ID: 1081290230

View in Genome Browser
Species Human (GRCh38)
Location 11:41315862-41315884
Sequence CTCAATAAATAGATGTACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 492
Summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 446}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081290228_1081290230 -1 Left 1081290228 11:41315840-41315862 CCATGTCTCCACACAGTGAGAGC 0: 1
1: 0
2: 0
3: 14
4: 214
Right 1081290230 11:41315862-41315884 CTCAATAAATAGATGTACAAAGG 0: 1
1: 0
2: 1
3: 44
4: 446
1081290229_1081290230 -9 Left 1081290229 11:41315848-41315870 CCACACAGTGAGAGCTCAATAAA 0: 1
1: 1
2: 15
3: 74
4: 411
Right 1081290230 11:41315862-41315884 CTCAATAAATAGATGTACAAAGG 0: 1
1: 0
2: 1
3: 44
4: 446

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081290230 Original CRISPR CTCAATAAATAGATGTACAA AGG Intronic
900924189 1:5692692-5692714 CTCAATAAATGTTTGTTCAATGG + Intergenic
901564776 1:10104481-10104503 CTCAATAGATAGATTTTAAATGG + Intronic
902135186 1:14299062-14299084 CTCAATAAACAGCTGTTGAATGG - Intergenic
902236129 1:15058585-15058607 CTCAATAAATAGTGGTTGAATGG - Intronic
902698164 1:18154331-18154353 CTGAAAAAAAAGATGTAAAATGG - Intronic
904963122 1:34350318-34350340 TTCAATAAATATATGTCAAATGG - Intergenic
905303325 1:37000168-37000190 CTCAAGAAATAGTTGTTGAATGG + Intronic
907172197 1:52478813-52478835 CTCAATGAATAGTTGTAAAATGG - Intronic
907455021 1:54569969-54569991 CTCAGTAAATATGTGTTCAATGG - Intronic
907814708 1:57906834-57906856 CTCAATAAATATTTGTGGAATGG + Intronic
908335209 1:63115720-63115742 CTCAATAAATATTTGTTAAATGG - Intergenic
909282765 1:73776576-73776598 CTCAACAAATAAATGCAAAAAGG + Intergenic
909602518 1:77475225-77475247 CTCCATATATAGATATATAAAGG + Intronic
910155426 1:84212800-84212822 TTCAATAAATAATTGTAAAATGG + Intronic
911836728 1:102628982-102629004 CTCAATAAATATTTGTTGAATGG + Intergenic
911927930 1:103860272-103860294 CTCAATAAATAAAATAACAAAGG - Intergenic
912749234 1:112271895-112271917 CTCAATCAAAAGATGGACATTGG - Intergenic
914908420 1:151765597-151765619 CTCAATAAATATTTGTTGAATGG + Intronic
915864495 1:159484445-159484467 CTTAATAAATATATCTAAAACGG - Intergenic
917014718 1:170517117-170517139 CTAATTAAATATATGTATAATGG - Intergenic
917107323 1:171505698-171505720 CTCAATAAATAGGAATAGAAGGG - Intronic
917142208 1:171847070-171847092 CTCAATAAATACATGTTCATTGG - Intronic
917589447 1:176461304-176461326 CTCAATTAATATTTGTAGAAGGG - Intergenic
917589790 1:176464360-176464382 CTCAATAAATACTTGTTGAAAGG - Intronic
918305739 1:183244424-183244446 CTCAATAAATATATGTTGGAAGG - Exonic
918384327 1:183990281-183990303 CTCAATAAATATTTGTTGAATGG + Intronic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
920782960 1:209012343-209012365 CTCAATCAATATTTGTTCAATGG - Intergenic
921116079 1:212093027-212093049 CTCAAAAAAAAGATATACACAGG - Intronic
922054960 1:222032992-222033014 TTCAATAAATAATTGTTCAATGG - Intergenic
923466551 1:234252541-234252563 CTCAATAGAGAAATGAACAAAGG + Intronic
923474161 1:234317202-234317224 CTAAATAAATAAAAGTACAACGG + Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924461857 1:244266760-244266782 CTCAATAAATAACTGTTCAAAGG + Intergenic
1063247880 10:4242081-4242103 ATAAATAAATAAATGCACAAAGG - Intergenic
1063507170 10:6610367-6610389 CTGAATAAATATATGTTGAATGG - Intergenic
1063671050 10:8100382-8100404 CTGATTAAACAGATGAACAAAGG - Intergenic
1063689008 10:8265864-8265886 CTAAACAAATAGATTTATAATGG - Intergenic
1063858051 10:10276894-10276916 CCCAATTAATACATGGACAAAGG - Intergenic
1065283468 10:24164539-24164561 CTCAATAAATATTTGTTAAATGG + Intronic
1065764676 10:29016908-29016930 CTCAAGACACAGATGTACTAAGG - Intergenic
1066147883 10:32581011-32581033 CTAAGCAAATAGATGTACAAGGG - Intronic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1066752683 10:38674897-38674919 CTCAACAAAAAAATGGACAAAGG + Intergenic
1066964350 10:42248129-42248151 CTCAACAAAAAAATGGACAAAGG - Intergenic
1067146745 10:43699894-43699916 CTCTATGTATAGATGTACATAGG + Intergenic
1068137902 10:52968827-52968849 CTCAATGAACATATGTACAGGGG + Intergenic
1068465896 10:57391120-57391142 CTAAATACATAGGTGAACAAAGG - Intergenic
1068720169 10:60236468-60236490 TTCAATAAATAAATGAACACGGG - Intronic
1069149605 10:64942211-64942233 TCCAATAAATAGATGTAGAATGG + Intergenic
1069947334 10:71997025-71997047 CACAATAAATAAATAAACAACGG - Intronic
1070448466 10:76532394-76532416 ATGAATAAATAAATGTATAAAGG - Intronic
