ID: 1081280206

View in Genome Browser
Species Human (GRCh38)
Location 11:41200552-41200574
Sequence CTGTTTTTGCAGAAGTAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 264}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081280206_1081280208 4 Left 1081280206 11:41200552-41200574 CCTACCTACTTCTGCAAAAACAG 0: 1
1: 0
2: 1
3: 16
4: 264
Right 1081280208 11:41200579-41200601 AAAACTTGCTTTACCGATGATGG 0: 1
1: 0
2: 0
3: 8
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081280206 Original CRISPR CTGTTTTTGCAGAAGTAGGT AGG (reversed) Intronic
905497843 1:38408644-38408666 CTATTCTTGCAGAAGTAAGATGG - Intergenic
906977550 1:50591783-50591805 CTGTTAGTGCAGAAGAAAGTCGG - Intronic
908331426 1:63074558-63074580 CTGATTTTGCAGAAGCAGATAGG + Intergenic
908835021 1:68220961-68220983 CTCTTTTTCAAGAAGTAGGTGGG + Intronic
908890381 1:68840125-68840147 CTGTTCTTGCAGGAGTAAGGTGG + Intergenic
909077827 1:71074059-71074081 CTGTTTGTGGAGAAGTAATTAGG - Intronic
910075640 1:83274955-83274977 CAGTTTTTGCAGGAGTTGTTGGG - Intergenic
910393428 1:86767957-86767979 CTGGTTTTGAAGAAGTAGGAAGG - Intergenic
911095778 1:94053886-94053908 CTTTGTTGGCAGAAATAGGTAGG - Intronic
911241032 1:95466950-95466972 CTGTCTTTGCAGAATGAGTTTGG + Intergenic
912413749 1:109494503-109494525 CTGTTTCTGAGGAAGTAGTTCGG - Exonic
912930721 1:113957799-113957821 TTTTTTGTGCAGAAGTAGTTGGG + Intronic
913616540 1:120565618-120565640 CTGTATTTGCACAAACAGGTGGG - Intergenic
914573737 1:148945293-148945315 CTGTATTTGCACAAACAGGTGGG + Intronic
915001134 1:152592980-152593002 CTTTTTTTGCTGATGTAAGTGGG + Intronic
915027475 1:152844228-152844250 CTGTGTTTACAGATGTAAGTGGG + Intergenic
915679487 1:157566798-157566820 ATGTTTATGCAAAAGTATGTTGG - Intergenic
916078009 1:161214168-161214190 TTGTATTTGGAGAAGTAGATCGG + Exonic
916819809 1:168387201-168387223 CTGTGTTTGCTGAGGTGGGTGGG + Intergenic
918972566 1:191438729-191438751 CTATTTTTGCAGGAGTAAGGTGG - Intergenic
920381688 1:205538257-205538279 CTGCTTGTGGAGAAGTGGGTGGG - Intergenic
921289152 1:213638870-213638892 CCTTTTTTGCAGAAATTGGTAGG - Intergenic
921960777 1:221031615-221031637 TGGTTTTTGCAGAAGTGGGATGG - Intergenic
922284349 1:224155530-224155552 CTGTTTTTGCAAAAGTATATTGG + Intronic
922844521 1:228673348-228673370 ATGTTTTTGCAGTTGTAAGTTGG + Intergenic
1063690409 10:8281850-8281872 CTGTATTGGAAGGAGTAGGTAGG + Intergenic
1065566211 10:27013059-27013081 CTGTTTTTCCACAAGAAGTTTGG + Exonic
1065828641 10:29595059-29595081 CTGGTTTTGCAGATGTAGAGTGG - Intronic
