ID: 1081292104

View in Genome Browser
Species Human (GRCh38)
Location 11:41339013-41339035
Sequence TTGGGCTGTTAGGAAGCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 1, 2: 0, 3: 18, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081292104 Original CRISPR TTGGGCTGTTAGGAAGCTTC TGG Intronic
900670664 1:3852249-3852271 TTGGGCTGGGAGGCAGCCTCGGG - Intronic
902143119 1:14373561-14373583 TTGGGCTGTGAGGGCGTTTCTGG - Intergenic
905181835 1:36172115-36172137 TTGGGGTGGCAGGAGGCTTCTGG - Intronic
905919364 1:41709302-41709324 CTTGGCTGTTAGGAGGCTTTGGG - Intronic
908500276 1:64736491-64736513 TTTGGCCATTAGGAAGCTTCTGG - Intergenic
910086178 1:83405325-83405347 TTGGGCAGGTAGGAAACCTCAGG - Intergenic
913358927 1:117957365-117957387 TTGGGCTGGTAGCAAACTTCTGG - Intronic
920183183 1:204145129-204145151 TTGGGCAGTCAGGCAGCTTAGGG + Intronic
922941137 1:229467537-229467559 CTGGGCTGTTAGGATGCCTTTGG - Intronic
923293250 1:232567960-232567982 TTCAGCTGTCTGGAAGCTTCTGG - Intergenic
924047301 1:240044888-240044910 TTGGGCAGTTGTGAAACTTCTGG + Intronic
924084837 1:240440289-240440311 TGGGGCTGTGAGGATGCTTAGGG - Intronic
1064901683 10:20302087-20302109 TTGGGCCCCTAGGTAGCTTCAGG - Intergenic
1069948151 10:72001417-72001439 TTGGGCTGTTATGTAGTTGCTGG + Intronic
1072211467 10:93250401-93250423 TGGGGCTGTTGGGAAGCTCAGGG - Intergenic
1074154215 10:110784188-110784210 TAGGGCTGCTAGGAAGGTTTGGG + Intronic
1074438242 10:113452777-113452799 TTGTGCTGTGAGGAGACTTCAGG + Intergenic
1077598591 11:3556408-3556430 TTGGGATGTGAGGATGCTGCAGG - Intergenic
1079680695 11:23293774-23293796 TTGGCCTCTGGGGAAGCTTCAGG + Intergenic
1080765304 11:35290966-35290988 TTGGTCTGTTAGGTCGCTTAAGG + Intronic
1081292104 11:41339013-41339035 TTGGGCTGTTAGGAAGCTTCTGG + Intronic
1083274723 11:61590314-61590336 CTGGGCATTTGGGAAGCTTCAGG - Intergenic
1084254673 11:67932280-67932302 TTGGGATGTGAGGATGCTGCAGG - Intergenic
1084818200 11:71663607-71663629 TTGGGATGTGAGGATGCTGCAGG + Intergenic
1085644553 11:78214535-78214557 GTGGGCTCTTAGGAAGCCTGTGG + Exonic
1087822488 11:102728227-102728249 CTGGGTTGTTATGAAGCTTAAGG - Intergenic
1089568171 11:119383555-119383577 TTTGGCTTTTATGAAGCTACTGG + Intergenic
1090965846 11:131597214-131597236 TTGGGCCCTTAGGAAACTTAGGG + Intronic
1092424739 12:8365759-8365781 TTGGGATGTGAGGATGCTGCAGG - Intergenic
1093499557 12:19796636-19796658 TTGAGTTTTGAGGAAGCTTCAGG + Intergenic
1096070873 12:48774888-48774910 GTGGGTATTTAGGAAGCTTCTGG + Intronic