1070713296 10:78699265-78699287 CTCACTAAATATTTGTTCAAAGG - Intergenic
1072745008 10:97933724-97933746 CTCAGTAAATATTTGTCCAATGG + Intronic
1074608187 10:114995017-114995039 ATAAATAAATAAATGTACAAAGG - Intergenic
1075974334 10:126682567-126682589 CTCTATAAATAGTTGTTCAATGG + Intergenic
1076167029 10:128290968-128290990 CTCAGTAAATATTTGTAGAATGG - Intergenic
1076213056 10:128666460-128666482 CTCAGTAAATAGTTGTGAAATGG + Intergenic
1076219857 10:128724370-128724392 CTAAGTAAATAAATGTGCAAAGG - Intergenic
1077278694 11:1732082-1732104 CTCAATAAATAAATAAATAAAGG - Intergenic
1078487064 11:11733341-11733363 TTCAATAAATAGTTGTTGAATGG + Intergenic
1078612075 11:12829609-12829631 CTCAATAAATACATGGATAAAGG - Intronic
1078636576 11:13056018-13056040 CTTAACAAATAGATGCACTAGGG - Intergenic
1078664004 11:13309593-13309615 CTCAATAAATACTTGTAAAATGG - Intronic
1080653137 11:34238499-34238521 CTCAATAAATATTTGTTGAATGG + Intronic
1080762253 11:35263004-35263026 CTCAATAAATATTTGTTGAATGG - Intronic
1081290230 11:41315862-41315884 CTCAATAAATAGATGTACAAAGG + Intronic
1081548833 11:44093840-44093862 CTCAATAAATAGTTGTTGAATGG - Intergenic
1082902437 11:58269552-58269574 CTCAATAATTATATGTCGAATGG + Intergenic
1084467936 11:69337820-69337842 CTCAGTAAATATATGGACAATGG - Intronic
1084850636 11:71936897-71936919 CTCAATAAATATATGGATATGGG - Intronic
1085204667 11:74723950-74723972 TTCAATAAATAAATGAATAATGG - Intronic
1085539947 11:77258010-77258032 CTCAATAAATATTTGTTGAATGG + Intronic
1085912331 11:80842445-80842467 CTCAATAAACAAATGTTGAATGG + Intergenic
1086040079 11:82465723-82465745 CTCAATAAATATTTGTAAAATGG + Intergenic
1086723521 11:90150980-90151002 ATAAATAAATATATGTAAAATGG - Intronic
1087154353 11:94886162-94886184 ATAAATAAATAGAGCTACAATGG + Intergenic
1087230593 11:95657455-95657477 CTCAATAAATTGATACAAAATGG + Intergenic
1087540382 11:99509779-99509801 ATTAATAAATAGATGTATTAAGG - Intronic
1087614276 11:100470429-100470451 TTCAACACATAGATGTTCAAAGG - Intergenic
1088627363 11:111739176-111739198 CTCAATAAAAATGTGTTCAATGG - Intronic
1088698903 11:112394504-112394526 CTCACTAAATAGTTGTGAAATGG - Intergenic
1090148442 11:124354871-124354893 CTGATTAAATAAATGAACAAAGG + Intergenic
1092031784 12:5292600-5292622 CTCAGTAAAGAGATTTACACGGG + Intergenic
1092856050 12:12674775-12674797 GTTAATAATTAGATATACAATGG + Intronic
1093331324 12:17845429-17845451 ATCATTAAATACATGTACTAAGG - Intergenic
1096281339 12:50257175-50257197 TTCAATTAATAAATGTAGAAAGG - Intronic
1096505170 12:52088050-52088072 CTCAATAAATCTCTGTAGAATGG - Intergenic
1097177178 12:57150030-57150052 TTCAATAAATATTTGTTCAATGG + Intronic
1098156690 12:67606891-67606913 CTCAATAAATACTTATAGAATGG + Intergenic
1098331462 12:69358171-69358193 TTCACTAAATAGAAGTGCAAGGG - Intergenic
1098744277 12:74216225-74216247 CTCAATAAATACATAAACATGGG - Intergenic
1099297590 12:80848950-80848972 CTCAACAAATAGTTGTTGAATGG - Intronic
1099340795 12:81431305-81431327 CACAATAAAGGGAAGTACAAGGG - Intronic
1099614311 12:84914801-84914823 AACAATAAATAGATGAAGAATGG + Intergenic
1100129006 12:91467013-91467035 CTCAAAAAAAAGATATATAAAGG + Intergenic
1100234531 12:92646748-92646770 ATTAATACATAGAAGTACAAAGG + Intergenic
1100996910 12:100310809-100310831 CTTAATAAATAGGTGTACTCTGG + Intronic
1101010091 12:100440528-100440550 CTCAATAAATAGTTGTTGAATGG + Intergenic
1101748421 12:107562138-107562160 CTCTATAAATATATGTTGAATGG - Intronic
1101993110 12:109503930-109503952 CTCAATAAATATTTGAAGAATGG - Intronic
1102456246 12:113072505-113072527 CTCAATGAATACAGCTACAATGG - Intronic
1102620662 12:114192092-114192114 CTCAATAAATAGTTGTTGGAGGG - Intergenic
1103130477 12:118464126-118464148 CTGAATAAATATTTGCACAATGG + Intergenic
1103939412 12:124493793-124493815 CTCAATAAATAGAGGCACGGGGG + Intronic
1105835753 13:24210085-24210107 CTCAATCACAAAATGTACAAAGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1108118204 13:47153840-47153862 CTAAATAAATAAATCTAAAAGGG + Intergenic
1108834908 13:54531573-54531595 CACTATAAATATATGTAAAATGG - Intergenic
1109177609 13:59175757-59175779 ATCAATCAATACACGTACAACGG + Intergenic
1110654656 13:77983463-77983485 TTCAATAAAGAAATGTGCAAAGG - Intergenic
1110656005 13:78000512-78000534 CTCAATTAAAAGATGCAGAATGG + Intergenic
1111873124 13:93859640-93859662 CCCAAAAAAGATATGTACAAAGG - Intronic
1112810609 13:103214236-103214258 CTTAATAATTAAATGTAAAATGG + Intergenic