1066587538 10:36952905-36952927 CTGTATATGGAGAAGGAGGTGGG + Intergenic
1070575859 10:77678293-77678315 ATCTTTTTTCAGAAGAAGGTGGG - Intergenic
1071212194 10:83356193-83356215 CTGTATTTGCAAAAATAGTTTGG + Intergenic
1071427292 10:85571669-85571691 CTGCTTTTACAGAAGCTGGTTGG - Intergenic
1080202936 11:29694463-29694485 CCATTTTTGCAGGAGTAGGGTGG + Intergenic
1080231098 11:30017778-30017800 TTGTTTTTGCAGCAACAGGTTGG - Intergenic
1081280206 11:41200552-41200574 CTGTTTTTGCAGAAGTAGGTAGG - Intronic
1081927622 11:46843866-46843888 TTGTTTTTGCAATACTAGGTAGG - Intronic
1082303223 11:50537018-50537040 CTGTTTTTGTAGAATCAGCTAGG - Intergenic
1082929411 11:58584396-58584418 CTGTTTTGGCAGAAGTATTTTGG + Intronic
1083064146 11:59906030-59906052 CCGTTCTTGCAGGAGTAGGGTGG + Intergenic
1083852709 11:65377367-65377389 TTCTTTTTGCAGGAGCAGGTTGG + Intronic
1084261381 11:67980974-67980996 CTGTTTTTGCCTAAGTGGCTGGG + Intergenic
1086030483 11:82349336-82349358 CTATGTTGGCAGGAGTAGGTCGG - Intergenic
1086300472 11:85421859-85421881 CAGTTTTTGCAGTGGTGGGTCGG + Intronic
1087149347 11:94844670-94844692 CTGTTACTGTAGGAGTAGGTTGG - Intronic
1087171527 11:95054174-95054196 CAGCTTTTCCAGAAGTAGGGTGG - Intergenic
1087405735 11:97727873-97727895 CCATTTTTGCAGAAGTAAGGGGG - Intergenic
1087477366 11:98653053-98653075 CAAATTTTGCAGAAGTATGTGGG + Intergenic
1087888969 11:103514906-103514928 CTCTTTTTGCAGAAAAAGGGAGG - Intergenic
1088598995 11:111459412-111459434 CTGTTTTGGAAGAAGCAAGTGGG - Intergenic
1089226075 11:116923421-116923443 CTAATTTTGGAGAGGTAGGTTGG - Intronic
1089439854 11:118506143-118506165 CTGTTATTGCAGCAGTAGAGGGG - Exonic
1090816087 11:130297419-130297441 CTGCTTGTGCAGAGGTAAGTTGG - Intronic
1091127482 11:133114020-133114042 CTGTTTCTGAAGAAGCAGGGAGG - Intronic
1091946982 12:4555319-4555341 ATGTTTTGGCAAAAATAGGTGGG - Intronic
1094028013 12:25979615-25979637 CAGTTTTTGCAGAAGTAAAATGG - Intronic
1096379935 12:51148088-51148110 CTATTCTTGCAGAAGTAAGGTGG - Intronic
1097176087 12:57143741-57143763 CTGCTGTTGCAGTAGCAGGTGGG - Exonic
1100231309 12:92611074-92611096 CTGGGTTTGGAGAACTAGGTTGG - Intergenic
1101478708 12:105076106-105076128 CTGTATTGGCAGAAGTAACTGGG + Intronic
1101572515 12:105966921-105966943 CTGTTGTTGCAGAAGAATGTAGG + Intergenic
1101773691 12:107775085-107775107 CTGTCTTTGCAGAAGTTTCTGGG - Exonic
1102838188 12:116087729-116087751 TTTTTTTTGCAGAATGAGGTAGG - Intronic
1104236742 12:126945686-126945708 CTATTTTTGCAGAATTAGCATGG - Intergenic
1104375362 12:128261364-128261386 ATGATTTTGCATAAGTAGATAGG + Intergenic