1100898565 12:99213130-99213152 TTGGGCTTTTGTGAAGCTGCAGG - Intronic
1103707607 12:122886896-122886918 TTGGGTTGCTAGGAAACTTTGGG - Intronic
1105236871 13:18564904-18564926 TGTGGCTCTCAGGAAGCTTCAGG - Intergenic
1106355337 13:28976760-28976782 ATCAGCTGTTAGGAAGCATCAGG + Intronic
1110403562 13:75122403-75122425 CTAGGCTGTTAGGGAGCTGCAGG - Intergenic
1113574792 13:111387609-111387631 TTGTGCTGTTTGGAAGTTGCTGG + Intergenic
1114676032 14:24440911-24440933 CTGGGCTGGTAGTAAGCTGCCGG + Exonic
1117264884 14:54076618-54076640 TTGGGCTGTAAGGGAACATCAGG - Intergenic
1117473763 14:56073145-56073167 TTGTTTGGTTAGGAAGCTTCTGG - Intergenic
1122086185 14:99307223-99307245 TGGGGCTATGAGGGAGCTTCTGG + Intergenic
1122243441 14:100384070-100384092 TTGGGCTGCCAGGCAGCTTCTGG + Intronic
1123506284 15:20942944-20942966 TAGGGTGGGTAGGAAGCTTCGGG + Intergenic
1123563510 15:21516648-21516670 TAGGGTGGGTAGGAAGCTTCGGG + Intergenic
1125784035 15:42299511-42299533 TTGGGCAGTAAGAAAACTTCAGG - Intronic
1128753960 15:70168803-70168825 TTGGGCATTTTGGAATCTTCTGG + Intergenic
1202971868 15_KI270727v1_random:243785-243807 TAGGGTGGGTAGGAAGCTTCGGG + Intergenic
1132639999 16:973582-973604 TTGGGCTGATGAGAATCTTCTGG + Intronic
1136086609 16:27889886-27889908 GCAGGCTGTTAGGAAGATTCGGG - Intronic
1139418857 16:66835880-66835902 TTGGGCTGTCAGGAAGTTTGGGG + Intronic
1143765203 17:9133226-9133248 TTGGTCTGTTAAGAATCTACTGG + Intronic
1144747676 17:17626586-17626608 TTTGGCTGCGAGGAGGCTTCGGG + Intergenic
1146278052 17:31527663-31527685 TTTGGCTGATAGGAAGCTCACGG + Intronic
1146304916 17:31723515-31723537 CTGAGCTCTTAGGAAACTTCTGG + Intergenic
1147817002 17:43217498-43217520 TAGGGCTGTCTGGAAGCTGCTGG + Intronic
1148630770 17:49106648-49106670 TGGGGCTGGGAAGAAGCTTCGGG - Intergenic
1148965863 17:51435541-51435563 TTGGGCAGTTACGCAGCTGCTGG + Intergenic
1149285659 17:55161344-55161366 TTTGAATGTTAGGAAGCTTCGGG + Exonic
1151199894 17:72460182-72460204 TCTTGCTCTTAGGAAGCTTCGGG + Intergenic
1152162938 17:78680630-78680652 TTGGGCTGTCAGGATGTTACTGG - Intronic
1153183672 18:2464081-2464103 TTGGTCTGTTGGGAGGCTTCTGG - Intergenic
1154170218 18:12046152-12046174 TTGGGTGGGTAGGAAGCTTCAGG - Intergenic
1154172605 18:12062095-12062117 TTGGGTGGGTAGGAAGCTTCGGG + Intergenic
1154512671 18:15125010-15125032 TGTGGCTCTCAGGAAGCTTCAGG + Intergenic
1157296751 18:46450493-46450515 TATGGGTGTCAGGAAGCTTCAGG + Intronic
1161087143 19:2340468-2340490 CTGGGCTGTGGGGAACCTTCTGG - Intronic