1114538511 14:23437980-23438002 CTCAATAAATACTTGTTGAATGG - Intergenic
1114650813 14:24283601-24283623 CTCAATAAATAAATAAATAAAGG + Intergenic
1114787837 14:25621404-25621426 CTCAATAAATAAATAAATAAAGG + Intergenic
1114849191 14:26362359-26362381 CTAAATATATTGATGTACATTGG + Intergenic
1114913263 14:27227748-27227770 CTGAATAAATAAATGAATAATGG + Intergenic
1116082589 14:40194024-40194046 CTCAAAAAATAGGTATAGAAGGG + Intergenic
1116106984 14:40521430-40521452 CTAAACAAATAGATTTATAATGG + Intergenic
1116554831 14:46289829-46289851 CTGAATAAGTAGATCTATAAAGG + Intergenic
1117177296 14:53157894-53157916 GTCATTAAATACATCTACAATGG - Intergenic
1117719739 14:58617784-58617806 CTCAATAAATAATTGTTGAATGG - Intergenic
1118080454 14:62352541-62352563 ATCAATACATATATGTTCAACGG - Intergenic
1119678445 14:76573885-76573907 CTCAATAAATATTTGTTGAATGG - Intergenic
1119757926 14:77131846-77131868 CTCAATAAATATACGTAGGATGG + Exonic
1120352791 14:83384527-83384549 CTCTGGAAATAGATGCACAATGG - Intergenic
1120499171 14:85272696-85272718 TTGAATAAATAAATGAACAATGG + Intergenic
1120598874 14:86475380-86475402 CTCAATAAATAGGTGTTAAATGG - Intergenic
1120678078 14:87445645-87445667 CTCAATAAATATATGTTGCATGG + Intergenic
1121149817 14:91622338-91622360 CTCAATAAATATTTGTTGAATGG + Intronic
1121677499 14:95765911-95765933 CTCAATAACTAAATGTCGAATGG + Intergenic
1121677502 14:95765961-95765983 CTCAATAACTAAATGTCAAATGG + Intergenic
1125850394 15:42897641-42897663 CTCAATAAATACTTGTCGAATGG - Intronic
1126046732 15:44648732-44648754 CTGTTTAAATAGATATACAAAGG + Intronic
1126679864 15:51192400-51192422 CTCAATAAATACTTGTTTAAAGG + Intergenic
1126798022 15:52276139-52276161 CTCAATAAATACATGTTGACAGG - Intronic
1127722562 15:61717253-61717275 CTCAATAAATAGTTTTAAATTGG + Intergenic
1127808855 15:62545802-62545824 CTCAATAAATATTTGTCAAATGG + Intronic
1127898900 15:63326715-63326737 CACAATAAAAACATGGACAAAGG + Intronic
1128321509 15:66697989-66698011 CTCAATAAATATTTGTAGAGTGG - Intergenic
1128485913 15:68088652-68088674 CTCAATAAATATTTGTTGAAGGG + Intronic
1130402872 15:83573752-83573774 ATGAATAAATAAATGAACAAAGG - Intronic
1130852751 15:87812669-87812691 CTCATTCAATAGATTTGCAAAGG + Intergenic
1134375001 16:13663951-13663973 CTCAACAAATATTTGTAGAATGG + Intergenic
1134655623 16:15946515-15946537 CTCAATAAATATTTGTTGAAAGG + Intergenic
1135715234 16:24759063-24759085 CTCAAAAAAAAGATGAATAAAGG + Intronic
1139271325 16:65686125-65686147 CTCTCTAAATAGATCTACCATGG - Intergenic
1140066374 16:71615002-71615024 CTAAATAAATGTTTGTACAAGGG + Intergenic
1142147661 16:88499286-88499308 CTCAATAAATGGAAGTACAAGGG - Intronic
1142720487 17:1772549-1772571 ATAAATAAATAAATGTAAAAGGG - Intronic
1144125818 17:12202125-12202147 CTCAATAAACCGAGGTACGAAGG + Intergenic
1144163108 17:12581182-12581204 CACTAAAAATAGATGTACAGAGG + Intergenic
1144256041 17:13469763-13469785 TTCAATCAATAAATGTACCATGG + Intergenic
1144327846 17:14198765-14198787 CTCAATAAATATTTGTTGAATGG - Intronic
1144385939 17:14749245-14749267 CTTAAAAAGTATATGTACAAAGG + Intergenic
1144620218 17:16814020-16814042 TTCAATAAATATATTTATAAAGG - Intergenic
1145032951 17:19519114-19519136 CTCAATAAATAAATAAATAAGGG - Intronic
1146246623 17:31290046-31290068 CTCAATGAATAAATGGGCAAAGG - Intronic
1147041262 17:37721197-37721219 CACAATAAACAGATTTATAATGG - Intronic
1147571602 17:41574898-41574920 TTCAATAAATATATTTATAAAGG - Intergenic
1147783076 17:42957799-42957821 CTCAATAAATACTTGTTGAATGG - Intronic
1147972329 17:44225659-44225681 ATAAATAAATAAATGTAGAATGG - Intergenic
1148541833 17:48487124-48487146 CTCAATTAATACATGTTAAATGG + Intergenic
1148632354 17:49121058-49121080 CTCAATAAATGTATGTTGAAAGG - Intergenic
1148655964 17:49283790-49283812 CTCAATAAATAAATAAATAAAGG - Intergenic
1149301699 17:55310372-55310394 CTCAATAAATAAATATCAAAAGG + Intronic
1149765266 17:59270805-59270827 CTCAAAAAATATTTGTAAAAAGG - Intronic
1149951418 17:60991313-60991335 ATAAATAAACAGAAGTACAATGG - Intronic
1151205557 17:72504021-72504043 CTCAATAAATATTTGAACAAAGG - Intergenic
1153118088 18:1685543-1685565 CCAAATAAATACATTTACAATGG - Intergenic
1153453708 18:5258279-5258301 CTCAATAAATAAGTATACAAAGG - Intergenic
1154511495 18:15108037-15108059 ATCAACAAATAGAAGTATAAAGG + Intergenic
1155402987 18:25459071-25459093 CTCAATAAATATTTGTTGAATGG - Intergenic
1155979788 18:32168092-32168114 CTCAGTAAATATATGTGGAATGG - Intronic
