAGGG - Intronic
908139966 1:61174117-61174139 CTTTTCCCCCTTCAGATGTGAGG + Intronic
908304234 1:62794633-62794655 AGTGTCCCCTTTCAGAGCTAAGG - Intronic
908410358 1:63858321-63858343 TCCTTTCCCTTTCAAATCTATGG + Intronic
909288990 1:73858358-73858380 CGTATCCACTTTCATATCTACGG + Intergenic
910308983 1:85801554-85801576 CCTTTACCATTTCAGGTCTAAGG + Intronic
912483129 1:110000430-110000452 CCTCACCCTTTCCAGATCTATGG + Intronic
912858050 1:113189425-113189447 CCTTTCTCCTTCCAAGTCTAAGG + Intergenic
913749796 1:121950427-121950449 AATTTCCCTTTTCAGATCTACGG + Intergenic
915044329 1:152999489-152999511 GCTTTCCTCTTTCATTTCTAGGG - Intergenic
916272460 1:162957889-162957911 CCTTTGCTCTTTCAGGCCTAAGG + Intergenic
916600714 1:166290713-166290735 CCCTTCCCCTTTCACATCCATGG - Intergenic
921411862 1:214844663-214844685 CCATTCCCCTTCCAGATCTGAGG + Intergenic
921577569 1:216854597-216854619 CCTTTCCACTTTCACTTCTTAGG + Intronic
923795516 1:237150957-237150979 CCTTTCTTCTTTTAGATCTCAGG + Intronic
1064698167 10:17988841-17988863 CCTTTTCCCTTTCACCCCTAAGG + Intronic
1064721866 10:18237050-18237072 CCTTTCGCCTTTGAGATCCCTGG - Intronic
1065816118 10:29484273-29484295 CTTTTGCACTTTCAGATCAATGG + Intronic
1065956784 10:30700623-30700645 CTTTTGCACTTTCAGATCAATGG - Intergenic
1065990450 10:31004342-31004364 CCTTTCCTCTTTTAGATGTCAGG + Intronic
1068507840 10:57925628-57925650 CCTTTATCCTTTGAGATCTACGG - Intergenic
1070460396 10:76662241-76662263 CCTTTCCCCCTTGACATATAAGG - Intergenic
1070647722 10:78213000-78213022 TCTTTCCACTTTCAGCTCTAAGG - Intergenic
1071798588 10:89032146-89032168 CCTTTCCCCATACTGATTTAGGG - Intergenic
1072901475 10:99411323-99411345 CTTTTCCACTTTCAGATCTTAGG - Intronic
1073094262 10:100970145-100970167 CCTTTCCTCTATTAGATCTTGGG - Intronic
1074049737 10:109870867-109870889 CCTTTGCCCGTTCAGCTTTATGG - Exonic
1075197723 10:120375480-120375502 ACTTCTCCCTTTCAGATCTTGGG + Intergenic
1075325211 10:121526187-121526209 TCTTTCCCTTTTCAGCTCTTTGG - Intronic
1075727279 10:124616999-124617021 CCTTGCACCTTCCAGCTCTAGGG + Intronic
1078224671 11:9381096-9381118 TCTTTTCCCTTTCAGTTTTAGGG + Intergenic
1078905948 11:15687965-15687987 CCTTTACCCCTTCAGACCTAGGG + Intergenic
1081133063 11:39404078-39404100 CCCTTCCTCTTTCAGATGAAAGG - Intergenic
1081273712 11:41120667-41120689 CCTTTCCCCTTTCAGATCTAAGG + Intronic
1082615312 11:55353206-55353228 CCTTTGCCCCTTCAGAACAAGGG - Intergenic
1084146681 11:67268708-67268730 CCTGTCCCCTTTCCCATCCATGG + Intronic
1084879006 11:72156252-72156274 AGTTTCTTCTTTCAGATCTATGG - Intergenic
1086447890 11:86887338-86887360 CATTTCCCATTTCACATCTTGGG - Intronic