1161361722 19:3853717-3853739 TTGGGCCGATAGGAATGTTCTGG + Intronic
1163939424 19:20478507-20478529 GTGGGCTGTTACCAAGCTTCTGG + Intergenic
1163993674 19:21022839-21022861 TGGGGCTGACAGGAATCTTCTGG + Exonic
1164027053 19:21361816-21361838 TGGGGCTGAGAGGAATCTTCTGG + Exonic
1165804227 19:38570808-38570830 TTGGGTCGTTAGGAGGGTTCAGG + Intronic
1165951091 19:39474274-39474296 CTGGGCTGGTAGGAACCTTGTGG - Exonic
1166554856 19:43691773-43691795 TTGGGCTGGCAGCATGCTTCTGG + Intergenic
925155709 2:1647778-1647800 TGTGGCTGTTGGGCAGCTTCGGG - Intronic
926567951 2:14498509-14498531 TCGAGTTGTTAGGAATCTTCTGG - Intergenic
928456949 2:31430938-31430960 TTGGGCCTTGAGGAAGCTCCTGG - Intergenic
929077624 2:38091564-38091586 TTGGGCTGTTAGGAATTTGCAGG - Intronic
932226711 2:70047114-70047136 TTGAGGTGTTAGTAAGCATCAGG + Intergenic
932894212 2:75623011-75623033 TTGGGCCATTAGGCAGCTTGTGG - Intergenic
934153100 2:89168537-89168559 TTGCTCTTTGAGGAAGCTTCAGG + Intergenic
934214140 2:90013394-90013416 TTGCTCTTTGAGGAAGCTTCAGG - Intergenic
936145436 2:109977738-109977760 GTAGGCTCCTAGGAAGCTTCAGG + Intergenic
936199250 2:110393740-110393762 GTAGGCTCCTAGGAAGCTTCAGG - Intergenic
937334929 2:121056436-121056458 GTGGGCTGTTAGGAAGAGTCTGG - Intergenic
937771378 2:125724164-125724186 TTGGGCAATTATAAAGCTTCAGG + Intergenic
938512914 2:131969645-131969667 TGTGGCTCTCAGGAAGCTTCAGG + Intergenic
938955094 2:136289952-136289974 ATGGGCTGTTTGCAAGCTTCAGG + Intergenic
942626711 2:177908768-177908790 TTGGGCTGTTCCTAGGCTTCCGG - Intronic
943267829 2:185758374-185758396 GTGGGCTGTTAGTAAGTTTCTGG - Intronic
945344566 2:208697650-208697672 TTGGGCTGTGAAGAAGCTGTTGG - Intronic
1169660118 20:7969356-7969378 TTAGTCTTTTAGAAAGCTTCTGG + Intergenic
1169728755 20:8764208-8764230 GTGGGCTGCTAGTAAGCCTCTGG + Intronic
1170994028 20:21334736-21334758 TTGGGCAGTTAGGAATTTGCTGG + Intronic
1176780857 21:13193189-13193211 TGTGGCTCTCAGGAAGCTTCAGG - Intergenic
1178980073 21:37256319-37256341 TTGGGATGTGAGGAAGAGTCAGG + Intronic
1179721813 21:43320620-43320642 TGGGGCTGTGAGGGAGCCTCTGG - Intergenic
1180746465 22:18092352-18092374 TCGGGCTGGTAGGAAGCTACAGG + Exonic
1181361326 22:22339503-22339525 TTGGATTGTTAGGATGCTGCAGG - Intergenic
1181364617 22:22366148-22366170 TTGGTCTGTTAGGATGCTGTGGG - Intergenic
1181374579 22:22446625-22446647 TTGGCCTCTTAGGAAGCTGCAGG - Intergenic
1181377343 22:22470189-22470211 TTGGCCTGTTAGGATGCGTCAGG - Intergenic
1182935942 22:34221630-34221652 CTGGGCTGTCAGCAAGCTTCAGG + Intergenic