1105375609 13:19841711-19841733 CTGTTTATACAAAAGTATGTGGG + Intronic
1106125042 13:26894317-26894339 CTGAGGTAGCAGAAGTAGGTCGG + Intergenic
1106284268 13:28305583-28305605 CTGTATTTACAGAAACAGGTGGG - Intronic
1106691430 13:32121469-32121491 CCGTTCTTGCAGGAGTAAGTTGG + Intronic
1107187949 13:37546495-37546517 TTGTTTTGGCAGTAGTAGGGGGG + Intergenic
1107307108 13:39034427-39034449 CTTTCTTTGTAGAAGTTGGTAGG - Intronic
1109431703 13:62245114-62245136 CAGTTTTTAAAGAAGTAAGTAGG - Intergenic
1109504526 13:63282931-63282953 CTGTTCTTGCAGGAGTAAGGTGG + Intergenic
1110429744 13:75410499-75410521 CTGTATTTGCTGAAGAAGTTGGG + Intronic
1112541984 13:100323188-100323210 CTTTTTTTACAAAAATAGGTAGG + Intronic
1112683874 13:101800023-101800045 GTGTCTGTGGAGAAGTAGGTAGG - Intronic
1114066736 14:19066334-19066356 CTGTGTTTGAACAGGTAGGTTGG + Intergenic
1114095530 14:19333693-19333715 CTGTGTTTGAACAGGTAGGTTGG - Intergenic
1114537472 14:23432134-23432156 CTGTTTTGGGAAAAGTTGGTAGG + Intronic
1114952322 14:27770826-27770848 CTATTTTTGCAGGAGTAAGGTGG - Intergenic
1115051625 14:29070458-29070480 ATGATGTTGAAGAAGTAGGTAGG + Intergenic
1115325850 14:32137584-32137606 CTGTTTTTGCAGAAATGGAAAGG - Intronic
1115990843 14:39147866-39147888 CTTTTTCTGCGGGAGTAGGTGGG - Exonic
1117733114 14:58743765-58743787 TTGTTTTTCCTGATGTAGGTAGG + Intergenic
1120201169 14:81539887-81539909 CTATGGTTGCAGAAGAAGGTGGG + Intergenic
1120766120 14:88327505-88327527 GTGTTTTTGCAGATGTCAGTTGG - Intergenic
1123827860 15:24101458-24101480 GTCCTTTTGCAGATGTAGGTGGG + Intergenic
1123997765 15:25730560-25730582 GTGTTTCTGCAGGAGTGGGTGGG - Intronic
1124577386 15:30921869-30921891 CTGTGTTCCCAGAAGTATGTGGG + Intronic
1126782721 15:52152239-52152261 CAGTTTTTCCAAAAGCAGGTTGG - Intronic
1128216699 15:65939253-65939275 CTTTTGTTGGAGGAGTAGGTGGG + Intronic
1128523220 15:68389330-68389352 GTGTATTTGCATAAGTGGGTTGG - Intronic
1130555496 15:84919673-84919695 CTGTTATTGCAGGAGTAGTTTGG - Intronic
1133719491 16:8481574-8481596 CTGTTGTTGCAGAATTAGGCTGG - Intergenic
1133810916 16:9160442-9160464 TCGTTTTTGCAGAGGAAGGTAGG + Intergenic
1136054845 16:27680686-27680708 CTTTTTTTGCAGAGGGAGGGTGG + Intronic
1136576075 16:31126199-31126221 CTGTTTGTGCAGAAGCATGAAGG + Intronic
1137737439 16:50735445-50735467 ATGGGTTTGCAGAGGTAGGTAGG + Intergenic
1139631198 16:68232866-68232888 CACTTTTTGCAGAACTTGGTGGG - Intronic
1141752505 16:85968270-85968292 CTGTTTCAGCAGAACTAGGGTGG + Intergenic
1142139155 16:88465015-88465037 ATGTTTTTGAAAAAGAAGGTAGG + Intronic
