ID: 1081296336

View in Genome Browser
Species Human (GRCh38)
Location 11:41394295-41394317
Sequence AGGAAGGTATAGAGAGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 920
Summary {0: 1, 1: 0, 2: 5, 3: 79, 4: 835}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081296336_1081296340 0 Left 1081296336 11:41394295-41394317 CCAGCTTCTCTCTATACCTTCCT 0: 1
1: 0
2: 5
3: 79
4: 835
Right 1081296340 11:41394318-41394340 TCACTGCACTATTAGAAAGGAGG 0: 1
1: 0
2: 1
3: 5
4: 94
1081296336_1081296339 -3 Left 1081296336 11:41394295-41394317 CCAGCTTCTCTCTATACCTTCCT 0: 1
1: 0
2: 5
3: 79
4: 835
Right 1081296339 11:41394315-41394337 CCTTCACTGCACTATTAGAAAGG 0: 1
1: 0
2: 0
3: 10
4: 113
1081296336_1081296342 2 Left 1081296336 11:41394295-41394317 CCAGCTTCTCTCTATACCTTCCT 0: 1
1: 0
2: 5
3: 79
4: 835
Right 1081296342 11:41394320-41394342 ACTGCACTATTAGAAAGGAGGGG 0: 1
1: 0
2: 0
3: 8
4: 138
1081296336_1081296343 3 Left 1081296336 11:41394295-41394317 CCAGCTTCTCTCTATACCTTCCT 0: 1
1: 0
2: 5
3: 79
4: 835
Right 1081296343 11:41394321-41394343 CTGCACTATTAGAAAGGAGGGGG 0: 1
1: 0
2: 0
3: 12
4: 133
1081296336_1081296341 1 Left 1081296336 11:41394295-41394317 CCAGCTTCTCTCTATACCTTCCT 0: 1
1: 0
2: 5
3: 79
4: 835
Right 1081296341 11:41394319-41394341 CACTGCACTATTAGAAAGGAGGG 0: 1
1: 0
2: 1
3: 12
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081296336 Original CRISPR AGGAAGGTATAGAGAGAAGC TGG (reversed) Intronic
900017411 1:162269-162291 AGGAAGGGAAAGAGAGAAAGAGG + Intergenic
900047670 1:520865-520887 AGGAAGGGAAAGAGAGAAAGAGG + Intergenic
900069884 1:762733-762755 AGGAAGGGAAAGAGAGAAAGAGG + Intergenic
900605901 1:3523418-3523440 AGGGAGGGTTAGAGGGAAGCAGG - Intronic
901433570 1:9233193-9233215 AGGAAGGCACAGATAGAAGTGGG - Intergenic
901905987 1:12411494-12411516 AGGGAGGGATAGAGAGAAGGGGG + Intronic
902459555 1:16563295-16563317 AGGATGGAATCGAGAGGAGCAGG + Exonic
903036071 1:20493390-20493412 GAGAAGGCAGAGAGAGAAGCCGG + Intergenic
904273464 1:29365305-29365327 AGGAAGGGAAAGAGGGAAGGAGG - Intergenic
904422268 1:30402000-30402022 AGGAAGGGATGGAGGGAAGGAGG - Intergenic
905481986 1:38268014-38268036 AGGAAGAAAGAGAGAGAAGGAGG - Intergenic
906838609 1:49111058-49111080 ATGAAGTTAGAGAGAGACGCAGG - Intronic
906942135 1:50264797-50264819 AGGAAGGAAGAGGAAGAAGCTGG - Intergenic
907146263 1:52234625-52234647 AGGAAGGAAGAGAGAGAGGAAGG + Intronic
907354553 1:53861675-53861697 AGGAAGGGAGAGAGAGAGGGAGG + Intronic
907458380 1:54590512-54590534 GGGAAGGTAGAGAGAGAAGGAGG + Intronic
907570034 1:55474809-55474831 AGGAAGGAAAAGAGAGAGGTAGG - Intergenic
907709307 1:56863874-56863896 AGGAAGGAAGGGAGAGAAGGAGG - Intronic
907790984 1:57663179-57663201 AAGAAGGAAGAGAGAGAAGGGGG + Intronic
907954996 1:59219617-59219639 AGGCAGAGAGAGAGAGAAGCTGG - Intergenic
909089111 1:71204002-71204024 AGGAAGGAATAGAGAAAAGAAGG + Intergenic
909994273 1:82259938-82259960 AGGAAGGTGTCAGGAGAAGCAGG + Intergenic
910133367 1:83936254-83936276 AGGCATGTATAGAGAGAATCAGG - Intronic
910408432 1:86914688-86914710 AGGAAGGAAGAGAGGGAGGCGGG + Exonic
910713071 1:90202000-90202022 AGGAAGGAAGAGAGAGAAAGAGG + Intergenic
910741636 1:90525490-90525512 AGGAAGGGAAGGAGAGGAGCAGG + Intergenic
911427662 1:97740934-97740956 AGAGAGGTAGAGAGGGAAGCTGG - Intronic
912302205 1:108529810-108529832 AGGAAGGCATAGGGGGAGGCAGG - Intergenic
912598235 1:110900987-110901009 AGAAAGGAATAGAGAAAAACTGG + Intergenic
912707629 1:111926678-111926700 AGCCAGGCATTGAGAGAAGCAGG - Intronic
912865030 1:113249003-113249025 AGGGAGGGAGGGAGAGAAGCAGG - Intergenic
913373797 1:118129663-118129685 AAGAAGGTAGAGAAAGAAGAAGG - Intronic
913492404 1:119393233-119393255 AAGAAGGGAGAAAGAGAAGCTGG - Intronic
913542406 1:119834598-119834620 AGGATGGAATTGAGAGGAGCAGG + Intergenic
913606034 1:120466847-120466869 AGGATGGAATTGAGAGGAGCAGG - Intergenic
913644221 1:120841219-120841241 AGGATGGAATTGAGAGGAGCAGG - Intronic
914082524 1:144422365-144422387 AGGATGGAATTGAGAGGAGCAGG + Exonic