1156014171 18:32528575-32528597 CTCTCTAAATATCTGTACAATGG + Intergenic
1157376333 18:47169773-47169795 CTCAATTAAAACATTTACAAAGG - Intronic
1157997882 18:52581482-52581504 CTCAATAAATATTTGTGGAATGG + Intronic
1158132377 18:54166960-54166982 CTCAATAAAGATATGTTGAATGG - Intronic
1158821660 18:61166271-61166293 ATAAATAAATAGATGTAAACAGG + Intergenic
1158886677 18:61834632-61834654 CTCAATAAATGCTTGTAGAAGGG + Intronic
1159188554 18:65011872-65011894 TTCAATAAATAGATATACAGAGG + Intergenic
1159249415 18:65854306-65854328 ATAAATAAATATATCTACAAGGG + Intronic
1161262270 19:3344619-3344641 TTTAATAAATAAATGTATAAAGG - Intergenic
1161263488 19:3351211-3351233 GTCAAAAAAGAAATGTACAAAGG + Intergenic
1161310975 19:3593733-3593755 CTCAATAAATATTGGTAGAAAGG - Intergenic
1164868205 19:31622632-31622654 GTGAAGAAATAGATTTACAAAGG - Intergenic
1165054112 19:33162894-33162916 CTAAATAAATAAATATAGAATGG + Intronic
1165174305 19:33916166-33916188 ATAAATAAATAAATGTAGAAAGG - Intergenic
1165251211 19:34537218-34537240 CTAAAGAAATATATGAACAAAGG - Intergenic
1165686053 19:37820787-37820809 CTCAGTAATTACATGAACAAAGG - Intergenic
1166095891 19:40538896-40538918 CTTAATAAATATTTGAACAAGGG + Intronic
1166138621 19:40793134-40793156 CTTAATAAATATGGGTACAAAGG - Intronic
1166272459 19:41723485-41723507 CCCAATTAATAAATGGACAAAGG - Intronic
1166636349 19:44455126-44455148 CTCCAGAAATAGCTGTATAAAGG + Intergenic
1167693014 19:50998734-50998756 CTCAATAAATATTTGTTGAATGG - Intronic
1167704466 19:51071070-51071092 CTGAATAAATAAATGAACTATGG + Intergenic
925205450 2:2002106-2002128 GTCAATAAAAAGAAGTAGAATGG - Intronic
925586962 2:5474525-5474547 CTTTATAGATAGATGTACAGTGG + Intergenic
925637379 2:5953123-5953145 CTCAATAAATGGTTGTGGAATGG + Intergenic
925679662 2:6406429-6406451 CTAAATAATTAGATATACTAAGG - Intergenic
926665221 2:15514350-15514372 CTGAATAAATAGAAATATAAGGG + Intronic
926972551 2:18481377-18481399 CTAAACAAATAGATGTAAATGGG - Intergenic
927184043 2:20469375-20469397 CTCGATAAATATATGTGGAATGG + Intergenic
927673225 2:25086591-25086613 CTCAATAAATAAATAAATAAAGG - Intronic
928817446 2:35316166-35316188 CTTATCAAAGAGATGTACAATGG + Intergenic
929665923 2:43833683-43833705 CTCAATAAATAAATAAATAAAGG - Intronic
929765253 2:44838744-44838766 GTCAATAAATATATGTGGAATGG + Intergenic
929873078 2:45774353-45774375 CTCACTAAATAGGTGTTGAACGG + Intronic
930328958 2:49958185-49958207 CTCATTAAATACATGCACAAAGG - Intronic
930930437 2:56875336-56875358 CTAAATAAACACATGTACAGAGG + Intergenic
931658297 2:64530552-64530574 CTCAATAAATACATGTTAAGAGG + Intronic
933246846 2:79985514-79985536 CTCAATAAGTAGGTGTTTAATGG + Intronic
933617237 2:84495163-84495185 CTCAATAAATAAATGGTCAAAGG - Intergenic
934186340 2:89680180-89680202 CTCAACAAAAAAATGGACAAAGG - Intergenic
934315673 2:91917050-91917072 CTCAACAAAAAAATGGACAAAGG + Intergenic
935356356 2:102204807-102204829 TCCAATAAAGAGATGTAGAATGG - Intronic
935505421 2:103895347-103895369 ACCAATAAATACATGTGCAATGG + Intergenic
936650547 2:114421649-114421671 GTCAAAATATTGATGTACAAAGG - Intergenic
937082646 2:119151421-119151443 CTCAATAAATAGTTTCAGAATGG - Intergenic
937729881 2:125216009-125216031 CTCACTAAATAGGTTTACCATGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
939366459 2:141239066-141239088 ATCAATAAAAAGATGTCTAAAGG + Intronic
939636766 2:144591609-144591631 CTCAATAAATACCTGTTAAATGG + Intergenic
940256057 2:151730441-151730463 AGCAATAAATAGATGCAGAAAGG + Intronic
941733502 2:168946249-168946271 GTCAACAAATAGTTGTTCAAAGG + Intronic
943087767 2:183333764-183333786 CTCAATTAAAAGATGGGCAAAGG - Intergenic
943204187 2:184870137-184870159 CTATATAAATAAATGTAAAAAGG + Intronic
945010762 2:205461027-205461049 CTCAATAAATATCTGTTGAATGG - Intronic
945279925 2:208026348-208026370 CTGAATAAATGAATGAACAAAGG + Intergenic
945283962 2:208064001-208064023 CTAAATAAATGGAAGGACAAAGG + Intergenic
945384928 2:209186237-209186259 CTCAATAAAGAAATGGTCAAAGG + Intergenic
945795173 2:214353974-214353996 CTCAATAAAGATATACACAAAGG + Intronic
945985865 2:216352945-216352967 CTCAATAAATATTTGCAGAATGG + Intronic
946296689 2:218789780-218789802 CCAAATAAATACATTTACAATGG - Intronic
946612003 2:221468854-221468876 TTCAATAAATAGATCCACTATGG + Intronic
946789607 2:223286727-223286749 CACAATAAATATTTGTAAAATGG - Intergenic
947066352 2:226230082-226230104 CTCAATAAAAAAATGGGCAAGGG + Intergenic