1143276009 17:5711395-5711417 GTGTCTTTCCAGAGGTAGGTGGG - Intergenic
1143895806 17:10135383-10135405 CTGGTTTTGAAGCAGAAGGTGGG - Intronic
1144257880 17:13487615-13487637 CTGCTTTTGCAAAAGGAGGTAGG - Intergenic
1146710507 17:35037031-35037053 CTGTTGTTGCAGAACTACCTTGG - Intronic
1147049547 17:37781764-37781786 CTGTTTTTTTAGAAGCAGGGAGG - Intergenic
1149150446 17:53556272-53556294 TTTTTTTTCCAGAAGAAGGTAGG - Intergenic
1149154878 17:53616159-53616181 CTGATTCTACAGAAGTAGGATGG + Intergenic
1150591143 17:66563801-66563823 CTGTCTGTGCAGAGGTACGTTGG + Intronic
1151028379 17:70705968-70705990 TTGTTTCTGCAGAAATAGGAGGG + Intergenic
1153466110 18:5389525-5389547 CTGTGGCTGGAGAAGTAGGTGGG + Intergenic
1154407763 18:14110637-14110659 CTATTTTTGTAGGAGTAAGTTGG - Intronic
1155759312 18:29545576-29545598 CTGATTTTGCAAATGTAGGATGG + Intergenic
1157738882 18:50074669-50074691 CTGTTTTTACATTAGTTGGTCGG - Intronic
1158830273 18:61269791-61269813 CCATTTTTGCAGGAGTAAGTTGG - Intergenic
1159885713 18:73903202-73903224 CTGCTCTTGCAGGAGAAGGTGGG - Intergenic
1160054412 18:75465507-75465529 CTGGTTTTGCAGAAGCCTGTGGG + Intergenic
1164331499 19:24262803-24262825 TTGTTTTTGATTAAGTAGGTTGG - Intergenic
1165593449 19:36990684-36990706 CTTGTTTTGAGGAAGTAGGTTGG - Intronic
1165848059 19:38831655-38831677 CTGTTATAGCAGATGTAGGACGG - Intronic
926889151 2:17624622-17624644 CTGCTTTTGAAGAAGGAGGAAGG + Intronic
927181760 2:20451752-20451774 CCATTTTTGCAGAAGAATGTAGG - Intergenic
932349975 2:71023835-71023857 CTTCTTTAGAAGAAGTAGGTAGG - Intergenic
934484990 2:94698482-94698504 CTATTTTTGCAGGAGTAAGGTGG + Intergenic
935125464 2:100218643-100218665 TTGTTTTTGATGCAGTAGGTGGG - Intergenic
935815744 2:106844226-106844248 CTTGTTTTGCAGAGGTTGGTGGG - Intronic
936727255 2:115334253-115334275 CTCTTGTTGCAGAAATAGCTAGG - Intronic
936879316 2:117231499-117231521 CGGTTTTTGCTAAAGCAGGTGGG + Intergenic
937690339 2:124748348-124748370 TTGATTTTACAGAAGTAAGTTGG - Intronic
938052245 2:128185126-128185148 TTGTTTTTGCAGAATTATTTTGG + Intronic
938451868 2:131428210-131428232 GTGTTTTAGCAGAAGGAAGTTGG + Intergenic
938484133 2:131686428-131686450 CTGTGTTTGAACAGGTAGGTTGG + Intergenic
940484328 2:154277568-154277590 CTGTTATTGCAGAAATTGTTCGG - Intronic
940799233 2:158115146-158115168 CTGTTTATGCACAAGGAGCTCGG + Exonic
940807735 2:158206797-158206819 GTGATTTTAAAGAAGTAGGTGGG + Intronic
943100861 2:183484510-183484532 CTATTTTTGCAGGAGTAAGGTGG + Intergenic
943910277 2:193556442-193556464 ATGTATTTTCAGAAGGAGGTAGG - Intergenic
946636144 2:221729762-221729784 CTATTTTTGCAAGAGTAAGTTGG - Intergenic