914210395 1:145573317-145573339 AGGATGGAATTGAGAGGAGCAGG + Intergenic
914269319 1:146065670-146065692 AGGATGGAATTGAGAGGAGCAGG + Exonic
914347958 1:146815860-146815882 AAGAAAGTAAAGAAAGAAGCAGG - Intergenic
914367778 1:146995201-146995223 AGGATGGAATTGAGAGGAGCAGG - Exonic
914439082 1:147687268-147687290 AGGAAGCAAGAGAGAGAGGCAGG - Intergenic
914485202 1:148103021-148103043 AGGATGGAATTGAGAGGAGCAGG + Exonic
914532152 1:148532357-148532379 AGGATGGAATAGAGAGGAGCAGG + Exonic
914585167 1:149055008-149055030 AGGATGGAATTGAGAGGAGCAGG + Exonic
914636244 1:149555364-149555386 AGGATGGAATTGAGAGGAGCAGG - Intergenic
914717853 1:150266711-150266733 AGAAAGGTACAGAGAGAATATGG - Intronic
915246916 1:154562153-154562175 AGGAAGGGAAAGAGACAAGGAGG + Intergenic
915470906 1:156125255-156125277 AGGGAGGGACAGAGAGAAGGAGG + Intronic
915577694 1:156791407-156791429 AGCAAGGTATAGATTGAAGCAGG + Intronic
915684078 1:157613627-157613649 ATGAGGGAATAAAGAGAAGCTGG + Intergenic
915702275 1:157807235-157807257 AGGGAGGAAGAGAGAGATGCAGG - Intronic
915762714 1:158331088-158331110 GTGAAGATAAAGAGAGAAGCAGG + Intronic
915878323 1:159637354-159637376 AGGGAGGGAAAGAGAGAAGGAGG - Intergenic
916480924 1:165213624-165213646 AGGAAGGTATAGGAGGGAGCAGG - Exonic
916588100 1:166165867-166165889 AGGAAGGTTTAGAAAGACGATGG + Intronic
916887810 1:169087066-169087088 AGGAAGGGAGAGAGGGAAGCAGG - Intergenic
916999644 1:170342542-170342564 AGGAAGTTATAGAGAAAATCTGG - Intergenic
917165075 1:172102759-172102781 AGGGAGGAAAAGAGGGAAGCAGG - Intronic
917562088 1:176168796-176168818 TGGAAGGTAGAGAAAGATGCAGG + Intronic
918085732 1:181243715-181243737 AGGAAGGAAGAGAGAGAGGAGGG - Intergenic
918085737 1:181243739-181243761 AGGAAGGAAGAGAGAGAGGAGGG - Intergenic
918187153 1:182138061-182138083 GGCACGGTATTGAGAGAAGCAGG - Intergenic
918532155 1:185535385-185535407 AGAAAGGATTAGAGAGAGGCAGG - Intergenic
918748630 1:188241303-188241325 AGGAAGGAAGAGAGAGGGGCTGG - Intergenic
919061619 1:192641376-192641398 AGGAAGGGAAAGAGGAAAGCAGG + Intronic
919479853 1:198074915-198074937 AGGAAGGGATTGAGAGGAGCTGG + Intergenic
919526765 1:198663218-198663240 AGCAAGGAATAGAGGGAAGCAGG - Intronic
919710823 1:200726401-200726423 AGGAAGGGAGAGAGAGAATGGGG + Intergenic
919816385 1:201443413-201443435 AGGTGTGGATAGAGAGAAGCTGG + Intergenic
920070780 1:203301506-203301528 AGGAAGGGAGAAGGAGAAGCAGG + Intergenic
920154555 1:203937817-203937839 AGGAAGGAAGAGAGAGAAAAAGG + Intergenic
922057444 1:222054970-222054992 AGGAAGGGAAAGAGGGAGGCAGG + Intergenic
922265566 1:223980717-223980739 AGGAAGGGAAAGAGAGAAAGAGG + Intergenic
922286164 1:224172551-224172573 AGGAAAGTAGAGAGGGAAGAAGG + Intergenic
922476461 1:225910206-225910228 GGGAGGATAGAGAGAGAAGCTGG - Intronic
922722688 1:227906650-227906672 AGGAAGGGAGAGGGAGGAGCAGG - Intergenic
922722708 1:227906724-227906746 AGGAAGGGAGAGGGAGAGGCAGG - Intergenic
922968728 1:229716140-229716162 AGGAAGGTGTAGCGGGGAGCGGG - Intergenic
923037211 1:230292622-230292644 AGGAAGGGAAAGAGAGAGGCAGG - Intergenic
923124806 1:231025744-231025766 AGGAAGGAAGGGAGAGAAGGAGG + Intronic
923327005 1:232888888-232888910 AGAAAGGAATAGAGGGAAGGAGG - Intergenic
924005117 1:239600660-239600682 AGGAAGGGAGAGAGGGAAGGAGG - Intronic
924347427 1:243085720-243085742 AGGAAGGGAAAGAGAGAAAGAGG + Intergenic
924460525 1:244254693-244254715 GGGAAGTCACAGAGAGAAGCAGG - Intergenic
1063394946 10:5678004-5678026 AGGAAGGAGGAGAGGGAAGCTGG - Intergenic
1063588001 10:7370209-7370231 AGGAATCTATAGGGAGAAGCCGG - Intronic
1064198542 10:13265257-13265279 AGGAAGGTACATAGAGCAGCCGG + Intergenic
1064210500 10:13357187-13357209 AGGAAGGAAGGGAGAGAAGGAGG - Intergenic
1064612439 10:17117146-17117168 AGGAAAGTAGAGAGAGATGCGGG - Intronic
1064652070 10:17519546-17519568 AGGAAGGGGGAGAGAGAAGGGGG + Intergenic
1065392402 10:25196639-25196661 AGGAAGCTAGACAAAGAAGCTGG + Intronic
1065530608 10:26666087-26666109 AGGAAGGGATGGAAAGAAGGGGG + Intergenic
1066161916 10:32742748-32742770 ATGAAGGTACAGTGAGAAGGTGG - Intronic
