ID: 1081279882

View in Genome Browser
Species Human (GRCh38)
Location 11:41196051-41196073
Sequence GCTTATTTGGACACAATAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 109}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081279879_1081279882 25 Left 1081279879 11:41196003-41196025 CCTTATTTCATCCTTTGATCTAA 0: 1
1: 0
2: 0
3: 14
4: 285
Right 1081279882 11:41196051-41196073 GCTTATTTGGACACAATAGAAGG 0: 1
1: 0
2: 0
3: 4
4: 109
1081279878_1081279882 26 Left 1081279878 11:41196002-41196024 CCCTTATTTCATCCTTTGATCTA 0: 1
1: 0
2: 2
3: 44
4: 469
Right 1081279882 11:41196051-41196073 GCTTATTTGGACACAATAGAAGG 0: 1
1: 0
2: 0
3: 4
4: 109
1081279880_1081279882 14 Left 1081279880 11:41196014-41196036 CCTTTGATCTAACTTTTTAAAGT 0: 1
1: 0
2: 0
3: 51
4: 462
Right 1081279882 11:41196051-41196073 GCTTATTTGGACACAATAGAAGG 0: 1
1: 0
2: 0
3: 4
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081279882 Original CRISPR GCTTATTTGGACACAATAGA AGG Intronic
904791587 1:33026398-33026420 GCTTAGGTGCACACAATAAAAGG + Intronic
907088148 1:51697830-51697852 GTTTATATGGAAACAATATAAGG - Intronic
909347108 1:74603254-74603276 GCTAACTTGTACAGAATAGAAGG + Intronic
911921245 1:103763857-103763879 GCTAAATTAGACACCATAGAGGG - Intergenic
914515739 1:148372556-148372578 GCTTATTAGGAAAGAATGGAAGG - Intergenic
916216683 1:162401251-162401273 TCTTGTGTGGACAAAATAGAGGG - Intronic
920822427 1:209393443-209393465 GGTTATTTGCAGACAATGGAGGG + Intergenic
1064223216 10:13459478-13459500 GGTTATTTTAATACAATAGATGG - Intronic
1067680446 10:48433750-48433772 GCTCATCTGGACAGAATGGAGGG + Intronic
1071497345 10:86178332-86178354 GCCTATTTGCACACAAAAGCGGG + Intronic
1072016751 10:91354984-91355006 GCAGATTTGGACACTACAGAAGG - Intergenic
1075503752 10:123002974-123002996 GATTATTTGGAAAAAATGGATGG + Intronic
1078027943 11:7716494-7716516 GGATATTGAGACACAATAGAGGG + Intergenic
1081279882 11:41196051-41196073 GCTTATTTGGACACAATAGAAGG + Intronic
1082820016 11:57538390-57538412 GCTGCTTTGGACACAAAACAGGG + Intergenic
1084738819 11:71124442-71124464 GCTTATTAGGATTCAATACATGG - Intronic
1085707032 11:78795733-78795755 GCTAATTTGTACAAAATATATGG - Intronic
1085882924 11:80489104-80489126 ACTCATTTGTACCCAATAGACGG + Intergenic
1086203222 11:84228193-84228215 GCTTATTTGGAAACATTTTATGG + Intronic
1089924916 11:122247409-122247431 CCTCATGTAGACACAATAGAAGG - Intergenic
1092875234 12:12842113-12842135 GCTTATTTGGGGTAAATAGAAGG - Intergenic
1093258494 12:16903034-16903056 ACTTATTTGGATTCAAAAGAAGG - Intergenic
1095694038 12:45123922-45123944 GAAGATTTGGACACAATTGATGG + Intergenic
1095887266 12:47202187-47202209 AGTTATTTGCACATAATAGAAGG + Intronic
1101313338 12:103605158-103605180 ACATATTTGGAAACAATAGCAGG - Intronic
1110463470 13:75773671-75773693 GCTGATTTGGAGGCAAGAGATGG + Intronic
1110657958 13:78023172-78023194 TCTTATTTGCACAAAAAAGAGGG - Intergenic
1111477949 13:88778442-88778464 GCTTATTTGTTCTGAATAGATGG - Intergenic
