ID: 1081279095

View in Genome Browser
Species Human (GRCh38)
Location 11:41186611-41186633
Sequence CCTGAACACTGGGTCGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 136}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081279095 Original CRISPR CCTGAACACTGGGTCGGAGG TGG Intronic
902400617 1:16155042-16155064 CGGGAACACTGGGGCGGGGGTGG + Intronic
906206041 1:43986959-43986981 TCTGAACACGGGGTAGGAGTGGG + Intronic
906714330 1:47955753-47955775 CCTGAAGCCTGGATGGGAGGGGG - Intronic
915238279 1:154501861-154501883 CCTGAAGACCGTGTCGGAGCGGG - Exonic
915445067 1:155969864-155969886 CCTGACCCCTGGGTTGGGGGTGG - Intronic
915512226 1:156392651-156392673 CCTGGACTCTGGGTCCGATGTGG - Intergenic
915909774 1:159907358-159907380 CCTGAACACCTGGTTGGAGAGGG + Intergenic
917142427 1:171850142-171850164 CCTGAACACTTGGTTGTAGATGG - Intronic
917730546 1:177870631-177870653 CCTCAACACAGGGTGGGTGGAGG + Intergenic
917796778 1:178538412-178538434 GGTGGCCACTGGGTCGGAGGTGG + Intronic
1062774919 10:136186-136208 CCGGAGCTCTGGGTGGGAGGAGG - Intronic
1065762335 10:28993797-28993819 ATTGAAGACTGGGTCGGATGCGG - Intergenic
1067677771 10:48399945-48399967 CCTGGAAACTGGGTCAGCGGGGG - Intronic
1071432163 10:85614725-85614747 CCAGAACACAGGCTCTGAGGGGG + Intronic
1073199654 10:101724998-101725020 CCTGTGCACTGGGGAGGAGGAGG - Intergenic
1076132239 10:128021390-128021412 CCTGAACACGGGGAGGGGGGCGG - Intronic
1076921968 10:133459006-133459028 CCTGAACTCTGGGGGAGAGGAGG - Intergenic
1078245802 11:9573046-9573068 GCTGGACACTGGCTGGGAGGAGG - Intergenic
1081279095 11:41186611-41186633 CCTGAACACTGGGTCGGAGGTGG + Intronic
1081636692 11:44726771-44726793 CCTGGACGCGGGGTTGGAGGAGG + Intronic
1084043348 11:66555303-66555325 CCTGAACACTGCCTTTGAGGTGG + Exonic
1084575719 11:69986687-69986709 CCTGGACGCTAGGCCGGAGGGGG + Intergenic
1086894950 11:92301378-92301400 CCTGCTCACTGGGATGGAGGTGG + Intergenic
1090952143 11:131483095-131483117 CCTCAACACTGGGTCATATGGGG + Intronic
1091222225 11:133936291-133936313 CCTGAACACTGCGATGGGGGCGG + Intronic
1091473542 12:751988-752010 CCTGAGCTCTGAGTCGGAGGAGG - Intergenic
1091761709 12:3091852-3091874 GCTGAAGACTGTGTTGGAGGAGG + Intronic
1095493411 12:42759739-42759761 CCTGAACACAGTGTAGCAGGAGG - Intergenic
1097901791 12:64880878-64880900 GCTGATCACTGGGAAGGAGGTGG + Intronic
1101246131 12:102885708-102885730 CCTGGCCAGTGGGTCAGAGGAGG + Intronic
1103176305 12:118866382-118866404 GCTGAACACAGGTTAGGAGGAGG - Intergenic
1104266678 12:127239984-127240006 CCACAACACTGGATCGGAAGAGG + Intergenic
1105240848 13:18609064-18609086 CCCGGACACTGGGGCGGCGGCGG - Intergenic
1106897216 13:34316695-34316717 CCTGAACACTAGGTGAGTGGTGG + Intergenic