1066728926 10:38419154-38419176 AGGAAGGGAAAGAGAGAAAGAGG - Intergenic
1066748291 10:38625256-38625278 AGGAAGGGTGGGAGAGAAGCGGG + Intergenic
1066968392 10:42292517-42292539 AGGAAGGGTGGGAGAGAAGCGGG - Intergenic
1067177382 10:43959629-43959651 AGGGACGTGTAGAGAGAGGCTGG - Intergenic
1067775006 10:49157083-49157105 AGGAAGGGATCTAAAGAAGCTGG + Intronic
1067909577 10:50332385-50332407 AGGATAGGATAGAGAGGAGCAGG - Intronic
1068086071 10:52374931-52374953 AAGAAGGAATCTAGAGAAGCAGG + Intergenic
1068460895 10:57327000-57327022 GAGAAGGAAGAGAGAGAAGCAGG - Intergenic
1069347561 10:67487817-67487839 AGGAAGGTCAAGAGAGAAGCTGG - Intronic
1069863829 10:71488025-71488047 AGAAAGGTACAGAGAGGGGCAGG - Intronic
1069948660 10:72004600-72004622 AGGTAGGTGGAGAGAGAAGGTGG - Intronic
1070065305 10:73027815-73027837 AGGAAGGGAGAGAGAGAGGAAGG + Intronic
1070394893 10:76003366-76003388 AGGATGGTAGAGAGAGAGGGTGG - Intronic
1070400459 10:76048973-76048995 AGGAACTTATAGGGAGATGCAGG + Intronic
1070515968 10:77206788-77206810 AGGAAGGAATAAAGGGAGGCAGG + Intronic
1071372578 10:84967319-84967341 AGGAAGGGATGGAGGGAGGCAGG + Intergenic
1071383866 10:85100240-85100262 ACGAAGGTCTAGAGAGACGAAGG + Intergenic
1071484660 10:86091039-86091061 AGGATGGCAGACAGAGAAGCAGG + Intronic
1072193194 10:93092881-93092903 AGGAAAGAAGAGAAAGAAGCAGG - Intergenic
1072275278 10:93816697-93816719 AGGCAGGTAGGGAGAGAAGGAGG + Intergenic
1073055327 10:100696510-100696532 AGGAAGGAAGGGAGAGAAGGAGG + Intergenic
1073615556 10:104991401-104991423 ATGAAGATGCAGAGAGAAGCTGG - Intronic
1073943991 10:108730015-108730037 AGGGAGGAATAGACAGAAGGAGG + Intergenic
1074316015 10:112362303-112362325 AGGAAGGTAGTGGGAGAAGCCGG - Intergenic
1074414702 10:113257396-113257418 AGGAAGGGAGAGAGAGAGGGAGG - Intergenic
1074564128 10:114561527-114561549 AGGAAGGGAGAGAGAGAACTGGG - Intronic
1074966560 10:118495893-118495915 AGGAAGGTACAGAAAGTAGGAGG + Intergenic
1075447807 10:122526016-122526038 AGGAAGGAATAGAGAGAGGATGG + Intergenic
1075495615 10:122916297-122916319 AGGGAAGGATAGAGAGGAGCAGG - Intergenic
1075553542 10:123412139-123412161 CAGAAGGAAGAGAGAGAAGCAGG - Intergenic
1075584463 10:123647181-123647203 AGGAAGGAAGAGAAAGCAGCTGG + Intergenic
1076476450 10:130757017-130757039 AGGAAGGAAGAGAGAGAGGGAGG + Intergenic
1076974007 11:157475-157497 AGGAAGGGAAAGAGAGAAAGAGG + Intergenic
1077272275 11:1686894-1686916 AGGGAGGAAGGGAGAGAAGCAGG - Intergenic
1077806379 11:5595174-5595196 AGGGAGGTATAGAGAGAGAAGGG - Intronic
1077866004 11:6222521-6222543 AGGAAGGTACGGAGCAAAGCAGG + Exonic
1078012386 11:7582612-7582634 AGGAAGGGACAGAGAAAAGCAGG - Intronic
1078038985 11:7839833-7839855 AATTAGGTAGAGAGAGAAGCTGG + Intergenic
1078106790 11:8362889-8362911 AGGAAGGGAGAGAGAGAGGAAGG - Intergenic
1079137687 11:17785181-17785203 AGGAAGGGAAAGAGGGGAGCAGG - Intergenic
1079189382 11:18265112-18265134 AGGAAGGAAGAGAGAGAGGAAGG + Intergenic
1079454208 11:20623059-20623081 TGGAAGAAATAGAGAGGAGCTGG + Intronic
1079601472 11:22316537-22316559 GGGAAGGGAGAGAGAGAGGCGGG - Intergenic
1079601479 11:22316559-22316581 GGGAAGGGAGAGAGAGAGGCGGG - Intergenic
1079601486 11:22316581-22316603 GGGAAGGGAGAGAGAGAGGCGGG - Intergenic
1081296336 11:41394295-41394317 AGGAAGGTATAGAGAGAAGCTGG - Intronic
1081548549 11:44091044-44091066 AGGAGGGAATAGAGAAAAGGAGG - Intergenic
1082921477 11:58499427-58499449 ATGGAGGTATATAGAGAGGCAGG - Intergenic
1083072778 11:60003594-60003616 AGGATGGAAGACAGAGAAGCTGG + Intergenic
1083117773 11:60479957-60479979 AGGGAGGGATAAAGAGGAGCTGG + Intergenic
1083214628 11:61210670-61210692 AGGCAGGTGAAGAGAGAAGGAGG - Intronic
1083217512 11:61229499-61229521 AGGCAGGTGAAGAGAGAAGGAGG - Intronic
1083220502 11:61249249-61249271 AGGCAGGTGAAGAGAGAAGGAGG - Intronic
1084110976 11:67014022-67014044 ATGAAGGCACAGAGAGAAGAAGG - Intronic
1084504561 11:69557182-69557204 AGGAAGGAAGAGAGAGCAGAGGG + Intergenic
1084928650 11:72535870-72535892 AGGAAGGGAGAGAGGGAAGGAGG + Intergenic
1085163120 11:74367517-74367539 AGGAAGGGAAGAAGAGAAGCTGG - Intronic