947089215 2:226491970-226491992 TTGTTTTTAGAGAAGTAGGAAGG - Intergenic
948714231 2:239849300-239849322 GTGTTCTTGCAGAAGTAAGGTGG - Intergenic
1170815118 20:19707418-19707440 CTGTTCATGCGGAAGTAAGTCGG + Intronic
1171339542 20:24416642-24416664 CTGTTTTAGCAGATGTCGTTGGG + Intergenic
1171843348 20:30242246-30242268 CTGTTTATGGAGATGTAGCTAGG - Intergenic
1175801825 20:61805366-61805388 CTGTGTTGGCAGATGGAGGTGGG + Intronic
1176073937 20:63240037-63240059 CTGTTCTTAGAGAAGTGGGTGGG + Intronic
1176545452 21:8195672-8195694 CTGATTCTGCAAAAGCAGGTGGG + Intergenic
1176564403 21:8378717-8378739 CTGATTCTGCAAAAGCAGGTGGG + Intergenic
1177036130 21:16045307-16045329 CTGTTTTGCCAAAAGGAGGTTGG - Intergenic
1177726867 21:24980892-24980914 CTGTTACTGCAGAGATAGGTTGG + Intergenic
1178148224 21:29764195-29764217 CTATTTTTTCACAAGTTGGTAGG + Intronic
1178189253 21:30261930-30261952 TTGATTTGGAAGAAGTAGGTGGG - Intergenic
1178838507 21:36118877-36118899 ATGTGTTTGCTCAAGTAGGTGGG + Intergenic
1178994400 21:37385472-37385494 CTGGCTTTGCAAAAGTAAGTGGG - Intronic
1179556514 21:42181763-42181785 CTGTTTTTAAAGAACTAAGTTGG + Intergenic
1180485218 22:15788918-15788940 CTGTGTTTGAACAGGTAGGTTGG + Intergenic
1180671195 22:17554873-17554895 GTGTTTGTGCAGAAGCAGGGAGG + Intronic
1181967025 22:26663932-26663954 CTGCTTTCTCAGAAGTAGATTGG + Intergenic
1182112710 22:27734643-27734665 CTGTGTGTGCAGAAGTGGATGGG - Intergenic
1183096102 22:35553212-35553234 CTGTGTGTGCAGAAGGTGGTGGG - Exonic
1203250322 22_KI270733v1_random:111910-111932 CTGATTCTGCAAAAGCAGGTGGG + Intergenic
951120438 3:18920698-18920720 CTGTGTTTTCAGAAGGAGGAAGG - Intergenic
951129211 3:19022011-19022033 GTGTATTTGGAGAAGCAGGTAGG - Intergenic
952109965 3:30111063-30111085 ATGTTTTTGCAGTAGCAGGAGGG + Intergenic
952431077 3:33223417-33223439 CTGATTTTGTAGAAATCGGTGGG - Intergenic
954750762 3:52812274-52812296 TCCTTTTTTCAGAAGTAGGTGGG + Intergenic
955990444 3:64621459-64621481 CTTTATTTGTAAAAGTAGGTAGG + Intronic
956613066 3:71144083-71144105 CTGCTTTTTAAGAAGTAGTTTGG + Intronic
957384316 3:79476199-79476221 CTGTTCTTGCAGAAGTAAACTGG - Intronic
957471345 3:80661387-80661409 CTATTCTTGCAGAAGTAAGTTGG - Intergenic
959088511 3:101877282-101877304 CTGTTTTTACAAAAGTACATTGG - Intergenic
964342289 3:155720407-155720429 CTGTTCTTGCAGGAGTAAGGTGG + Intronic
965341919 3:167502081-167502103 CTGTTTTTGCAATAGTGAGTGGG + Intronic
966282829 3:178254677-178254699 CTGTGTTTGTAGCAGTAGCTGGG - Intergenic
967557045 3:190872322-190872344 CTGGTTTTGCAGAAGCATTTGGG - Intronic