1183773671 22:39948332-39948354 TTGGGGTCTTACGAAGCTCCTGG + Intronic
949179156 3:1106104-1106126 TTGGTATGTTAGGAAAATTCAGG + Intronic
950551436 3:13668617-13668639 TTGAGTCTTTAGGAAGCTTCTGG + Intergenic
950751858 3:15135441-15135463 TTGGGATGTTAGGATGCTGCAGG + Intergenic
952669582 3:35949910-35949932 TTGGCCTGTGGGGAAGCCTCAGG - Intergenic
952979825 3:38725740-38725762 TGGGGCTCTTAGGGAGCTCCAGG - Intronic
954201764 3:49027528-49027550 TTGGGCAGTTTGAAAGCCTCTGG + Intronic
954925326 3:54229005-54229027 TTGTGCTGTATGGAAGATTCAGG + Intronic
956025209 3:64976139-64976161 CTGGACTGTGAGGAAGATTCGGG - Intergenic
957068755 3:75548863-75548885 TTGGGATGTGAGGATGCTGCAGG - Intergenic
960907417 3:122615345-122615367 TTTGGCTGTTAGGTACATTCTGG - Intronic
969013083 4:4083400-4083422 TTGGGATGTGAGGATGCTGCAGG - Intergenic
969243577 4:5918073-5918095 TTCTGCTGTCAGGAAGCTCCGGG + Intronic
969267426 4:6073663-6073685 ATGGGATCTAAGGAAGCTTCTGG - Intronic
969740760 4:9024390-9024412 TTGGGATGTGAGGATGCTGCAGG + Intergenic
969800099 4:9557222-9557244 TTGGGATGTGAGGATGCTGCAGG + Intergenic
971162901 4:24151929-24151951 TTGTGGTCTTAGGAAGCATCTGG + Intergenic
972135304 4:35885581-35885603 TTGGGTTTTTGGGAAGCCTCAGG - Intergenic
976051343 4:81014587-81014609 TTGCGGTGTTGTGAAGCTTCTGG - Intergenic
978691124 4:111511873-111511895 TTGGCCTGTCAGGAAGTGTCGGG + Intergenic
979178188 4:117691786-117691808 ATGGCCAGATAGGAAGCTTCTGG - Intergenic
979318926 4:119300542-119300564 TAGGGTTGTTACGAAGCTGCAGG - Exonic
984837940 4:184039843-184039865 TTAGGCAGTTAGAAAGTTTCTGG - Intergenic
988047709 5:25979925-25979947 TTGGGCTGTTACAAAGTCTCAGG - Intergenic
996905446 5:128594841-128594863 TTGGGCAGTCAGAAAGGTTCTGG + Intronic
997145289 5:131426594-131426616 TTGAGGTGTTAGGAACCTGCTGG - Exonic
998548295 5:143050907-143050929 TTTGCCTGTTGGGATGCTTCAGG + Intronic
1000071268 5:157743400-157743422 TTGAGCTGGCAGGAAGCGTCTGG - Intergenic
1001496130 5:172188523-172188545 CTGGGCTTTGGGGAAGCTTCGGG + Intergenic
1002438690 5:179251932-179251954 TGTTGCTGTTAGGAAGATTCGGG - Intronic
1003148272 6:3527193-3527215 TTGAGCTGTGAGTAAGCGTCCGG + Intergenic
1003843527 6:10148141-10148163 TTGGACTGTTAGGAAGGCTGAGG + Intronic
1003882034 6:10487868-10487890 TTGGGCTGTTGGGGAGGCTCAGG + Intergenic
1007689363 6:43689063-43689085 TTGTGTTGTAAGGAAGCTTATGG + Intergenic
1008091290 6:47296486-47296508 GGGGGCTGCTAGGTAGCTTCTGG + Intronic
1008925236 6:56885207-56885229 TGGGGGTGTGAGGAAGCTTTAGG - Intronic