1085485710 11:76861143-76861165 AGGAAGGCAAAGAGCGAACCTGG + Intronic
1085720879 11:78911484-78911506 AGGTAGGAAGAGAGAGAGGCTGG + Intronic
1085762735 11:79256299-79256321 AGGAGGGTTGAGAGAGGAGCAGG - Intronic
1085789810 11:79487261-79487283 AGGAAGGAAAAGAAAGAAGGAGG - Intergenic
1086433897 11:86762968-86762990 TGGAAGATATAGTGAGAAACAGG - Intergenic
1087071140 11:94082074-94082096 ATGAAGTCAGAGAGAGAAGCTGG + Intronic
1087480879 11:98699121-98699143 AGGAAGCAAGAGAGAGAAGTGGG + Intergenic
1088381270 11:109195073-109195095 AGGAAGGAAGAAAGAGAAGAAGG - Intergenic
1088537226 11:110874440-110874462 AGGAAGGGAGGGAGAGAAGGAGG - Intergenic
1088834003 11:113561877-113561899 ATGAAGGGAGAGAGAGAAGCAGG + Intergenic
1089410369 11:118236376-118236398 AGGAAGGGAGGGAGAGAAGGAGG + Intronic
1089772623 11:120814624-120814646 AGGAAGGTCTAAGGAGAAGGTGG + Intronic
1089950605 11:122522189-122522211 AGAAAGGAATAGAGAAAAGGAGG + Intergenic
1090051138 11:123380922-123380944 AGGAAGGTACGTAGAGAAGAAGG - Intergenic
1090059409 11:123451012-123451034 AGGAAGGTAGAGAGGAAAGAGGG + Intergenic
1090651232 11:128807931-128807953 AAGAAGATAGAGAGAGGAGCTGG - Intronic
1091142666 11:133249289-133249311 AGGAAGGGAAAGAGAGAAAGGGG + Intronic
1091783527 12:3228955-3228977 AGGGAGGTATACAGAGGAGGAGG - Intronic
1092633150 12:10407272-10407294 AGGAAGGCATACACAGGAGCAGG + Intronic
1092746340 12:11675873-11675895 AGGAAGGGAGAGGGAGAAGGAGG + Intronic
1092969557 12:13679059-13679081 AGGAAGGAAGAGAGAGATGGAGG + Intronic
1093282350 12:17210057-17210079 ATGAAGATACAGGGAGAAGCTGG - Intergenic
1093643387 12:21554229-21554251 AGGAAGGGAAGGAGAGAGGCAGG + Intronic
1094367914 12:29703741-29703763 ATGAAAGTTTAAAGAGAAGCTGG - Intronic
1094671577 12:32575386-32575408 AGGAAGCAAGAGAGAGAAGGGGG + Intronic
1094673647 12:32596358-32596380 AGAAAGGTTTAGAGATAACCAGG + Intronic
1094738745 12:33264433-33264455 AGGAAGGAATAAAGAAAAGAAGG - Intergenic
1095193765 12:39288389-39288411 AGGAAGGTCTAGGGAAAAGGAGG + Intergenic
1095540646 12:43305272-43305294 AGGAAGACAGAGAGAGAAGAAGG + Intergenic
1095636819 12:44444371-44444393 AGGAAGGGATAGAGGGAGGGAGG + Intergenic
1095942988 12:47738452-47738474 AGAAAGGCTTAGAGAGAAGAGGG + Intronic
1096284101 12:50283354-50283376 AAGAGGGTGTGGAGAGAAGCCGG + Intronic
1096430590 12:51539753-51539775 AGGCAGGTACAGAGAGAAAATGG - Intergenic
1096720258 12:53516090-53516112 GGGAATGAAGAGAGAGAAGCAGG + Exonic
1097707217 12:62880755-62880777 AGGAAGGAAGAGAGAAAAACAGG - Intronic
1097982579 12:65749962-65749984 AAGAAGGGACAGAGATAAGCTGG + Intergenic
1097991095 12:65834619-65834641 AGGGAGGCAAAGAGAGAGGCAGG - Intronic
1098328150 12:69323904-69323926 AGGAAGATACAGGGAGAAGGTGG + Intergenic
1098501632 12:71199413-71199435 AGGAAGGACTAGAAAGAAGCAGG + Intronic
1098671711 12:73238333-73238355 AGGAAAGGATGGAGAGAAGTTGG + Intergenic
1098722476 12:73918444-73918466 AGGAAGGAATGGAAAGAAGGAGG - Intergenic
1098918818 12:76284186-76284208 AGGAAGGGAGGGAGAGAAGAAGG + Intergenic
1099415935 12:82386450-82386472 AGGAAGGGAGAGAGAGAGGGAGG - Intronic
1099600333 12:84727711-84727733 TGGAGAGGATAGAGAGAAGCTGG - Intergenic
1100116611 12:91313215-91313237 TGGAAGTGACAGAGAGAAGCAGG + Intergenic
1100787029 12:98089550-98089572 AGGAAAGTAAAGAGAGAAGGTGG - Intergenic
1100948666 12:99819919-99819941 AGGAAGGTAGAGAGGAAGGCAGG + Intronic
1101034536 12:100692377-100692399 AGGAAGAGAGAGAGAGAAGTGGG - Intergenic
1101467446 12:104962333-104962355 GGGAAGGTGTGGAGAGGAGCGGG + Intergenic
1101709572 12:107252683-107252705 AGGAAGGGAAGGAGAGAAGGAGG - Intergenic
1101968462 12:109296372-109296394 AGGAAGGCACACAGAGAAGGGGG - Intronic
1102544128 12:113642516-113642538 AGGAAGGGAGAGAGGGAGGCAGG - Intergenic
1102652459 12:114451855-114451877 AGGAAGGGAGAGAGAGATGGAGG - Intergenic
1102714086 12:114954813-114954835 AGGAAGGCATAGAAAGAACATGG + Intergenic
1102786547 12:115609712-115609734 AGAAAGATAAAGAGAGAAGCAGG - Intergenic
1102940683 12:116938871-116938893 AGGAAGCTATAGGGAAATGCTGG - Intronic
1103307150 12:119974013-119974035 AGGAAGGGAAAGAAAGAAGGGGG + Intergenic