947090031 2:226499245-226499267 CTCAATAAATAAATAAATAATGG - Intergenic
947233692 2:227918219-227918241 TTCAATAAATAGCTGTAGTATGG - Intronic
947929062 2:233948223-233948245 CTCAATAAATATCTGTTGAATGG - Intronic
1169097322 20:2913955-2913977 GTCAATGAATGGATGTAGAAGGG - Intronic
1169462753 20:5810508-5810530 CTTAAAAAATATATGTGCAATGG - Intronic
1169754598 20:9030485-9030507 CTCAATAAATTTTTGTTCAATGG - Intergenic
1169868502 20:10226434-10226456 TTCAATAAATATTTGTTCAATGG - Intronic
1170159914 20:13300395-13300417 CCCAATAAATAAATATAAAAGGG + Exonic
1170712050 20:18800141-18800163 CACAATAAAAAAATATACAAAGG - Intergenic
1177223220 21:18220281-18220303 CTCAATTAGAAGATGTACACTGG - Intronic
1177223264 21:18221243-18221265 TTCAATAAAGAGATATAAAAAGG - Intronic
1178048308 21:28720731-28720753 CTCAAAAAATACATATATAAGGG + Intergenic
1178390085 21:32191142-32191164 CTCAACAAATAAATGTCCAGGGG + Intergenic
1179636148 21:42710985-42711007 CTCAAAAAAAATATGTAAAAAGG + Intronic
1182336887 22:29589626-29589648 CTCAAAAAAAAAATGAACAAAGG + Intergenic
1182726648 22:32452246-32452268 CTCAATAAATACTTGTTGAATGG + Intronic
1182753490 22:32660094-32660116 CTCAATGCATGGATGTTCAATGG - Intronic
1182938730 22:34253415-34253437 CTCAATTAAAAGATATACACTGG - Intergenic
1183001140 22:34860184-34860206 CTCAATAAAGATTTGTATAAAGG + Intergenic
1183007807 22:34917999-34918021 CTCAATAAATATTTGTTAAATGG + Intergenic
1183257926 22:36775027-36775049 CTCAATAAATACTTTTAGAATGG - Intronic
1183344945 22:37302290-37302312 CTCAATAAATAGTTGTAGGTAGG + Intronic
1184353358 22:43960386-43960408 CTCAATAAATATTTGTGGAATGG - Intronic
950291456 3:11787823-11787845 CTCAAGAAATAAATGTACTTTGG - Intergenic
951524706 3:23642771-23642793 CTCAATAAATAAATAAATAAGGG + Intergenic
951864919 3:27297576-27297598 CTCAACAAATATATCTATAATGG + Intronic
953720631 3:45351795-45351817 CTCAATAAATACTTGTTGAATGG - Intergenic
953901979 3:46848697-46848719 TTCAATAAATGCATGTAGAAGGG + Intergenic
955105689 3:55895692-55895714 CTCAATAAATACCTATGCAATGG + Intronic
955468322 3:59259128-59259150 CTGAATAAATATATTTAAAATGG + Intergenic
955681748 3:61508664-61508686 GTCAAGAAGTAGATGTAAAAAGG - Intergenic
956000390 3:64723873-64723895 CTCAATAAATAATTGTAGAAGGG - Intergenic
956904251 3:73749588-73749610 CTCAATAAATATTTGTAGAATGG - Intergenic
957430442 3:80098627-80098649 CACAATATATAAATGAACAAGGG + Intergenic
957609066 3:82443937-82443959 ATAAATAAATAGATGTTAAAGGG + Intergenic
958064872 3:88530312-88530334 CTAGATAAATGGATGAACAAGGG - Intergenic
958512517 3:95066566-95066588 CTCAATTAAAAAATGGACAAAGG + Intergenic
959337569 3:105085255-105085277 AACAATAAATAAATGTAAAAAGG - Intergenic
960483449 3:118222093-118222115 CTCAATTAAAAAATGGACAAAGG + Intergenic
960663904 3:120092176-120092198 CTCCATAAATAGAGATACACTGG + Intronic
960785311 3:121367205-121367227 CTCAATAAAGACAAATACAAGGG - Intronic
961965980 3:130903411-130903433 CTAAATAACTACAGGTACAATGG - Intronic
962083814 3:132169462-132169484 ATCAATAAATGAATGAACAATGG - Intronic
963190125 3:142461320-142461342 TTCAATGAATAAATGTAGAAAGG - Intronic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
964516265 3:157511792-157511814 ATAAATACATAGATGTAGAAAGG - Intronic
965143418 3:164867566-164867588 CTCAATAAATATTTGTCAAATGG - Intergenic
967376962 3:188815109-188815131 CTAAATAAATACTTGTCCAATGG + Intronic
967443912 3:189542578-189542600 CTCCAGAAGTAGATGTACATTGG + Intergenic
967532587 3:190566208-190566230 CTCAATACATAGGTGTTAAATGG + Intronic
968195687 3:196704269-196704291 CCCAATAAAAAAATGAACAAAGG + Intronic
968821843 4:2859450-2859472 CTCAACAGATATGTGTACAAAGG + Intronic
969964674 4:10982062-10982084 TTGAATAAATAGATGAACAAAGG - Intergenic
971174803 4:24271855-24271877 CTCAATACATAGATGTATTGAGG - Intergenic
971688539 4:29802952-29802974 ATCAATAAATATATGTGAAAAGG + Intergenic
973184397 4:47307883-47307905 TTCATTAAATAGATGAAAAATGG - Intronic
973219756 4:47711747-47711769 CTCAATGAATAGATCAACAATGG - Intronic
974007944 4:56578201-56578223 ATGAATAAATAAAAGTACAAAGG + Intronic
974068987 4:57107234-57107256 CTCAATAAATGCATGTTAAATGG + Intronic
974249499 4:59366146-59366168 CTCAATACATAGTTGTTAAATGG - Intergenic
974264836 4:59572185-59572207 CTCAAAGATTAGAAGTACAATGG + Intergenic
974522720 4:63005828-63005850 CTCAATAAATAAATTTAAAATGG + Intergenic
975019596 4:69469888-69469910 CCAAATAAATACATTTACAATGG + Intergenic