1087105104 11:94400794-94400816 CCTTTCCTCTCTCAGTTCTCTGG - Intronic
1087534848 11:99430170-99430192 CCTTTCCCCTTTACCATCTTTGG - Intronic
1088486644 11:110347223-110347245 CCTCTCCCTTTTCTGTTCTAAGG - Intergenic
1090030452 11:123201705-123201727 CCTTTCCCCTCTCAGAGAAAGGG + Intergenic
1090371224 11:126254495-126254517 ATGTTCCCCTTTAAGATCTATGG - Intronic
1094715425 12:33009821-33009843 CTTTTCCCCTTTTATATTTATGG + Intergenic
1096059338 12:48683148-48683170 CCTTTCCCATTTAATAGCTATGG - Intergenic
1098305611 12:69099606-69099628 CTTCTCTCCTTTCAGATCTGTGG - Intergenic
1098360236 12:69647369-69647391 CGTTTCCCCTTTCAGAGCTTGGG - Intronic
1099685579 12:85884099-85884121 CCTTTCCCTTTTAAAAACTATGG + Intergenic
1102539565 12:113608867-113608889 CAATTCCCCTTTCTGACCTAGGG + Intergenic
1102999428 12:117374187-117374209 CCTTTTCCCTTTTACATCGAGGG - Intronic
1103229950 12:119320978-119321000 CCTTTGTCCCTTCAGGTCTAGGG + Intergenic
1104593650 12:130104630-130104652 CCAGTCCCCTTTGAGATCCAGGG + Intergenic
1105456608 13:20546895-20546917 CCTTTCCCCTTTTAAAACTTAGG + Intergenic
1106407467 13:29486448-29486470 CCTTTCTCCATTCAGATCAAAGG + Intronic
1106590100 13:31091535-31091557 CCTTTCCCCTTGCAGCACTGGGG - Intergenic
1107606086 13:42058685-42058707 CTTTTCCCCTTGCAGATAGATGG + Intronic
1107708325 13:43128667-43128689 CCATGCCCCTGTCAGCTCTAGGG + Intergenic
1108891430 13:55265390-55265412 GCTTTGCCCTTTCAGCTCTCTGG + Intergenic
1109890582 13:68607288-68607310 CTTTTACCCTTTCAGATCTCAGG + Intergenic
1110405203 13:75143331-75143353 CCTTTCCCCTCTCCCAACTAAGG - Intergenic
1112961934 13:105137299-105137321 TCTTTGCCCTTTCAGACCTGGGG - Intergenic
1113263146 13:108588609-108588631 ACTTACCCCTTTCAGAACTTAGG + Intergenic
1115517236 14:34198171-34198193 CCCTTGCCCTTTCAGCTCTAGGG - Intronic
1115945741 14:38658129-38658151 GCTTTCTCCTTACAGATCTAAGG + Intergenic
1116516871 14:45815192-45815214 CCTTTCCCCTTCTAGATATTAGG - Intergenic
1116671991 14:47854603-47854625 CATTTGCCCCTTCAGGTCTAGGG - Intergenic
1117184348 14:53225264-53225286 TCTTTTCACTTTCAGATGTAAGG + Intergenic
1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG + Intronic
1119790720 14:77347355-77347377 CCTGTCCCCGTTCAGTGCTAGGG + Intronic
1120747672 14:88166646-88166668 CCTTTTCCCTTTAAGACCTTGGG + Intergenic
1122402421 14:101475354-101475376 CTTTTCCCCTTGCAGCTGTAAGG - Intergenic
1122621398 14:103059507-103059529 CCTTTCCCCTTGCTCATCTCAGG - Intergenic
1122965167 14:105120251-105120273 CCTTTCCCCATTCAGAGGAAAGG + Intergenic
1123845320 15:24294642-24294664 CCTTACCCCTTTCAAATTTCAGG + Intergenic
1124204625 15:27706595-27706617 CCATTCCCCTTCCAGATCACAGG + Intergenic