1103367023 12:120390801-120390823 AGGAAGGGAGGGAGAGAAGAAGG + Intergenic
1103444393 12:120984704-120984726 AAGAAGGGAGAGAGAGAAGCTGG + Intronic
1103991928 12:124805157-124805179 AGGAAGCCATAGGGAGCAGCAGG + Intronic
1104253269 12:127116914-127116936 AGGAAGGGATAGGGAGAAAGAGG - Intergenic
1105814385 13:24021152-24021174 AGGAAGGTATTAGGAGAGGCAGG + Intronic
1106239716 13:27901446-27901468 GGGAAAGAAGAGAGAGAAGCAGG - Intergenic
1106262537 13:28079919-28079941 AGGAAGGAAGAGAGAGGAGGGGG + Intronic
1106306006 13:28510219-28510241 AGGAAGGGAGAGAGGGAAGGGGG + Intergenic
1106432341 13:29693121-29693143 AGGAGGGAATACAGAGGAGCGGG - Intergenic
1106883588 13:34158633-34158655 AGGAAGGGAGAGAGAGAAGGAGG - Intergenic
1107711344 13:43153284-43153306 AGGAAGGCACAGAGGGAAGAAGG - Intergenic
1107748908 13:43543230-43543252 AGGAAGGAATAAAGAGAGGAGGG + Intronic
1107750641 13:43561978-43562000 AGGAAGGAAGAGAGAGAGGGAGG + Intronic
1108094874 13:46891042-46891064 AGGAAGGTACAGAAAGAACAGGG + Intronic
1108439006 13:50429871-50429893 AGAAAGGTATACAGAGAATAAGG - Intronic
1108481456 13:50876616-50876638 AGGAAGGTATAGATCAAAGTTGG + Intergenic
1109268249 13:60225291-60225313 AGAAAGGTCCAGGGAGAAGCAGG - Intergenic
1109434534 13:62282795-62282817 AGGGAGCAATAGAGAGAAGGGGG + Intergenic
1110027804 13:70564198-70564220 AGAAAGGTATAGACAGAGTCAGG + Intergenic
1110065677 13:71102448-71102470 ATGAAGGGATAGGGAAAAGCTGG + Intergenic
1110276638 13:73648417-73648439 TGGAAGGAATAGAGACAAGAAGG + Intergenic
1110277195 13:73653421-73653443 AGGAAGGCACAAAGAGAATCGGG + Intergenic
1110625386 13:77649857-77649879 AGGAAGGAATAAAAAGAGGCAGG - Intergenic
1111162754 13:84417403-84417425 ATGAAGTTGGAGAGAGAAGCTGG + Intergenic
1111319480 13:86608119-86608141 CAGAAGGTAAAGAGAGGAGCAGG - Intergenic
1111686677 13:91510708-91510730 TGGAAGGGATACAGTGAAGCTGG - Intronic
1112849547 13:103688153-103688175 AGGAGGGGATAGAGAGAAGTTGG - Intergenic
1113295114 13:108951238-108951260 AGGAAGGAATAGACAGCAGCTGG - Intronic
1114374115 14:22124408-22124430 AGGAAGGGAAGGAGAGAAGGAGG + Intergenic
1115254965 14:31390358-31390380 AGGGGGGTAAAGATAGAAGCAGG + Intronic
1116264601 14:42671504-42671526 AGGAAGGAAGAGAGGGAGGCAGG - Intergenic
1116749361 14:48863664-48863686 AGGATTGTATAGAGAGAATGTGG + Intergenic
1117033515 14:51702299-51702321 AGGAAGTTATAAAGCGAAACAGG - Intronic
1117291994 14:54343431-54343453 AGGTAGGAATAGAGAGAGGAGGG + Intergenic
1117839509 14:59844583-59844605 AGGAAGATAGGGAGAGATGCAGG + Intronic
1118200668 14:63669139-63669161 GGAGAGGAATAGAGAGAAGCTGG - Intergenic
1118465311 14:66025156-66025178 AGGGACGTACAGAGAGAAACTGG + Intergenic
1119206340 14:72796867-72796889 AGGGAGGTTTAGAGAAAAGGAGG + Intronic
1119608235 14:76039721-76039743 AGGAAGGGAGAGAGAGACTCAGG - Intronic
1120288164 14:82532278-82532300 AGGAGGGTATATAAAGAAGAAGG - Intergenic
1121616145 14:95315092-95315114 AGGAAGGTCTAGAGATAGGGAGG + Intronic
1121655786 14:95594577-95594599 AGGAAGGAAATGAGAGAAGCTGG - Intergenic
1121697950 14:95928293-95928315 AGGGAGGGAGAGGGAGAAGCAGG - Intergenic
1122439734 14:101722451-101722473 TGGAAGGAGGAGAGAGAAGCAGG + Intergenic
1123169779 14:106361553-106361575 AGGAGGCTGCAGAGAGAAGCAGG + Intergenic
1123679221 15:22745760-22745782 AGAAAGGATTAGAGAGAAGATGG + Intergenic
1124331441 15:28820210-28820232 AGAAAGGATTAGAGAGAAGATGG + Intergenic
1125110295 15:36024403-36024425 AGGAAGAAATAGAAAGAAGTGGG + Intergenic
1125132571 15:36300863-36300885 AGGGAGGGATAGAGAAAAGAAGG + Intergenic
1125542020 15:40475075-40475097 AGGTAGGGGTAGAGAGAAGAAGG + Intergenic
1126434232 15:48619453-48619475 AGGAAGGGAGGGAGAGAAGGAGG - Intronic
1126455795 15:48860637-48860659 AGGAAGATAATGAGAGAAGCAGG + Intronic
1126475942 15:49065263-49065285 AGGAAAGCAGGGAGAGAAGCAGG + Intergenic
1126800407 15:52292955-52292977 AGGAAGGCAGGGAGAGAGGCAGG + Intronic
1127465763 15:59242963-59242985 AGAGAGGTACACAGAGAAGCAGG + Intronic
1127560568 15:60132471-60132493 AGAAAGGAATAGAGGGAAGAAGG + Intergenic