1115929326 14:38473051-38473073 GCTCATTTAGAAATAATAGAGGG - Intergenic
1116189948 14:41651771-41651793 GCTTATTTGCAAAGACTAGATGG + Intronic
1117092577 14:52266009-52266031 ACTTATATTGACTCAATAGAAGG - Intergenic
1117530425 14:56655466-56655488 GCTTATGTGGTCACATCAGAAGG - Intronic
1117785895 14:59284526-59284548 GCTCATTTAGATACAAGAGAAGG + Intronic
1124849396 15:33321667-33321689 ACTTAATTGGACTTAATAGACGG + Intronic
1125598281 15:40901231-40901253 GATTATTTGGCCACAAAAGGGGG + Intronic
1127784186 15:62341845-62341867 GCTTATTGAGACAAGATAGACGG + Intergenic
1128162672 15:65434568-65434590 GCTTATCTGGAGACAAATGACGG - Intergenic
1141118147 16:81329353-81329375 GTTTATTTGGCCACATTTGAGGG - Intronic
1155377135 18:25172354-25172376 GTTTCTTTAAACACAATAGATGG - Intronic
1156849530 18:41710323-41710345 GCACATATGGACAAAATAGATGG + Intergenic
1157289881 18:46401791-46401813 CCCTATTTGGAAACCATAGAAGG - Intronic
1158027083 18:52913039-52913061 ACTTAGTTGTACACAATAAAAGG - Intronic
1159254602 18:65930484-65930506 GCTTACTTGGACAAAATTCATGG - Intergenic
1163837243 19:19582339-19582361 GCTTATTTGGGCACAAGATGTGG - Intronic
1167060577 19:47142962-47142984 CCTTATTTCCACACCATAGAAGG + Intronic
925721043 2:6827617-6827639 GCTTATTTTGCCATAATTGAGGG - Intergenic
927227115 2:20778728-20778750 GTTTATTGGATCACAATAGAAGG + Intronic
931612453 2:64116995-64117017 CCTTATATGGACACAATTCAGGG - Intronic
932655367 2:73606779-73606801 CCTTAATAGGACACAATTGAAGG - Intronic
933177339 2:79190481-79190503 CCATACTTGGACACAATAGGTGG + Intronic
934819489 2:97359890-97359912 TCATATTTTGACACAGTAGATGG + Intergenic
935011822 2:99142953-99142975 GATTATTTGGAAAGAATATAAGG + Intronic
935637396 2:105259902-105259924 GTCTGTTTGGACCCAATAGAAGG + Intergenic
938342411 2:130544360-130544382 GCACACTGGGACACAATAGAAGG + Intronic
938347421 2:130576349-130576371 GCACACTGGGACACAATAGAAGG - Intronic
940335245 2:152519969-152519991 GCTTATTTGCACTCCAGAGAAGG - Intronic
942808441 2:179964880-179964902 GCTCATTTAGACACTATAAAAGG + Intronic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1173710642 20:45152733-45152755 GCATAGTTGAAGACAATAGAAGG + Intergenic
1177808814 21:25902781-25902803 GCATATTTGGAAACATGAGATGG - Intronic
1178020510 21:28402633-28402655 GCTTATTAAGACAGCATAGATGG + Intergenic
1178194083 21:30322549-30322571 GCTTATTTGGGCATAATACCAGG + Intergenic
1178306028 21:31490813-31490835 GCTTATTTCTACACAATAGCAGG - Intronic
1179041851 21:37810222-37810244 GGTGATATGGACACAATATATGG - Intronic
1179728810 21:43355878-43355900 GCTTATTTGGCCATAATGAATGG + Intergenic
1183741775 22:39672832-39672854 GCCTAATGGGCCACAATAGAAGG + Intronic
956788990 3:72666113-72666135 CCTTCTATTGACACAATAGAAGG + Intergenic
961803356 3:129469974-129469996 GCTTTTTGGGACACAAAAGAGGG + Intronic
962230824 3:133663953-133663975 GCTTATCTGGAGACACAAGATGG - Intergenic
964049859 3:152377477-152377499 TCTTATTTGGGGACAATAAAAGG + Intronic
972451325 4:39201684-39201706 TCTGATATGGACACAAGAGAGGG - Intronic