1124867753 15:33509982-33510004 TCTTTCCCTTTTTAAATCTATGG + Intronic
1129298483 15:74612515-74612537 CCTGTGCCCTTTCAGAGCCAGGG - Intronic
1130969992 15:88724910-88724932 CCCTTCTCCTTTCAAATCTATGG - Intergenic
1133071902 16:3252230-3252252 CCTTTCCCCTCCCAGGTCTCAGG + Intronic
1134190757 16:12119548-12119570 CCTTTCCAGTTTTAGAACTATGG - Intronic
1134194779 16:12150984-12151006 CCTTTCCCCTGTCTGCTGTATGG + Intronic
1135749817 16:25048735-25048757 CCTTCCTCCTTTCAGGTCTGTGG - Intergenic
1139287134 16:65825775-65825797 CCTCTTCCCTTTCAGAGCTGTGG - Intergenic
1141917679 16:87111015-87111037 CCTTGCCCCTTCCAGATCCAGGG - Intronic
1143842488 17:9744087-9744109 CCCTTCCTCTTTGAGATCCAGGG - Intergenic
1149863318 17:60136518-60136540 CCTGGCTCCTTTCAGATCTGTGG - Intergenic
1150480917 17:65509667-65509689 CCTTGCTCATTTCAGATCTCAGG - Intergenic
1150668034 17:67163270-67163292 CCTTTCATCTTTCAAATCTGAGG + Intronic
1151032182 17:70754334-70754356 CCTTTACACATTCAGGTCTAGGG - Intergenic
1152058399 17:78050457-78050479 CATTTTTCCTTTCAGACCTAGGG - Exonic
1153095107 18:1392111-1392133 CCCTTGCCCCTTCAGACCTATGG - Intergenic
1156878803 18:42050286-42050308 CTTTTCCCCTTGGAGTTCTATGG + Intronic
1158129200 18:54133943-54133965 CCTTTCCACTTTCTGGTGTAGGG - Intergenic
1158554628 18:58465313-58465335 GCTTTCCCCCTGCAGAGCTAAGG + Intergenic
1159858015 18:73612876-73612898 CCTTTGTCCATTCACATCTAGGG - Intergenic
1161339552 19:3733738-3733760 CCTGGTCCCTTTCAGATCAACGG + Exonic
1162527447 19:11214642-11214664 CCTTTCCCCTTCCAGGACCAAGG - Exonic
1162940830 19:14007977-14007999 CTTTTCCCCTTGCTGTTCTAGGG - Intergenic
1163055922 19:14717717-14717739 CCTTACCCCTTTCACATCAATGG - Exonic
1163093087 19:15035059-15035081 CCTTTCTCCATTCAAATCTTGGG + Intergenic
1163807290 19:19406579-19406601 CCTTTCCCCTCTCTGATCTCCGG + Intronic
1164533164 19:29063343-29063365 CCTTAGCCCTTTCAGAACTCAGG + Intergenic
1165269821 19:34696555-34696577 CCTGGCCCCTTTCAGTTCTCAGG - Intergenic
1165272656 19:34724043-34724065 TCTTTAATCTTTCAGATCTAGGG - Intergenic
1165576467 19:36823848-36823870 CCTTTCCCCTTTCATCTATAGGG - Intronic
1166322737 19:42028686-42028708 CCTTTCTTCCTTCAGAACTAGGG + Intronic
1166802836 19:45468812-45468834 CCTTTTCCATCTCAGATCTAGGG - Intronic
1167773719 19:51541308-51541330 CCTATCCCCATTCAGATGTCAGG + Intergenic
1167834870 19:52060294-52060316 CCTTTCCCCTTTTACATACAGGG + Intronic
1168246146 19:55114010-55114032 CCTCTCCCCATTCAGACCCAGGG + Intronic
927386889 2:22544820-22544842 CCTTCCACCATTCAGATCTTTGG + Intergenic
928205630 2:29281278-29281300 CCTTTCCCCATCCAGAGCTGAGG - Intronic
928229228 2:29482046-29482068 CTTTTCCCATTTGAGATCTGTGG - Intronic