1127667688 15:61165054-61165076 GGGAACCTACAGAGAGAAGCAGG - Intronic
1128366786 15:67009808-67009830 AGGATGGTATAGAGAGGCTCAGG + Intergenic
1128619762 15:69138764-69138786 AGGAAGGAAAAGAGAGAGGGTGG - Intergenic
1129848504 15:78778932-78778954 AGGCAGGTGTGGAGAGAGGCTGG + Intronic
1129933062 15:79428298-79428320 AGGAAGGAAGGGAGAGAAGAAGG - Intergenic
1130236779 15:82142506-82142528 AGGAAGGAATTGACAGAAGGAGG + Intronic
1130258644 15:82337627-82337649 AGGAAGATGGAGGGAGAAGCCGG - Intergenic
1130270041 15:82441457-82441479 AGGAAGATGGAGGGAGAAGCCGG + Intergenic
1130275935 15:82476385-82476407 AGGAAGATGGAGGGAGAAGCCGG - Intergenic
1130485453 15:84395977-84395999 AGGAAGATGGAGGGAGAAGCTGG + Intergenic
1130490296 15:84426015-84426037 AGGAAGATGGAGGGAGAAGCCGG - Intergenic
1130522738 15:84675706-84675728 AAGAAGGAATAGAAAGCAGCAGG - Intronic
1131338552 15:91573429-91573451 AGGAAGGAAGAGAAAGAAGGAGG + Intergenic
1131689314 15:94809418-94809440 AGGAAGGAAGAGGGAGAAGGGGG + Intergenic
1132020417 15:98356557-98356579 AGGAAGGGATGGAGAGAGGAAGG + Intergenic
1132398969 15:101493402-101493424 GGGAAGGAAGAGAGAGAAGGAGG - Intronic
1132507840 16:321196-321218 TGGAAGGCACAGAGAGCAGCGGG - Intronic
1133688254 16:8187859-8187881 AGGAAGGAAGAGAGAGAGGGAGG + Intergenic
1133698285 16:8285877-8285899 AGGAAGGTAAAAAGAGAGGGAGG - Intergenic
1133702548 16:8322595-8322617 ATGAAGGGATGGAGAGAAGGTGG - Intergenic
1133890859 16:9877601-9877623 AGGAAGGGGGAGAGAGAAGGGGG - Intronic
1134267732 16:12706447-12706469 AGGAAGGAAGGGAGAGAGGCAGG - Intronic
1135331587 16:21564575-21564597 AGGAAGGAAGAGAGAGAGGAAGG + Intergenic
1135351457 16:21732834-21732856 AGGAAGGCAAAGAGTGAAGGAGG + Intronic
1135449939 16:22548962-22548984 AGGAAGGCAAAGAGTGAAGGAGG + Intergenic
1135728191 16:24873224-24873246 AGGAAGGAATGGAGAGAGGGAGG + Intronic
1135991372 16:27220798-27220820 TGGAATCTATAGAGACAAGCAGG + Exonic
1136075542 16:27814707-27814729 AGGAAGGGAGAGAGGGAAGGAGG + Intronic
1136170054 16:28483679-28483701 AGGAAGGGAGGGAGAGAAGAAGG - Intronic
1136734473 16:32452045-32452067 AGGAAGGGTGGGAGAGAAGCGGG - Intergenic
1136946065 16:34652585-34652607 AGGAAGGAAGGGAGAAAAGCAGG + Intergenic
1137796886 16:51228558-51228580 AGAAAGAGATAGAGAGAAACTGG + Intergenic
1138090780 16:54172538-54172560 ATGTAATTATAGAGAGAAGCAGG - Intergenic
1138176997 16:54909525-54909547 AGGAGGGTATAGAGAGAGACAGG + Intergenic
1138202555 16:55100972-55100994 AGGAAGGAATGGAGGGAAGAAGG + Intergenic
1138263098 16:55639727-55639749 AGGAAGGAAGGGAGAGAAGGAGG + Intergenic
1139210026 16:65068001-65068023 AGGGAGGGAGAGAGAGAAGAGGG + Intronic
1139210071 16:65068183-65068205 AGGAAGGAAATGAGAGAAGAAGG + Intronic
1139210079 16:65068211-65068233 AGGAAGGGAAAGAGGGAAGGAGG + Intronic
1139986077 16:70899672-70899694 AAGAAAGTAAAGAAAGAAGCAGG + Intronic
1140113852 16:72024993-72025015 AGAAAGGGACAGAGAGAAACGGG - Exonic
1140798629 16:78464332-78464354 AGGAAAGAAGAGAGAGAAGGAGG + Intronic
1140832805 16:78767077-78767099 AGGAAAGGAGAGAGAGAAGGAGG - Intronic
1140938432 16:79697756-79697778 AGGAAGGAAGAGAGGGAAGGAGG - Intergenic
1141818671 16:86430425-86430447 AGGGAGGTGGGGAGAGAAGCTGG - Intergenic
1141927418 16:87178587-87178609 AGGGAGGCAGAGAGAGAAGGAGG - Intronic
1142299177 16:89246930-89246952 AGGCGGGTGGAGAGAGAAGCCGG + Intergenic
1142305630 16:89283203-89283225 AGAAAGGCAAAGAGAAAAGCTGG - Exonic
1142446251 16:90140188-90140210 AGGAAGGGAAAGAGAGAAAGAGG - Intergenic
1203018607 16_KI270728v1_random:377557-377579 AGGAAGGGTGGGAGAGAAGCGGG + Intergenic
1203036942 16_KI270728v1_random:650715-650737 AGGAAGGGTGGGAGAGAAGCGGG + Intergenic
1142461254 17:95275-95297 AGGAAGGGAAAGAGAGAAAGAGG + Intergenic
1142972386 17:3621583-3621605 GGGAAGGAATGGAGAGAAGGAGG - Intronic
1143121939 17:4613571-4613593 AGGAAGGTAAAAAGAAAAGGAGG - Intergenic
1143457195 17:7075959-7075981 AGGAAGGTATGGGGAGTACCTGG - Intronic
1143639465 17:8187806-8187828 AGGAAGGGATTGAGAGAAACCGG + Intergenic
1143725620 17:8843278-8843300 AGGGAGGGAGAGAGAGAAGGAGG - Intronic