968314964 3:197716511-197716533 GGTTTTTTTCAGAAGTAGGTAGG - Intronic
968476438 4:811849-811871 CTGTCTTTGCTGACGTATGTTGG + Intronic
969827487 4:9769019-9769041 ATGTTTTTGCAGGAGTTGGGGGG - Intergenic
971297038 4:25404374-25404396 TTTTTTTTGCAGAGGTAGTTTGG + Intronic
972392388 4:38626067-38626089 CTGCTTCTGCAGCAGAAGGTAGG - Intergenic
974401047 4:61407295-61407317 TTGTTATTACAGAAGTAGATAGG + Intronic
978065308 4:104392042-104392064 CTGTACTTTCAAAAGTAGGTTGG + Intergenic
978513941 4:109551565-109551587 CTATTCTTGCAGGAGTAAGTTGG + Intergenic
981266294 4:142787624-142787646 CTGTTTATGCAGCAATAGTTGGG + Intronic
981508025 4:145524647-145524669 CTATTTCTGCAGTATTAGGTGGG + Intronic
982582657 4:157198600-157198622 GTGTTTTTACAGAAGTATTTTGG + Intergenic
982610209 4:157564684-157564706 ATGTTGTTGCAGAAGCATGTAGG - Intergenic
984069092 4:175089800-175089822 TTGTTTATGCAGTATTAGGTAGG + Intergenic
984492972 4:180458708-180458730 CTGTTATTGCAGCTTTAGGTGGG + Intergenic
985923610 5:2998844-2998866 CTGTCTCTGCAGAACTAAGTAGG - Intergenic
986277927 5:6296746-6296768 CTGTTTTTGCAGACTTTGTTTGG - Intergenic
986967347 5:13290198-13290220 CTATTCTTGCAGTAGTAAGTAGG + Intergenic
988177645 5:27747506-27747528 CTGGTTTTGTAGAAGGAGTTAGG - Intergenic
990355880 5:54965723-54965745 CTGTTTTTGCAGAACTAAGATGG - Intergenic
991496586 5:67232798-67232820 CTGTCTTTGCAAAAGTATGATGG + Intergenic
991565983 5:68004852-68004874 ATGTTTTTTCACAAGTGGGTGGG - Intergenic
992177033 5:74159464-74159486 CTGTTGGTGGAGATGTAGGTTGG + Intergenic
992599410 5:78383128-78383150 CTGTTTTTGCAGGAGTAAGTTGG + Intronic
993349425 5:86829943-86829965 CTGTTTTGGCAGTAGTGGTTGGG + Intergenic
994321914 5:98404395-98404417 CTGTATTTGGAGAACTGGGTTGG - Intergenic
995818202 5:116195887-116195909 CTGTTCTTGCAGGAGTAAGGTGG - Intronic
998737260 5:145156624-145156646 GTGTTTTTGCAGAACTAGAAAGG + Intergenic
999710732 5:154316013-154316035 CTCTTTTCTCAGAAGTAGTTTGG - Intronic
1003447239 6:6195788-6195810 TTGTTTTTGCAGAGGTAAGCAGG - Exonic
1005639641 6:27783736-27783758 CAGTTTTTGAAAATGTAGGTTGG - Intergenic
1007110823 6:39312829-39312851 CTGTATTTGCAGAAGTCCGCAGG + Intronic
1010811271 6:80301640-80301662 CTGTCTTTGTAGAATTAGTTAGG - Intronic
1012199857 6:96392413-96392435 CTGTTTTTACATAAGTATCTGGG + Intergenic
1012859407 6:104541473-104541495 CTGTTATTCCAGAAGTGGGTTGG - Intergenic
1013016249 6:106163258-106163280 CCGTTACTGCAGGAGTAGGTTGG - Intergenic
1014320161 6:119917983-119918005 CTGTGTTTTCAGGAGAAGGTTGG + Intergenic