928400822 2:30977570-30977592 ACTTTCCCCTTTCAGGTGAAAGG - Intronic
929857329 2:45648259-45648281 CCTTTCTCCTTTCAAAATTAAGG - Intergenic
931411329 2:62034762-62034784 CCTTTGCCCTTTGATTTCTAAGG + Intronic
932256202 2:70289365-70289387 CTTTTCCTTTTTCAGATTTATGG - Exonic
933589315 2:84214497-84214519 TCTTTGCCCCTTCAGGTCTAGGG - Intergenic
933770716 2:85742221-85742243 ACCCTCCCCTTTCAGATCTGTGG + Intergenic
937023431 2:118678949-118678971 CATTTCCCCCTTCAGCACTAAGG - Intergenic
937614567 2:123906540-123906562 CATTTCCCCTTTTGGAACTAAGG + Intergenic
937850994 2:126635798-126635820 ACTTTCACCTTGCAGATTTATGG - Intergenic
938697905 2:133851195-133851217 CTTTTCCCCTTCCAGGCCTATGG - Intergenic
939664470 2:144933975-144933997 TCTTTCCGCTTTCAGTTTTAAGG + Intergenic
940840677 2:158577293-158577315 CCTTTCCACTTCCAGTTCTCGGG - Exonic
941099922 2:161284164-161284186 CCTTTGCCCTTTTAAGTCTACGG + Intergenic
941257214 2:163247218-163247240 CCTGTCTGCTTTCAGATCCAGGG - Intergenic
941843873 2:170114432-170114454 CCTTTCCCCTTTCCTTTCTGTGG - Intergenic
943538621 2:189183619-189183641 CCTTCCCTATTTCAGATCTTTGG - Intergenic
944276435 2:197843740-197843762 TCCTTCCCCTTTCAGATCTAGGG - Intronic
946353498 2:219170378-219170400 CCTCACCCCTTTCAGAACCAAGG + Intronic
947843693 2:233226731-233226753 CCCACCCCCCTTCAGATCTAAGG - Intronic
947990116 2:234480346-234480368 TCTTTCATCTTTCAGATCTTAGG - Intergenic
948185103 2:236014776-236014798 CCTCTCCCCTTTCTGCTCTCGGG + Intronic
1168859223 20:1033954-1033976 CCTTTGCCCTTTCAGCTCTGGGG + Intergenic
1169359587 20:4936868-4936890 CCTGTGCTCTTTCAGGTCTAAGG - Intronic
1169583750 20:7057517-7057539 CCTTTGTCCCTTCATATCTAGGG + Intergenic
1169843824 20:9968194-9968216 CCTGCATCCTTTCAGATCTATGG - Intergenic
1173093535 20:40001104-40001126 ACTTTTCCCTTTTAAATCTAAGG + Intergenic
1173183011 20:40818797-40818819 CATTTCTCCCTTCAGACCTAAGG - Intergenic
1173821276 20:46022003-46022025 CCATTCCCCTCTCAGGCCTAGGG - Intronic
1174582420 20:51581396-51581418 CCTTTCCCTTCTCAGAGTTAGGG + Intergenic
1174766705 20:53261211-53261233 CCTTTCTCCTCTCAGCTCTTAGG - Intronic
1176678995 21:9808179-9808201 TATTCGCCCTTTCAGATCTAGGG - Intergenic
1180712036 22:17845991-17846013 CATTTCCCCTTCCAGAGCTCTGG - Intronic
1182380699 22:29884432-29884454 ACCTTCCCCTTTCAGATTCAGGG + Intronic
1183056435 22:35309346-35309368 CCTGGCCTCTTTCAGTTCTAAGG - Intronic
1183652408 22:39165087-39165109 CCTTTGCCCTTTCATATAAAGGG + Intergenic
1183815441 22:40296265-40296287 TCTTTCCCATTTCTGATCTGAGG - Intronic
1184598983 22:45531693-45531715 CCTTTCCCCTTCCAGATCTAGGG + Intronic
949849681 3:8410463-8410485 CCTGTCCGCTGTCAGATATATGG - Intergenic