1010044886 6:71430027-71430049 GTGGTCTCTTAGGAAGATTCCGG + Intergenic
1011413087 6:87086209-87086231 TTGGGCTGTTAGAAAGCTTCTGG + Intronic
1013155514 6:107489210-107489232 TTGGGCTGAGTGGGAGCTTCTGG - Intergenic
1013341108 6:109216885-109216907 GTCAACTGTTAGGAAGCTTCTGG - Intergenic
1018712550 6:166507094-166507116 TGGGGCTGTTCGGGAGCATCGGG - Intronic
1027303055 7:76861789-76861811 TTGGGCAGGTAGGAAACCTCAGG - Intergenic
1027712546 7:81623759-81623781 TTTGTCTGCTAGGCAGCTTCTGG - Intergenic
1029071736 7:97905037-97905059 TTGGGATGTGAGGATGCTGCAGG - Intergenic
1030783074 7:113625599-113625621 TTAGGCTGTTAGTAAGCATTTGG + Intergenic
1031618106 7:123904742-123904764 TTGGCTTCTGAGGAAGCTTCAGG + Intergenic
1032258185 7:130313521-130313543 TTGGGCTTTTATAAGGCTTCGGG + Intronic
1032729831 7:134629628-134629650 GTGGGCTTCTAGGTAGCTTCAGG + Intergenic
1035774927 8:2180859-2180881 ATGGGCAGTGAGGCAGCTTCGGG + Intergenic
1035904241 8:3491934-3491956 CTGGGCTGTGAGCAAGCCTCCGG - Intronic
1036245965 8:7116957-7116979 TTGGGATGTGAGGATGCTGCAGG + Intergenic
1036888305 8:12577070-12577092 TTGGGATGTGAGGATGCTGCAGG - Intergenic
1040580360 8:48693879-48693901 CTGGCCTGTTAGGAAGGTTTGGG + Intergenic
1042425460 8:68643025-68643047 GTGGCCTGTTAGGAACCTCCTGG - Intronic
1046291139 8:112163102-112163124 CTGGGCTTTTAGGAAACTCCAGG + Intergenic
1055415069 9:76072847-76072869 TTGGGCAGTGAGAAGGCTTCTGG - Intronic
1057171218 9:92964417-92964439 TTGGGGTGGTAGGAACATTCAGG + Intronic
1057870743 9:98715101-98715123 TTTGGCTTATAGGAAGCTTGTGG + Intergenic
1057981484 9:99668381-99668403 ATGGCCTGTTACAAAGCTTCAGG + Intergenic
1059599608 9:115762415-115762437 TTGTGCTGTTACTATGCTTCAGG + Intergenic
1061585873 9:131568051-131568073 TTGGGGTGTTGGGAACCTGCTGG + Intergenic
1062036523 9:134384987-134385009 TTGGGCAGGCAGGAAGCTCCTGG + Intronic
1062550313 9:137083049-137083071 TGGGGCTGAGAGGAGGCTTCGGG + Exonic
1186414672 X:9372837-9372859 ATAGGCTGTTGGGAAGCTTGAGG - Intergenic
1189498749 X:41533628-41533650 CTGAGCTGCTAGAAAGCTTCTGG + Intronic
1192426521 X:71081859-71081881 TGGGGCAGTCAGGAACCTTCTGG + Intergenic
1197163762 X:123352855-123352877 ATGAGCTGTTAGGTATCTTCTGG - Intronic
1197540278 X:127751038-127751060 TTGGGCTGTTGTGAAGGTTAAGG + Intergenic
1198115978 X:133545018-133545040 TGGAGCTGTTAGGCAGCCTCAGG - Intronic
1198212901 X:134531666-134531688 TTGGGATGATGGGAAGGTTCTGG - Intergenic
1199612238 X:149628365-149628387 TTTCACTGTTAGGAAGCCTCAGG + Intronic
1200747729 Y:6917127-6917149 TTGTCCTGTTAGGAACCTCCAGG + Intronic