1014426587 6:121314174-121314196 CTGTTTTTGAAGATGGAAGTAGG - Intronic
1016599057 6:145836105-145836127 CTTTTTTTTCAGAAGGAGGCAGG - Intergenic
1018304863 6:162444305-162444327 CTCATTTTGCAGAACTATGTAGG - Intronic
1022705644 7:32799756-32799778 CTTTTTTTGCAGAAATGGATGGG + Intergenic
1023224717 7:37957451-37957473 GTGTTTTCGCAGAAGGATGTTGG + Intronic
1024560062 7:50636365-50636387 CTGGTTTTGTAGAATTAGTTAGG - Intronic
1026232258 7:68495635-68495657 GTGTTTTTGCAGGGGGAGGTGGG + Intergenic
1027326038 7:77049908-77049930 CTATTTTTACAAAAGTTGGTCGG + Intergenic
1027587607 7:80077321-80077343 GTATTAATGCAGAAGTAGGTAGG - Intergenic
1028019024 7:85748227-85748249 CTGTTTTTGTAGAATGAGTTAGG - Intergenic
1028913853 7:96237377-96237399 CTGTATTTGGAGAAGCATGTAGG + Intronic
1029685815 7:102147203-102147225 CTGCTTTGGCAGAAGTAGAGGGG - Intronic
1029989282 7:104948248-104948270 CTTTTTTTGTAGATCTAGGTAGG + Intergenic
1030713032 7:112775170-112775192 CTGTACCTGCAGAAGTTGGTGGG + Exonic
1030794887 7:113775798-113775820 ATGAATTTGCAGAAGCAGGTAGG - Intergenic
1030803070 7:113878241-113878263 CTGATTTCGTAGAAATAGGTTGG + Exonic
1032055813 7:128683383-128683405 CAGTTTTTGGAAAAATAGGTGGG + Exonic
1033962081 7:146927304-146927326 CTGTATTTGCTGAAAGAGGTTGG + Intronic
1035593141 8:833480-833502 CTGGCTTTGCAGATGGAGGTGGG - Intergenic
1039144700 8:34434323-34434345 CTATTCTTGCAGAAGTAAGGTGG + Intergenic
1039834204 8:41243526-41243548 GGGTTTTTGCAGATGTAGTTAGG + Intergenic
1041073273 8:54145845-54145867 CTGTTGTAGGTGAAGTAGGTAGG + Intronic
1043506167 8:80905255-80905277 CCATTATTGCAGAAGTGGGTTGG + Intergenic
1043594987 8:81874736-81874758 CTGTGTTTTCAGAAGTTGTTTGG + Intergenic
1044825679 8:96194647-96194669 CTGTATTTGGAGAAGGAGTTTGG + Intergenic
1045121762 8:99045241-99045263 CTATTCTTGCAGGAGTAAGTTGG + Intronic
1047067843 8:121306450-121306472 CTGTTTCTGCAAAAGTAAGAGGG - Intergenic
1047422943 8:124722234-124722256 CTGTGTTTGAAGAAGTGGATGGG - Intronic
1048653163 8:136503619-136503641 CTCTTTTTGCATAAATAGCTTGG + Intergenic
1048859560 8:138714027-138714049 CTGTTTTTGTAAAAGAAGGTTGG + Intronic
1049523835 8:143110455-143110477 TTACTTTTGCAGTAGTAGGTAGG + Intergenic
1050142836 9:2534259-2534281 TTTTTTTTGAAGAAGTAAGTAGG - Intergenic
1050335497 9:4586088-4586110 CTGTTATTGCAGAACTATGCTGG - Exonic
1050463691 9:5898365-5898387 TTGTTATTGCAAAAGTAGGTTGG - Intronic
1051351190 9:16199365-16199387 CGTTTTTATCAGAAGTAGGTGGG - Intergenic
1053189693 9:36052527-36052549 TTGTTTTTGGAGAAGTCTGTTGG + Intronic
1053400187 9:37812241-37812263 TTGTTTTTGAAGAAGTTGGTAGG - Intronic