975065573 4:70059235-70059257 CTCAATAAATTTTTGTTCAATGG - Intergenic
976388459 4:84485004-84485026 CATAATAATCAGATGTACAAGGG + Intergenic
977178381 4:93842082-93842104 CTCAGAAAATAAATGTTCAAAGG - Intergenic
977947920 4:102935158-102935180 CTCAACAAAAAAATGGACAAAGG + Intronic
978433420 4:108657270-108657292 CTCAATAAATATCTGTTGAATGG + Intronic
978979913 4:114930835-114930857 TGTTATAAATAGATGTACAATGG - Intronic
979842650 4:125464504-125464526 ATAAATAAATAGATATACAAAGG - Intronic
980954822 4:139417526-139417548 CTCAATAAATATTTGTAGAGTGG - Intronic
980975124 4:139603996-139604018 CTCAATAAATATATGTGAGATGG - Intronic
981036135 4:140170674-140170696 CTAAATGAATAAATTTACAAAGG - Intergenic
981086030 4:140684828-140684850 CTCAATAAATAAATAAATAAAGG + Intronic
981435604 4:144717964-144717986 CTCAATAAATATTTGTAGAATGG - Intronic
981820958 4:148887247-148887269 CTTAATAAATATTTGTAGAATGG - Intergenic
982338448 4:154267664-154267686 CTACATTCATAGATGTACAAAGG - Intronic
982366509 4:154585284-154585306 CTCAATAAATACATGTTAAATGG - Intronic
982587921 4:157266141-157266163 TTCAATAAATAGCTCTAAAACGG - Intronic
982983955 4:162180213-162180235 ATGAATAAATATATGTAAAATGG + Intergenic
983260894 4:165455435-165455457 TTCAGTAAATAAATGCACAAAGG + Intronic
983337177 4:166411804-166411826 CTCAATAAATATTTGTTCACTGG + Intergenic
983434951 4:167701347-167701369 CTGAATAAATGGCTATACAATGG + Intergenic
983521426 4:168712950-168712972 AACAATAAAGTGATGTACAAAGG - Intronic
984107781 4:175571657-175571679 CTCCATAAATACATGTAAACGGG + Intergenic
984539030 4:181014056-181014078 CTCAATAAGTATATGAAAAAAGG + Intergenic
984960748 4:185095122-185095144 CTCAATAAATGTCTGTAGAAAGG - Intergenic
985004634 4:185521831-185521853 CTCAATAAATAGCTGACAAATGG - Intronic
985438156 4:189954043-189954065 CTCAATAGAAAAATGGACAAGGG + Intronic
986587088 5:9329729-9329751 ATAAATAAATAAATGTACAAAGG - Intronic
987028852 5:13956338-13956360 CTCATTAAATATATGTTGAATGG + Intergenic
987532278 5:19136811-19136833 CTGATTAAATAGATCAACAAGGG + Intergenic
987638436 5:20578170-20578192 TTCAATAAATAGGTGTTCAGTGG + Intergenic
987638549 5:20579661-20579683 TTCAATAAATAGGTGTTCAGTGG - Intergenic
987943744 5:24576677-24576699 CTAAATAAATAAATGAACAGGGG + Intronic
987988283 5:25178295-25178317 CACAATAAAAAGATGATCAAGGG - Intergenic
988045364 5:25944498-25944520 CTCATTAAATAGACTTACCAGGG + Intergenic
988508827 5:31848372-31848394 CTGAATAATTAAATGTATAAAGG + Intronic
990164544 5:52979828-52979850 CTCAATAAATACATGCTGAATGG + Intergenic
990414623 5:55574422-55574444 CAAAATAAATAAATGCACAAAGG + Intergenic
990749418 5:58997483-58997505 CTCAATTAATATATTTAGAAGGG + Intronic
991616494 5:68502190-68502212 CTCAATAAATGCTTGTAAAATGG - Intergenic
991684652 5:69170368-69170390 CTCAATAAATGTTTGAACAATGG + Intronic
992880184 5:81100540-81100562 CCCTATAAATAGATGAAAAAGGG - Intronic
993236819 5:85321416-85321438 CCCAATTAAAAGATGGACAAAGG + Intergenic
993323769 5:86508326-86508348 CTCAAAAAATATTTGTAGAAAGG + Intergenic
993861248 5:93139579-93139601 CCCAATAAATAGTTGTACTCTGG - Intergenic
994169408 5:96642308-96642330 CTCAATAAATATTTGTTAAATGG + Intronic
995005620 5:107191461-107191483 ATCAATAAATGTCTGTACAAAGG - Intergenic
995766745 5:115627056-115627078 CTCCATAAATATATGTAAAATGG - Intronic
995801831 5:116005042-116005064 TTCAATAAGTAAATCTACAATGG - Intronic
995802787 5:116017528-116017550 CACAATAAATAAAAGGACAAAGG - Intronic
996248475 5:121295793-121295815 CTCAATAAATAAATAAATAAGGG + Intergenic
996689616 5:126325774-126325796 CTCAAAAAAGAGAAGTACCAAGG + Intergenic
998260291 5:140625745-140625767 CTCAATAAATAATTGTTAAATGG + Intergenic
998322318 5:141244290-141244312 CTCAATAAATATTTGTTAAATGG - Intergenic
998661604 5:144245082-144245104 ATAAATAAATAAATGTACAATGG - Intronic
998668619 5:144328150-144328172 CTCAATAAATATTTTTAGAAAGG + Intronic
999070788 5:148741380-148741402 GTCAATAAATAGCTGTTAAATGG + Intergenic
999292522 5:150435734-150435756 CTCAAAAAAAAAAAGTACAATGG + Intergenic
999622128 5:153484378-153484400 CTCAATAAATACATATTAAAAGG - Intergenic
999692792 5:154163184-154163206 CTCAATAAATATTTGTTTAATGG - Intronic
999801434 5:155041596-155041618 CTCAATAAATAAATGTTGAGTGG + Intergenic
999962602 5:156772941-156772963 ATCAATACATATATGAACAAAGG + Intergenic
1000800568 5:165720910-165720932 TTCATTACATAGATGTAAAAAGG + Intergenic
1000865875 5:166514115-166514137 ATCAATAAAGGGATGAACAAAGG - Intergenic