1113444944 13:110357972-110357994 CATCAACACTGGGTCTTAGGCGG + Intronic
1116828054 14:49691182-49691204 CTTGGTCACTGGGTGGGAGGTGG - Intergenic
1127911352 15:63418779-63418801 CCTGAATTCTGGGTCCTAGGAGG + Intergenic
1128316596 15:66663278-66663300 CCTGGAGACTGGGTTGGAGTGGG - Intronic
1128675735 15:69607243-69607265 CCTGAGCAGTGGGGCAGAGGCGG - Intergenic
1129222973 15:74144321-74144343 CCTAGACACTGGGTGGGATGTGG - Intergenic
1130597749 15:85258681-85258703 CCTGAGCACTGGGGGGGAGCAGG + Intergenic
1130937509 15:88482773-88482795 CCTGTCCACTGGGTGGGAGGTGG + Intergenic
1131536416 15:93241411-93241433 CCTGACTGCTGGGCCGGAGGTGG + Intergenic
1132253044 15:100349307-100349329 CCTGAAAACAGGGTCGGAAAAGG - Intergenic
1133110208 16:3543501-3543523 CCTGGAGACTGGGGCGGAGAGGG + Exonic
1135419846 16:22298122-22298144 CCTGACCATTCGGTCCGAGGAGG + Intronic
1135992069 16:27224337-27224359 CCTGAGCAGTGGGTGGGGGGAGG + Intergenic
1137758730 16:50923361-50923383 AATGAACACTGGGTTGGTGGTGG + Intergenic
1138347956 16:56331512-56331534 CCTGAACCCTGAGTGGGAGGAGG - Intronic
1139705674 16:68738574-68738596 ACTGAACACTGTGGTGGAGGGGG + Intronic
1142284780 16:89167316-89167338 CCTGAGCACTGGGAAGGTGGGGG - Intergenic
1142482941 17:229748-229770 CCTGCACCCTGGCCCGGAGGTGG - Intronic
1143407841 17:6689790-6689812 CCTGAACACAGGATTGAAGGTGG - Intronic
1143450162 17:7031611-7031633 CCTGGACACAGGGTGGGAGTTGG + Intergenic
1147293418 17:39461774-39461796 CCTGAGGACTGGCTCGGCGGAGG + Intronic
1147667217 17:42156371-42156393 CATGAACACTGGCGCGGAAGTGG - Intergenic
1148082761 17:44976621-44976643 CCTGATTTCTGGGTCTGAGGAGG + Intergenic
1149650853 17:58275589-58275611 CCTGAACCCTAGGTGGGATGGGG - Exonic
1150272306 17:63874270-63874292 CCTGAACCTTGGGGCGGAGGCGG + Intronic
1150275853 17:63897167-63897189 CCTGAACCTTGGGGCGGAGGCGG + Intergenic
1150538935 17:66076390-66076412 CCTGAAGACTGTGTGGGAGCTGG + Intronic
1151544351 17:74783469-74783491 CCTGAAGGCTGGGTAGGAGTTGG + Intronic
1152368502 17:79870847-79870869 CCTGAGCAGTGGGTGGGAGGTGG + Intergenic
1153431463 18:5022061-5022083 CCTGAAATCTGGGTCAGAGTGGG - Intergenic
1162082194 19:8224879-8224901 CCTGAAGACTGGGTGGAGGGTGG + Intronic
1163432857 19:17278654-17278676 CCTTAACACTGGGTCCATGGCGG + Intronic
1164622679 19:29706563-29706585 CCTGAGCACTGAGATGGAGGTGG + Intronic
1164705795 19:30318573-30318595 CCTGCACACAGAGTCAGAGGTGG - Intronic
1165362546 19:35345746-35345768 CCTGCACCCTGGGAGGGAGGCGG + Intronic
1165925574 19:39324115-39324137 GCTGAACAAGGGGTCGGATGCGG - Intergenic
1166194924 19:41199163-41199185 CCTGAACACAAGGGCCGAGGTGG - Intronic
1166547240 19:43640602-43640624 CCTGAATCCTGGGTCCCAGGAGG + Intergenic
1167340772 19:48914525-48914547 CCTGATCACTGGCTCTGAGGGGG - Intronic