972934210 4:44112239-44112261 TCTTCTCTGAACACAATAGAGGG - Intergenic
973075973 4:45926218-45926240 GCTTATTAGGACATAAAACATGG - Intergenic
975384600 4:73741438-73741460 GATTATTTGGAGACTATGGAAGG - Intronic
977130449 4:93229318-93229340 GCTGGTTTGGACAAAACAGAGGG + Intronic
979973817 4:127170791-127170813 TCTTATGTGGACACAATTCATGG - Intergenic
980269064 4:130560574-130560596 GCTTACTTGGAGAAAAGAGAAGG - Intergenic
980919823 4:139072680-139072702 GGTTATTTGTGCACATTAGAAGG - Intronic
982123884 4:152167926-152167948 GCTCATTTGGAGACACTAAAGGG + Intergenic
986734335 5:10656958-10656980 TCTTATTTAAAAACAATAGAGGG - Intergenic
987763050 5:22190563-22190585 GCTTTTTTGTAGACAAGAGAAGG - Intronic
989424003 5:41274714-41274736 GCCTTTTTGGACACAGTAAATGG + Intergenic
991897830 5:71423967-71423989 GCTTTTTTGTAGACAAGAGAAGG - Intergenic
991972483 5:72154463-72154485 GCTAATTTGGCCACTACAGATGG + Intronic
994604825 5:101954086-101954108 GCTTAGAGGGACACAAAAGAGGG + Intergenic
995331040 5:110946302-110946324 ACTTATTTGTATACAATAGAAGG + Intergenic
998966263 5:147543879-147543901 GCATCTTTGGAGATAATAGAAGG - Intergenic
1007317125 6:40998189-40998211 GCTTAGCTGGACAAAATAGTAGG + Intergenic
1010025159 6:71206641-71206663 GCTTATGTGTTTACAATAGAAGG + Intergenic
1011090862 6:83597722-83597744 GCTTATGTGGCCAAAGTAGATGG - Intronic
1011644614 6:89445921-89445943 TCTTATTTGGGCACAATTCATGG - Intronic
1011776090 6:90732381-90732403 TATTATTTGGCCATAATAGAAGG - Intergenic
1012707740 6:102554265-102554287 GCTGATTCTGACACAATGGAAGG - Intergenic
1015002711 6:128238808-128238830 TCATATTTGGACACAAAATATGG + Intronic
1020396022 7:7719058-7719080 GCTTTTTTTAACACAATAAAAGG - Intronic
1021299357 7:18953279-18953301 GCTTTTTGGGTCACAATAGCTGG + Intronic
1022824840 7:33998348-33998370 GCTGACCTGGACACCATAGAAGG - Intronic
1029904477 7:104077198-104077220 GATTAATAGGAAACAATAGATGG - Intergenic
1039439459 8:37584629-37584651 GCCTATTTGGAGACAATGGGTGG - Intergenic
1041097710 8:54365907-54365929 GCCTAATTGATCACAATAGATGG - Intergenic
1045073803 8:98540391-98540413 GGTTATTTGGACCCAAAAGCAGG + Intronic
1046050452 8:109015355-109015377 TCTCATTTGCAGACAATAGAAGG - Intergenic
1050419473 9:5448437-5448459 TTTTATTTGGACGAAATAGATGG - Intergenic
1050763272 9:9100246-9100268 GCCTATTTGGACACAGCAGTAGG + Intronic
1052538986 9:29782131-29782153 GCCTATTTGAAGACACTAGAGGG - Intergenic
1060712308 9:125879806-125879828 GCATATTTGGAAATAATAAAAGG - Intronic
1186247477 X:7629884-7629906 GGATATTGGAACACAATAGAGGG - Intergenic
1194318713 X:92415023-92415045 GCTAATTTGGAGAGAAAAGAAGG + Intronic
1196728323 X:118917195-118917217 GATGATTTGGACAGAAGAGAGGG - Intergenic
1199636361 X:149816407-149816429 GCATATGTGGACACAAAGGAGGG + Intergenic
1199676914 X:150196781-150196803 CCTTATTTGGAAAAAAAAGAGGG + Intergenic
1200626850 Y:5528179-5528201 GCTAATTTGGAGAGAAAAGAAGG + Intronic
1200944614 Y:8821574-8821596 GATAAGTTGGACACAAAAGAGGG + Intergenic
1201552249 Y:15229856-15229878 GATGATTTGGATACAATAGATGG + Intergenic