951617191 3:24560423-24560445 CATTTCCCCTCACAGATCTGGGG - Intergenic
952126407 3:30305831-30305853 CCTTGCCCCTTTCAAAGCTAGGG - Intergenic
952211152 3:31230871-31230893 CCCTTGCCCCTTCAGGTCTAGGG - Intergenic
953089458 3:39709313-39709335 CTTTTCCACTTTGATATCTAAGG + Intergenic
953367947 3:42362816-42362838 CATTTCCCCTTTGTAATCTATGG - Intergenic
953545614 3:43861913-43861935 CCTTTGTCCTTTCAGTCCTAGGG + Intergenic
953828762 3:46277435-46277457 CCTTTTCCCCTTCAGACCTTGGG + Intergenic
954009107 3:47619268-47619290 CCTTTCCACTTTCCCAACTACGG + Intronic
956534511 3:70260724-70260746 CCCTTTCACTTTCAGATTTAGGG + Intergenic
959837769 3:110940852-110940874 CATTTTCCCCTTCAGATGTAGGG - Intergenic
959919626 3:111856613-111856635 CCTTTCTCCCTTCAGGTCTAAGG - Intronic
960819878 3:121718129-121718151 CCTTTGCCATTTTAGATCTAGGG - Intronic
961077942 3:123998988-123999010 CCCTTGCCCTTTCAGGTCTAGGG + Intergenic
961216463 3:125164144-125164166 CCTTTCTCCTTTCGGATCAAGGG - Intronic
961306622 3:125962346-125962368 CCCTTGCCCTTTCAGGTCTAGGG - Intergenic
962160077 3:132989736-132989758 CCCTCCTCCTTTCTGATCTAGGG + Intergenic
962808338 3:138942420-138942442 CCTTTTGCCTTTCAGTTCTCGGG + Intergenic
963481430 3:145879483-145879505 CTTTTCCCCTTACAGTGCTAAGG - Intergenic
964104501 3:153024378-153024400 CTTTTCCCTGTTCAGAACTATGG + Intergenic
965549792 3:169952617-169952639 CCTTTGTCCTTTCAGGCCTAAGG + Intergenic
972872761 4:43320562-43320584 CATTTACCCCTTCAGGTCTAGGG + Intergenic
973734412 4:53856416-53856438 GCTTTACCCTTTCAGTTCTCTGG + Intronic
974881678 4:67766245-67766267 CTTTTACCTTTTCAGATCAATGG - Intergenic
976142222 4:82004163-82004185 TCCTTGCCCTTTCAGGTCTAGGG - Intronic
976201902 4:82587134-82587156 CCTTTCACCAGTCAGATCTCAGG + Intergenic
977483934 4:97617680-97617702 CCTTTCCCTTTTCTGAGCAATGG + Intronic
980019856 4:127695761-127695783 CCTTGCCCCTTTCTGATCTTAGG + Intronic
980668151 4:135967174-135967196 CCTCTCCTCCTTCAGATCTCTGG + Intergenic
981316762 4:143348274-143348296 CATTTCTCATTCCAGATCTATGG + Intronic
984643139 4:182192375-182192397 CCATTGCCCTTTCAAATTTATGG + Intronic
984860881 4:184236877-184236899 CCTTTCCCCATTCTGTTCTTCGG - Intergenic
985198164 4:187455539-187455561 CATTTCCCATTTCAGTTTTATGG + Intergenic
988315795 5:29625855-29625877 CCTTTGCCTGTTAAGATCTATGG + Intergenic
989609955 5:43281488-43281510 GCTTTCCCCTTTCATACCCAGGG - Intergenic
992382059 5:76247415-76247437 ACTTTCCCTTTCCATATCTAGGG + Intronic
992491945 5:77253388-77253410 GTTTTCCCCTTTCACATCTTTGG + Intronic
997627977 5:135344138-135344160 CCTTTCCCTTGCCAGATCTAAGG + Exonic
998048954 5:139014993-139015015 CCTTGACCCTTTAAAATCTAAGG - Intronic