1167457328 19:49603608-49603630 CTTGAACTCTGGGGTGGAGGGGG + Intronic
925019284 2:555915-555937 CGTGAACACTGGGTCAAAGGAGG - Intergenic
925333452 2:3076159-3076181 CATGAACACTGGATCAGAGGTGG - Intergenic
925744764 2:7034479-7034501 CCTGAAAACTAGGCAGGAGGTGG - Intronic
926345075 2:11937470-11937492 CCAGATCACTGAGTCGGAAGTGG - Intergenic
935137713 2:100322047-100322069 CCAGGACACTGGGGCGGCGGCGG + Exonic
935236340 2:101141478-101141500 ACTGAACGCTGGGTTGGGGGAGG + Intronic
941819827 2:169833053-169833075 CCTGAAGAGTGGGTGGGAGGTGG - Intronic
947710271 2:232309638-232309660 CCTTAAAACTGGGCCGCAGGTGG - Intronic
947815656 2:233034628-233034650 CCTGGACCCTGGCTCGGAGGTGG - Exonic
947836820 2:233181768-233181790 CCCAAACACTGGGTGGGAAGGGG - Intronic
1172135161 20:32681692-32681714 CCTGTACAGTGGCTGGGAGGAGG - Intergenic
1174114969 20:48220576-48220598 CCTGAACCCTGAGTCAGATGGGG + Intergenic
1175174962 20:57105883-57105905 CCTGACCACGGGGTGGGAGAAGG + Intergenic
1176383002 21:6122735-6122757 CCTCAGCACTGGGGTGGAGGCGG + Exonic
1176448111 21:6839849-6839871 CCCGGACACTGGGGCGGCGGCGG - Intergenic
1176826281 21:13704871-13704893 CCCGGACACTGGGGCGGCGGCGG - Intergenic
1179740467 21:43415504-43415526 CCTCAGCACTGGGGTGGAGGCGG - Exonic
1180975355 22:19845013-19845035 CCTGGAAACTTGGTCGGAGCTGG + Intronic
1183607915 22:38877555-38877577 CATGTACACTGGGTTGGGGGAGG - Intergenic
1184831929 22:46994316-46994338 CCTCAACACTGGCTCTGATGGGG - Intronic
1185057142 22:48586998-48587020 CCTGGACAGGGGGTCGGTGGAGG - Intronic
1185131002 22:49038757-49038779 CCTGGACACTGGCTGGAAGGCGG + Intergenic
1185333976 22:50263366-50263388 CCTGAACACTGAGGGGTAGGCGG + Intergenic
950610287 3:14122550-14122572 CCTGAAGGCTGGGTAGCAGGTGG + Intronic
952465120 3:33576192-33576214 CCTGAACACAGGTTCTGATGTGG - Exonic
952718256 3:36504242-36504264 CCTGAACGCTGGGTCACAGAGGG + Intronic
954314542 3:49794052-49794074 CCTGAACTGGGGGTCTGAGGAGG + Intronic
961356783 3:126344508-126344530 CCTGCACACTGGGTGGGCTGTGG - Intronic
967833677 3:193943254-193943276 GCTGAAAACAGGGTAGGAGGAGG - Intergenic
969225905 4:5798266-5798288 CCTGAACACTAGCACTGAGGAGG - Intronic
970891179 4:21046299-21046321 CCTGGACACTGGTTAAGAGGAGG + Intronic
972239749 4:37177630-37177652 TCTGAAGACTGGGTAAGAGGTGG + Intergenic
974951127 4:68583856-68583878 CCTGATCAGGTGGTCGGAGGTGG + Intronic
975999818 4:80360323-80360345 CCTGAAGACTGTGCTGGAGGCGG + Intronic
981920186 4:150078375-150078397 CCTGACCGCTGCGTGGGAGGCGG + Intronic
983938810 4:173521619-173521641 TCTGAACACTGGGACGTAGTAGG + Intergenic
985365478 4:189227184-189227206 CTTGAAAACTGGGTGGGTGGAGG - Intergenic
992399869 5:76402663-76402685 TCTGCACACTGGGGCGGGGGCGG + Intergenic