1053671046 9:40362018-40362040 CTGTTTTTCCATAAGTAGAAGGG + Intergenic
1053672806 9:40385899-40385921 CTATTTTTGCAGGAGTAAGGTGG - Intergenic
1053922622 9:43012280-43012302 CTATTTTTGCAGGAGTAAGATGG - Intergenic
1054382163 9:64502078-64502100 CTGTTTTTCCATAAGTAGAAGGG + Intergenic
1054383918 9:64525961-64525983 CTATTTTTGCAGGAGTAAGGTGG - Intergenic
1054511819 9:65990384-65990406 CTATTTTTGCAGGAGTAAGGTGG + Intergenic
1054513567 9:66014281-66014303 CTGTTTTTCCATAAGTAGAAGGG - Intergenic
1055472660 9:76628827-76628849 GTGTGTTTGGAGAAGTGGGTTGG - Intronic
1057266285 9:93620098-93620120 CTCTTTCTGCAGATGTGGGTGGG + Intronic
1057339864 9:94190615-94190637 CCGTTATTGCAGGAGTAGGGTGG + Intergenic
1058204656 9:102088241-102088263 CTGTTTCTGTAGAAGTATGCAGG + Intergenic
1058422990 9:104851045-104851067 CACATTTTGCAGAAGTGGGTGGG - Intronic
1058585897 9:106505805-106505827 CTGGCTTTGCAGAAGGAGGAAGG - Intergenic
1058631083 9:106987354-106987376 CCATTTTTGCAGAAGTAAGGTGG + Intronic
1058806371 9:108595939-108595961 TAGTTTTTGCAGAGGTATGTTGG + Intergenic
1059866872 9:118524449-118524471 CAGTTTTTGCAGAAATAGAAAGG + Intergenic
1059900089 9:118914742-118914764 CTGTTGCTGCACATGTAGGTTGG + Intergenic
1062067272 9:134535515-134535537 CTGATTTTGCAGATGTAGTGGGG - Intergenic
1062292241 9:135801325-135801347 CTGGTTTTGCAGATGGAGGGAGG - Intergenic
1187392310 X:18894199-18894221 CTGTTCTTGCAGGACCAGGTGGG - Exonic
1187681839 X:21775615-21775637 CTATTTTTGCAGGAGTAAGGTGG - Intergenic
1189517841 X:41733261-41733283 CTTTTTTTGTAGGAGTAGGCTGG + Intronic
1190522616 X:51295670-51295692 CTTTTTTTTCAGAGGTAGGAAGG - Intergenic
1190975106 X:55391514-55391536 CCATTTTTGCAGGAGTAGGGTGG - Intergenic
1191964248 X:66739886-66739908 CTGTTTTTGCTGAATTGTGTAGG + Intergenic
1192111437 X:68368853-68368875 TAGTCTTTGCAGAAGTAGCTTGG + Intronic
1193745774 X:85278680-85278702 ATGTTTTTTAAGAAGTAGGTAGG + Exonic
1193983745 X:88215267-88215289 CTGGTTTTGAAGATGTAGGAAGG - Intergenic
1193998146 X:88391982-88392004 TTGTTTTTGCAATACTAGGTAGG - Intergenic
1194094886 X:89626985-89627007 CCGTTCTTGCAGAAGTAAGGTGG + Intergenic
1194642349 X:96417518-96417540 ATGTTTTAGCTCAAGTAGGTAGG - Intergenic
1196438452 X:115695384-115695406 GTGTTTGGGCAGAGGTAGGTGGG - Intergenic
1196465844 X:115970541-115970563 CTGTTTGGGCAGAGGTGGGTGGG + Intergenic
1196674617 X:118406262-118406284 CTGTATTTTCAAAATTAGGTAGG + Intronic
1199595982 X:149506050-149506072 CTGTGTTTGCAGTATTAGGACGG - Intronic
1200447518 Y:3283138-3283160 CCGTTCTTGCAGAAGTAAGGTGG + Intergenic