998429706 5:142060410-142060432 CCTTTTGCCTCTCAGAGCTATGG - Intergenic
1001978977 5:176024882-176024904 CATTTCTCCTTTCAGTTCTGTGG - Intronic
1002238440 5:177818884-177818906 CATTTCTCCTTTCAGTTCTGTGG + Intergenic
1002840160 6:898543-898565 CCTTTCCCCTTTCCCTTCAATGG + Intergenic
1005399018 6:25412567-25412589 CCTTTTCTCTTTAAGATATAGGG - Intronic
1007246222 6:40465065-40465087 CCTTCCCTCTTTCATATTTAAGG - Intronic
1007911036 6:45514355-45514377 CCTTTCCCATTTCACAGGTAGGG + Intronic
1008306384 6:49906582-49906604 CATTTCTCCTTTTAGATTTAGGG - Intergenic
1008328244 6:50213219-50213241 CCTTTCCCTTCTCATATTTATGG - Intergenic
1010154011 6:72770985-72771007 CCTTCCCCCTTCTAGATCGAGGG - Intronic
1010192392 6:73207702-73207724 CCATTCCCCTTTTGGAGCTAGGG + Intergenic
1012136675 6:95566192-95566214 GCTTTCCTCTTTCACATTTAAGG - Intergenic
1012627130 6:101418085-101418107 CCTTCCTCCTCTCAGATCTGTGG - Intronic
1014252307 6:119127397-119127419 CTTTTCCCCTGTCAGATCCTAGG - Intronic
1018319098 6:162587557-162587579 CCTTCCCCCTTACAGAACAATGG + Intronic
1018771235 6:166973140-166973162 CCTTTCCCCTTTTACATACAGGG - Intergenic
1018854943 6:167668557-167668579 CCTTTGCCGTTTCAGAGCCAGGG + Intergenic
1019849722 7:3542448-3542470 CCTTTCCTCTTTCAGAGAGAAGG + Intronic
1020078682 7:5275095-5275117 CCTTACCCCTTACAGATGCATGG + Intronic
1021274561 7:18633538-18633560 CTTTTCCCATTTCAAATATAAGG - Intronic
1022965131 7:35465445-35465467 CCCTTGCCCCTTCAGACCTAGGG - Intergenic
1023956230 7:44888989-44889011 CTTCTCCCCTTTCAGATATTCGG + Intergenic
1024950729 7:54857875-54857897 CCTTTGCCCTTTCACATCTTGGG + Intergenic
1025535777 7:61946452-61946474 CCTTAGCCCTTTGAGACCTATGG + Intergenic
1027448517 7:78302677-78302699 CCTTTTGCCTTTCATGTCTAGGG - Intronic
1028270021 7:88777005-88777027 CCTTTGCCCTTCCAGCTCTAGGG - Intronic
1030208817 7:106976439-106976461 CCTTTTCCCTTTCTGAGATAGGG - Intergenic
1030503208 7:110386001-110386023 CCTTTCCCTTCTGAGATCTGTGG + Intergenic
1031058054 7:117015671-117015693 CCTTTACCCTACCAGATGTAAGG - Intronic
1031939843 7:127776929-127776951 CCTTTTCCCTTTGGGATCTGTGG + Intronic
1032751195 7:134843357-134843379 CCTTTCTATTTTCAGATTTAGGG - Intronic
1035233007 7:157477577-157477599 CCTTGCCGCTTTCAGTTCTGGGG - Intergenic
1035924182 8:3709771-3709793 ACTTACCCCTTTCAGGTCTTCGG + Intronic
1038825003 8:30990300-30990322 CCTCTCCCCTCTCACATATAAGG + Intergenic
1039557936 8:38490123-38490145 CCTTTCCCTTTTCAGAAGTCTGG - Intergenic
1039699941 8:39951865-39951887 TCTTTCCTCTTTCATAACTACGG + Intronic
1040469732 8:47727321-47727343 TCTGTGCCCTTTCAGTTCTAGGG - Intronic
1040515281 8:48129552-48129574 CCTTTCCTTTTACAGATTTATGG + Intergenic