995478551 5:112572356-112572378 ACTGAACACTGTTTGGGAGGAGG - Intergenic
997292904 5:132750071-132750093 GCTGATCTCTGGGTCTGAGGAGG + Intronic
999374388 5:151076659-151076681 CCTGACCACTGTGAGGGAGGGGG - Intronic
999781984 5:154857500-154857522 CCTGCACACAGTGTCGGCGGCGG - Intronic
1001942064 5:175747825-175747847 CCTGAACACTTCCTCGGTGGTGG - Intergenic
1004270027 6:14186788-14186810 CCTGAACCCGGGGTGGGTGGGGG - Intergenic
1006181196 6:32154364-32154386 CCCGAACGCTGAGTTGGAGGCGG + Exonic
1006856513 6:37137433-37137455 CCTGAACACTCGGGCTGAGAAGG - Intergenic
1007796339 6:44351040-44351062 CCTGAACCCAGAGGCGGAGGTGG + Intronic
1011427613 6:87247428-87247450 ACTGGACTCTGGGTCAGAGGAGG + Intronic
1014585645 6:123194636-123194658 CCTGAGCACTGTGTTGGAAGTGG + Intergenic
1016627997 6:146195391-146195413 CCTGAACGGCGGGTCTGAGGAGG - Intronic
1017275056 6:152556583-152556605 CCTGGAGACTGGGTCTGTGGAGG - Intronic
1018862629 6:167722175-167722197 CCTGAAGACTGGGGTGGAGTTGG + Intergenic
1022939782 7:35223179-35223201 CCAGAACACTGGGAAGGATGCGG + Intronic
1023492752 7:40761949-40761971 CATGAACACTGGGCGGGAGAGGG + Intronic
1023586668 7:41738142-41738164 CCTGGACACTGGTTCGGGGGCGG - Intergenic
1026503828 7:70965386-70965408 TCTGAATACTGGGTTGGGGGAGG - Intergenic
1029546116 7:101211540-101211562 CCTGGGCCCCGGGTCGGAGGAGG + Intronic
1032703036 7:134398792-134398814 ACTGAAGACTGGGTCTGAGCTGG + Intergenic
1035006185 7:155662792-155662814 CCTCAACAATGGGTAGGTGGGGG + Intronic
1035638404 8:1163978-1164000 CCTGAACACTGAGTCTTAGAGGG - Intergenic
1037395145 8:18433812-18433834 CCTGAACAATGGGTAGGTGAGGG - Intergenic
1037654162 8:20868580-20868602 CCTGAACCATGGGGCTGAGGAGG - Intergenic
1039473735 8:37828729-37828751 CCTCAGCACCGGGTGGGAGGTGG - Intronic
1039826664 8:41180186-41180208 CCTGAACAATGGGTTGGACATGG + Intergenic
1041364662 8:57089175-57089197 CATGAACACAGGGTCAGCGGGGG - Intergenic
1047289522 8:123517151-123517173 ACTCATCACTGGGTAGGAGGTGG + Intronic
1048068500 8:130997889-130997911 CATCAACTCTGGGTCAGAGGTGG - Intronic
1051865500 9:21676120-21676142 CACGATCACTGGGTAGGAGGTGG + Intergenic
1061652680 9:132063736-132063758 CCTGAACACTTGAGCGGTGGAGG - Intronic
1203521079 Un_GL000213v1:44669-44691 CCCGGACACTGGGGCGGCGGCGG + Intergenic
1189532605 X:41901951-41901973 CCTGAAGACTGGGTCTGCAGGGG + Intronic
1190486161 X:50927260-50927282 CCTGGAGACTGGGTCTGAGGGGG + Intergenic
1191848065 X:65563724-65563746 CTTGAACCCTGGGTGGGTGGAGG + Intergenic
1192800260 X:74458932-74458954 CCTGAACACTGAGTCATAGATGG - Intronic
1195070121 X:101270902-101270924 CATGCACACTGGCTCAGAGGTGG - Intronic
1200310702 X:155074008-155074030 CCTGATAACTTGGTGGGAGGAGG - Intronic