1001045483 5:168368307-168368329 CTCAATAAATATTTGTGCAATGG - Intronic
1001045734 5:168370199-168370221 CTCAATAAGTATTTGTGCAACGG - Intronic
1001333629 5:170779895-170779917 CTAAATAAATTAATGTACACAGG - Intronic
1004061746 6:12204668-12204690 CTCAATAAATAGTTGTGAATGGG - Intergenic
1004570896 6:16844019-16844041 TTCAATACATAGCTGTAGAAAGG - Intergenic
1005124101 6:22426125-22426147 CTTAATAAATATTTGTAGAATGG + Intergenic
1005385788 6:25282946-25282968 TTCAACAAATAAATGTACATAGG - Intronic
1005795223 6:29353339-29353361 CTGAATAAATATATGAACATGGG - Intergenic
1006269312 6:32951626-32951648 CTCAAAAAATATATATATAAAGG + Intronic
1006887261 6:37392769-37392791 CTCTAAAGATATATGTACAAGGG - Exonic
1006990203 6:38208796-38208818 CTCAATAAATAGTTGTTGAATGG - Intronic
1008028318 6:46664212-46664234 CTCTATAGATAGATGAAGAATGG - Intronic
1008966579 6:57318697-57318719 CTCAATAAATACTTGTTGAATGG - Intronic
1009692312 6:67051613-67051635 ATCAGTAAATGGATGTATAAAGG - Intergenic
1009914980 6:69983152-69983174 CTAAATAAATAGATATATTATGG - Intronic
1010871235 6:81043688-81043710 TGCAATAAAGAGATGTCCAAAGG + Intergenic
1011193627 6:84762208-84762230 CTAAATAAATACCTGGACAAGGG + Intronic
1011943725 6:92874345-92874367 CTTAATAGATAAATGAACAAAGG - Intergenic
1012294013 6:97496732-97496754 CTCAGAAGATAGATGTTCAAGGG + Intergenic
1012891765 6:104905190-104905212 CTCAGTAAATAGGAATACAAGGG - Intergenic
1012985007 6:105866296-105866318 CTCAATAAATATCTGTTGAATGG + Intergenic
1014735119 6:125084832-125084854 CTCAATAAATATCTGTTAAATGG - Exonic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1014793151 6:125697843-125697865 CTCAATTAATAAATGAGCAAAGG + Intergenic
1014797340 6:125741044-125741066 CTCAATAAATGGTTGATCAATGG + Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017801506 6:157900288-157900310 CTCAATTAAAAAATGGACAAAGG - Intronic
1020699659 7:11463954-11463976 AGCAAAAAATAGAAGTACAATGG - Intronic
1021052339 7:16003530-16003552 CTCATTAAATATTTGTAAAATGG - Intergenic
1022585661 7:31606320-31606342 CTCAATAAATGTTTGTTCAATGG + Intronic
1022734038 7:33059635-33059657 CCCAATTAATAGATGAAAAATGG + Intronic
1023574910 7:41617413-41617435 CTCAATAAATATTTGTTGAATGG - Intergenic
1023710196 7:42984374-42984396 CTCTATAAATAGAACTACAAAGG - Intergenic
1024020943 7:45368430-45368452 CTCAACTAAAAAATGTACAAAGG - Intergenic
1024128318 7:46323512-46323534 ATAAATAAATAAATGTGCAAAGG - Intergenic
1025586879 7:62800942-62800964 ATAAATAAATAAAAGTACAATGG + Intergenic
1025994797 7:66521179-66521201 CTCAAGAAATACATGTAAAGGGG - Intergenic
1026449485 7:70514946-70514968 CTCAATAAAAATATGGACAAAGG - Intronic
1026811039 7:73465236-73465258 CTCTATATATAGATGGCCAAAGG + Intronic
1026986420 7:74557826-74557848 CTCAAGAAATACATGTAAAGGGG - Intronic
1027523301 7:79235920-79235942 CTCAATAAACAGTTGTTAAAAGG + Intronic
1028004415 7:85545191-85545213 ATCAATAAATATATGTTAAATGG + Intergenic
1028170388 7:87588967-87588989 CCCAATAAAAAGATGGGCAAAGG - Intronic
1028509150 7:91603427-91603449 TTCAATAAAATGATGTTCAAGGG - Intergenic
1028635580 7:92985480-92985502 ATCAATAAATAGCTATACTATGG + Intergenic
1028658907 7:93244186-93244208 CTCAATAAATATTTGTTGAATGG - Intronic
1028730473 7:94142320-94142342 CTCAATAAATATTTGTGGAAGGG - Intergenic
1031562184 7:123251721-123251743 CTCAATAAAGATTTGTAGAATGG - Intergenic
1031970813 7:128063606-128063628 TTCAATAAATAGATGAGGAAAGG - Intronic
1032611042 7:133414271-133414293 GTCAATCAATAGGTGTAAAATGG - Intronic
1032897711 7:136269910-136269932 ATCTATAAATAGATGAAAAATGG + Intergenic
1033425118 7:141236962-141236984 CCCAATAAATAAATGCATAAAGG + Intronic
1035094057 7:156338940-156338962 GTCAATGGATAGATGTACATTGG + Intergenic
1036573375 8:10001766-10001788 CTCAATAAATAATTGTGGAATGG + Intergenic
1039174561 8:34788460-34788482 CTATATATATATATGTACAATGG - Intergenic
1039533599 8:38287146-38287168 CTACAGAAATAGATGCACAAAGG + Intronic
1039862747 8:41472992-41473014 CTCTAAAAATAGATATAAAAAGG + Intergenic
1040538005 8:48326422-48326444 CTCAAGAAATATTTGTTCAAAGG - Intergenic
1040666610 8:49641513-49641535 TTCAAAAAATAGAGATACAAGGG - Intergenic
1041162962 8:55063480-55063502 CTCCAAAAATAGATTTACAAAGG + Intergenic
1041259585 8:56009339-56009361 CTCAATAAATAAATTTAGCATGG - Intronic
1041405719 8:57497097-57497119 ACCAATAAAAAGATGTACATGGG - Intergenic
1041480944 8:58318882-58318904 TTCAATAAATAAATGAACAAAGG + Intergenic