1144398628 17:14871830-14871852 AGGAAGGGAGAGAGAGAAGGAGG - Intergenic
1145959827 17:28880921-28880943 AGGAAGGGAGGGAGAGATGCTGG - Intronic
1146690050 17:34867175-34867197 AGGGAGCTAGAGAGAGAACCCGG + Intergenic
1146953701 17:36923582-36923604 AGAGAGGGAAAGAGAGAAGCAGG + Intergenic
1147325906 17:39669523-39669545 AGGAAGAACTAGAGAGAGGCAGG + Intronic
1147911737 17:43860097-43860119 AGCTAGGTATTGAGAGAAGCTGG + Intronic
1148211690 17:45812717-45812739 AGGAAGAAATAGAGAGAGGCAGG - Intronic
1148452361 17:47787935-47787957 AGAAAGGGATAGAGAGAGGGAGG + Intergenic
1148510522 17:48165306-48165328 GGGCAGGTTTAGGGAGAAGCTGG - Intronic
1148545528 17:48515982-48516004 AGGGAGGAAGAGAGAGAAGGAGG + Intergenic
1148545538 17:48516018-48516040 AGGGAGGAAGAGAGAGAAGGAGG + Intergenic
1148545548 17:48516054-48516076 AGGGAGGAAGAGAGAGAAGGAGG + Intergenic
1149388391 17:56165214-56165236 AGGATGGTATAGCAAGAAACAGG - Intronic
1149925383 17:60697233-60697255 AGGAAGGAAAAGAAAGAAGCAGG + Intronic
1150157725 17:62868377-62868399 AAGAAGGTATAGAGACCAGTGGG - Intergenic
1150489650 17:65565473-65565495 AGGAAGGTGAAGAGAGACACAGG + Intronic
1150775122 17:68075125-68075147 AGGGAGGGATGGAGGGAAGCAGG - Intergenic
1151103759 17:71588063-71588085 AGGAAGTTACAGAGAAAGGCAGG + Intergenic
1151213891 17:72564326-72564348 GGGCAGGTATGGAGAGAAGAAGG + Intergenic
1151608292 17:75154123-75154145 AGGAATGAATGGAGAGCAGCAGG + Intronic
1152003235 17:77660436-77660458 AGGAAGGGAGGGAGAGAAGAAGG - Intergenic
1152222868 17:79078732-79078754 ATCAAGGTAGAGATAGAAGCAGG + Intronic
1153276106 18:3369206-3369228 AGGAAGCAAGAGAGAGAAGCAGG - Intergenic
1153584048 18:6603030-6603052 AGGCAGGGACAAAGAGAAGCTGG - Intergenic
1153782117 18:8504167-8504189 AGGAAGTTATATACAGTAGCAGG - Intergenic
1153865162 18:9260942-9260964 AGGAAAGGAGAAAGAGAAGCAGG - Intronic
1153992748 18:10414625-10414647 AGGAAGGATTACAGAGAAGCTGG - Intergenic
1155437978 18:25832889-25832911 AGGCAGGGATAGGGAGAAGTTGG + Intergenic
1155730970 18:29157522-29157544 AGGAAGGGAGAGAGGGAAGGAGG + Intergenic
1155762150 18:29582085-29582107 AGGAAGGAAGGGAGAGAAGAAGG + Intergenic
1156491963 18:37501638-37501660 AGGAAGCCATAGACAGAAACAGG + Intronic
1156658792 18:39320725-39320747 ATGCAGGTATAGACAGAAGAAGG - Intergenic
1156826347 18:41434487-41434509 AGGAAGGAAGAGAGGGAAGGAGG + Intergenic
1156851826 18:41737567-41737589 AGGAAGGGAGGGAGAGAAGGAGG - Intergenic
1157392922 18:47317857-47317879 AGGAAGGGAAGGAGAGAAGGAGG - Intergenic
1157499475 18:48179725-48179747 AGGAAGGGAGAGAGAGAGGGAGG - Intronic
1157915184 18:51657421-51657443 AGGAAGGAATGGAAAGAAGGAGG - Intergenic
1158076466 18:53536184-53536206 AGGAAGCAAGAGAGAGAAGCAGG + Intergenic
1158576964 18:58646147-58646169 AGAAAGGTAGCGAGAGAGGCTGG + Intergenic
1159431834 18:68362518-68362540 AGGAAGGAATTGATAGCAGCAGG + Intergenic
1159851639 18:73532872-73532894 AGGAAGGTAGAGAGGGAGGGAGG + Intergenic
1159931916 18:74321290-74321312 AGGAAGGGAGAGAGAGAGGGAGG - Intronic
1160135827 18:76270943-76270965 AGGGAGGTATGGAGAGAAGGTGG - Intergenic
1160448406 18:78944819-78944841 AGGAAGGGATGGAGGGAATCGGG + Intergenic
1160519622 18:79497159-79497181 AAGAAGGACTGGAGAGAAGCAGG + Intronic
1160650955 19:227642-227664 AGGAAGGGAAAGAGAGAAAGAGG + Intergenic
1162822309 19:13230338-13230360 AGAGAGGGATAGAGAGAAGATGG + Intronic
1163054599 19:14708849-14708871 GTGAAGATATAGAGAGAAGATGG - Intronic
1164441737 19:28284631-28284653 AGGAAGGTAGAGGGAAAAGAGGG + Intergenic
1164760925 19:30727765-30727787 AGGAAGAGATTGGGAGAAGCCGG + Intergenic
1164794398 19:31014573-31014595 AGGAAGGGAGGGAGAGAAGGAGG + Intergenic
1164916774 19:32058315-32058337 AGGAAGGGAGAGAGGGAAGAAGG - Intergenic
1165188854 19:34045284-34045306 AGGAAGAGAGAGAGAGAAGAAGG + Intergenic
1165934995 19:39383785-39383807 AGGAAGGAAAGGAGAGAGGCAGG - Exonic
1166108772 19:40610447-40610469 AGGCAGGGGTAGAGGGAAGCGGG - Intronic
1166956799 19:46470434-46470456 AGGAAGGTGAAGAAAGAACCGGG - Exonic
1167084590 19:47300632-47300654 AGGAAGGAAAGGAGAGAAGGAGG - Intronic