1041519570 8:58740520-58740542 CCTTTGCCCTTTCAGGCCTAGGG - Intergenic
1042034759 8:64520197-64520219 CATTTCCCCTTTCTGATCAAAGG + Intergenic
1042935824 8:74057186-74057208 CCTTTCCCCTTGCAACACTAAGG + Intergenic
1043499538 8:80838798-80838820 CCTTTCCCCTTTCTCCTCCAGGG - Intronic
1043977843 8:86603064-86603086 CCTTTTCTCTTTCAAATCTCAGG + Intronic
1044716340 8:95103213-95103235 CCTTACCCCTGTCAAATGTATGG + Intronic
1046822584 8:118650272-118650294 CTTTCCTCCATTCAGATCTAGGG - Intergenic
1051031503 9:12685561-12685583 CTTCTCTCCTTTCAGATATATGG - Intronic
1053793671 9:41705367-41705389 CCTTCCACCTCTCAGATTTATGG + Intergenic
1054151503 9:61609463-61609485 CCTTCCACCTCTCAGATTTATGG - Intergenic
1054182082 9:61917381-61917403 CCTTCCACCTCTCAGATTTATGG + Intergenic
1054471277 9:65540602-65540624 CCTTCCACCTCTCAGATTTATGG - Intergenic
1057342308 9:94213849-94213871 CCTTTTCACTTTCAAATCTCAGG - Intergenic
1057741103 9:97711713-97711735 ACTTCCCGCTTTCTGATCTATGG - Intergenic
1058585147 9:106500073-106500095 CCTATCCTCTTTCAGGTCTTGGG - Intergenic
1059148818 9:111928135-111928157 CCTTTACCCCTTCAGATATGTGG - Intronic
1059926130 9:119211076-119211098 GCTTTCCCCTTTGACATCCACGG - Intronic
1062041160 9:134404944-134404966 CATTTCCCCTTTCAGATCCTTGG - Intronic
1203664166 Un_KI270754v1:10715-10737 TATTCGCCCTTTCAGATCTAGGG - Intergenic
1187700391 X:21959686-21959708 CCTTTCCTCTTTTAGGTTTAGGG + Intronic
1188630439 X:32351253-32351275 CCTTCCTCCTTTGAAATCTATGG + Intronic
1189174115 X:38937014-38937036 ACTTTCTCCTTAAAGATCTAAGG - Intergenic
1191270734 X:58464639-58464661 CCTTTGCACTTTGAGGTCTAGGG + Intergenic
1191689454 X:63925049-63925071 CTTATCCTCTTCCAGATCTAGGG - Intergenic
1192561105 X:72128682-72128704 CCTCTCTCCTCTCAGAACTAAGG + Exonic
1192683591 X:73280514-73280536 CCTGTCTCCTGTCAGATCAATGG - Intergenic
1194574068 X:95589644-95589666 CCTTTGCCCATTCAGTTCTAAGG + Intergenic
1195161836 X:102179212-102179234 CCTTTCCCCTTTCCTTTCCATGG + Intergenic
1195757720 X:108215776-108215798 TTTTTCCCCTTTCGGGTCTAGGG + Intronic
1196582412 X:117393179-117393201 CCTTTCCCCTTGCTGTTCTTAGG - Intergenic
1197443459 X:126518928-126518950 TCTTTGCTCTTTTAGATCTATGG + Intergenic
1197793828 X:130280588-130280610 CCTTTCCCCTTTTACATACAGGG + Intergenic
1197868103 X:131039666-131039688 CTTTAACCCTTTAAGATCTAGGG + Intergenic
1197871073 X:131063416-131063438 CATTTCCCTTTTCAAAGCTAAGG + Intronic
1198034921 X:132792366-132792388 CCTGTCTCCTCTCAGATCTTAGG - Intronic
1200152383 X:153957526-153957548 GCTTCCCCCTTTCAGACCAAAGG - Exonic
1202191826 Y:22253712-22253734 CCTTTCCCCTTTCCTACCCATGG + Intergenic