1041661061 8:60401536-60401558 CTCATTAAATAGAGGTGCAAAGG - Intergenic
1042017720 8:64334575-64334597 CTTAATAGATAAATGAACAAAGG + Intergenic
1042323754 8:67506353-67506375 AACAATAAAGAGATGAACAAGGG - Intronic
1042505391 8:69554269-69554291 CTCTATAAATAGATGTTTATAGG - Intronic
1043084138 8:75806212-75806234 CTCAATAAATATGTGTTAAATGG - Intergenic
1044051650 8:87513482-87513504 CTGAATACATAGATGTTTAAGGG + Intronic
1045136380 8:99223616-99223638 TTCAATAAATAATAGTACAAAGG + Intronic
1045489654 8:102658415-102658437 CTCAACAAATAGTTGTCGAATGG - Intergenic
1045783366 8:105894579-105894601 TTGAATAAATAAATGTAGAAGGG + Intergenic
1046144254 8:110136676-110136698 CTCAACAAATATTTGTAGAATGG - Intergenic
1046680776 8:117167748-117167770 CTAAAAATATATATGTACAAGGG - Intronic
1046726623 8:117681974-117681996 CTCAATAAATCTCTGTACAAGGG + Intergenic
1046910864 8:119624988-119625010 CTTAATAAATTGAGGAACAAAGG + Intronic
1047364217 8:124197528-124197550 CTGAATAAATGAATGAACAAAGG + Intergenic
1047397443 8:124514569-124514591 CTCCATAAATATTTGTTCAATGG + Intronic
1047477258 8:125245280-125245302 CTCAATAAATAAATAAATAAAGG + Intronic
1047555549 8:125925267-125925289 CTCAATAAATATATGTTGAATGG - Intergenic
1048268814 8:133011726-133011748 TTCAATAAATACTTGTAGAATGG + Intronic
1048503887 8:135003487-135003509 CTCAGTAAATATTTGTAGAATGG - Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1050140109 9:2508799-2508821 TTAAGTAAATAGATGGACAATGG - Intergenic
1050695006 9:8268999-8269021 CTAAATAAATAGTTGAATAATGG - Intergenic
1051195485 9:14559161-14559183 CTCAATCAATAGCTAGACAATGG + Intergenic
1052977011 9:34418757-34418779 CTTTAAAAATAGATCTACAATGG + Intronic
1053036487 9:34831158-34831180 CACAATGAAGAGATGTAGAAGGG + Intergenic
1053805973 9:41802269-41802291 ATAAATAAATAGATAAACAAAGG - Intergenic
1055592183 9:77828652-77828674 ATCAATAAATATTTCTACAATGG + Intronic
1055706417 9:79010166-79010188 TTCAATAAATACCTGTAGAATGG + Intergenic
1055927720 9:81527613-81527635 CTCAATAAATAAATAAATAAAGG + Intergenic
1057617984 9:96609515-96609537 CTCAATAAATACTTGTTGAATGG + Intronic
1057730870 9:97607163-97607185 CTCAAAAAATATATATACAAAGG + Intronic
1058728089 9:107822960-107822982 TTAACTAAATAGATGTAAAACGG - Intergenic
1059924974 9:119200308-119200330 ATTAATAAATAGATTTAAAAAGG + Intronic
1062248072 9:135579929-135579951 GTAAATAAATGGATGGACAATGG - Intergenic
1185684179 X:1914490-1914512 CTAAATAAAAATATTTACAAAGG + Intergenic
1186423097 X:9442549-9442571 ATCAATAAATAGTTGAACACAGG - Intergenic
1186911396 X:14171433-14171455 CCCAATCAAAAGATGTACAGTGG - Intergenic
1187804647 X:23105942-23105964 CACAATAAATTGAGGTATAAAGG + Intergenic
1187948991 X:24453518-24453540 CCAAATAAATAGAAGTATAAAGG + Intergenic
1188073196 X:25743281-25743303 CCAAATAAATACATATACAATGG - Intergenic
1188287840 X:28350295-28350317 ATAAATAAATAGATATACAGAGG + Intergenic
1188742002 X:33795935-33795957 CCAAATATATAGATGTACACTGG - Intergenic
1189057482 X:37713568-37713590 CTCAGTAAAAAGAAGTACACAGG - Intronic
1189064575 X:37793674-37793696 CACATTAAATAGATGTGCAATGG - Exonic
1189177662 X:38974162-38974184 CTCAATAAATATTTGTTGAATGG - Intergenic
1189769800 X:44414109-44414131 TCCAATAAAGAAATGTACAATGG - Intergenic
1190731494 X:53229354-53229376 ATAAATAAATAAATGTAGAAGGG + Intergenic
1190800406 X:53783279-53783301 ATAAATAAATAAATGTAGAAGGG + Intergenic
1192113442 X:68388548-68388570 CTCAATAAATAGCTGTTGAATGG - Intronic
1192377835 X:70582713-70582735 ATAAATAAATAAATGTACATAGG - Intronic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1194517444 X:94872682-94872704 CCCAATCAAAAGATGTACACTGG + Intergenic
1194567513 X:95510711-95510733 CTCAATAAATATTTGTTGAATGG - Intergenic
1195973483 X:110499260-110499282 CTCAATAAATAGTTTTTGAATGG + Intergenic
1196254520 X:113500657-113500679 CTCAAAGAATAAATGTTCAAGGG - Intergenic
1196812790 X:119641946-119641968 CTCAGTAAATATTTGTAGAATGG - Intronic
1197480150 X:126973775-126973797 CCCAATAAAAAGATATAGAATGG + Intergenic
1197922962 X:131615007-131615029 CTCAATAAATATTTGTTGAATGG + Intergenic
1198212186 X:134526701-134526723 CTCAATAAATAAATAAATAATGG - Intergenic
1198576877 X:138020219-138020241 CCCAATAAATGAATGAACAAAGG - Intergenic
1199856892 X:151766612-151766634 CTCAATAAATAGTTGTTAAATGG + Intergenic
1200039044 X:153352902-153352924 TTCAATAAATATATGTTAAATGG + Exonic
1201183341 Y:11371871-11371893 CTCAACAAAAAAATGGACAAAGG + Intergenic