1167799219 19:51729541-51729563 AGGGAGGGAAAGAGAGAAGGAGG + Intergenic
1167859423 19:52270794-52270816 AAGAAGGAATAGAGGGAAGAAGG + Intronic
1168092755 19:54096443-54096465 AGGCAGGCAGAGAGAGAGGCAGG - Intronic
1168092757 19:54096459-54096481 AGGGAGGCAGAGAGAGAGGCAGG - Intronic
1168092777 19:54096569-54096591 AGGGAGGCAGAGAGAGAGGCAGG - Intronic
1168143890 19:54408489-54408511 AGGAAGGGAGAGAGAGAGGAAGG + Intergenic
1168255387 19:55161854-55161876 AGGAAGGCAGAGAGGGATGCAGG + Intronic
1168705063 19:58465900-58465922 AGGTAGGTATAGAGGGAGGGAGG + Intergenic
1202675800 1_KI270711v1_random:5479-5501 AGGATGGAATCGAGAGGAGCAGG + Intergenic
925127541 2:1470829-1470851 GGGAAGGTATTGAGTAAAGCTGG - Intronic
925219327 2:2125111-2125133 AGGAAGGTAAAGAGAAAAGCAGG - Intronic
925299473 2:2800277-2800299 AGGAAGGGAAGGAGAGAAGGAGG + Intergenic
925365382 2:3307703-3307725 AGGCAGGGATGAAGAGAAGCTGG + Intronic
925965691 2:9063108-9063130 AGGAAGGAAGAGAGAGAAAGAGG + Intergenic
926309729 2:11666828-11666850 AGGCAGGGAGAGAGAGAAGACGG + Intronic
926631558 2:15141186-15141208 AGGAAGGAAAAGAGTGAAGGAGG - Intergenic
926942530 2:18153570-18153592 AGAAAGGAAAAGAGAGAAGAAGG + Intronic
928052738 2:28017035-28017057 AGGATGGGAGAAAGAGAAGCTGG - Intronic
928205225 2:29279043-29279065 AGGAAGGCACAGAGAGGGGCAGG - Intronic
928274915 2:29891858-29891880 AGCATTGTACAGAGAGAAGCTGG - Intronic
928401764 2:30984156-30984178 AGGCAGGAACAGTGAGAAGCAGG - Intronic
928702205 2:33910483-33910505 AGGAAGGAAGAGAGAGAGGAAGG - Intergenic
928736917 2:34301704-34301726 AGGAAGCAAGAGAGAGAAGAGGG - Intergenic
928811334 2:35231016-35231038 AGGGAGGAAAAGAGAGAAGGAGG - Intergenic
929443406 2:41983969-41983991 AGGAAGGTTGAGAGAGATGCTGG + Intergenic
929534600 2:42773127-42773149 AGGACAGTATAGAGAGGAGTGGG - Intronic
929664353 2:43822354-43822376 AGGGAGGTAGAAAGAGAAGCAGG - Intronic
929729235 2:44469039-44469061 AGGAAGGTATTGGGAGAGGTTGG + Intronic
931807639 2:65823253-65823275 AGGGAGGTATAGGGAAAAGCGGG - Intergenic
931807898 2:65825809-65825831 AGGGAGGTATAGGGAAAAGCAGG - Intergenic
931817502 2:65919323-65919345 AAGAAGGAATAGAGAAAAGTTGG - Intergenic
932226341 2:70044063-70044085 AGGAAGGGATAGGGAGGAGAAGG - Intergenic
932356856 2:71074274-71074296 AGGAAGGAAAATAGAGATGCTGG + Intronic
933226156 2:79751688-79751710 AGGAAGGGAGAGAGGGAAGGAGG + Intronic
933485838 2:82922536-82922558 AGGAAGGTAAGGAGGGAAGTTGG + Intergenic
934311258 2:91867404-91867426 AGGAAGGGTGGGAGAGAAGCGGG + Intergenic
934773065 2:96920218-96920240 AGGAAAGTGGAGAGAGAAGCCGG + Intronic
934944988 2:98534372-98534394 AGGAAGGTAAGGAGAGCACCAGG + Intronic
935203611 2:100879482-100879504 AGGAAGGGAGAGAGAAAAGGAGG - Intronic
935210226 2:100933294-100933316 AGGTAGGTAGAGAGAGGAGAAGG + Intronic
935407294 2:102722356-102722378 AGGAAGGCAGAGAGAGGGGCAGG + Intronic
935459545 2:103312985-103313007 AGGGAGGGATAGACAGAAGGGGG - Intergenic
935609495 2:105006263-105006285 ATGAAGATATAGGGAGAAGGTGG - Intergenic
935616018 2:105082696-105082718 AGGAAAGTATAAAGTGAAGGGGG + Intronic
936573821 2:113637210-113637232 AGGAAGGTGTGCAGAGGAGCAGG - Intronic
937451437 2:122005248-122005270 AGAAAGGTGCAGAGAGAATCAGG - Intergenic
937505885 2:122536005-122536027 AGGAAAAGAAAGAGAGAAGCCGG + Intergenic
937619588 2:123970589-123970611 AGGAAGGAAGAGAGGGAAGGAGG + Intergenic
937697683 2:124826406-124826428 TGGGAGGTAAAGAGAGAAGGTGG + Intronic
937700712 2:124860399-124860421 AGGAAGGGAGAGAGGGAGGCAGG - Intronic
937870298 2:126781513-126781535 TGGAAGGAAAAGAGTGAAGCAGG - Intergenic
937975624 2:127580729-127580751 CCGAAGCTAGAGAGAGAAGCAGG - Exonic
938656697 2:133442208-133442230 AGGAAGGAAGAAAGAGAGGCAGG + Intronic
938672625 2:133600361-133600383 AGGAAGAAAGAGAGAGAAGTTGG + Intergenic
939329658 2:140740768-140740790 ATGAAGATATAGGGAGAAGATGG - Intronic
939472386 2:142640122-142640144 AGGAAGGTAGAAAGAAAAGAAGG - Intergenic
939623190 2:144446038-144446060 AGGAAGGGGGAGAGAGAAGAAGG - Intronic
940848330 2:158664152-158664174 AGGAAGGGAGAGTTAGAAGCAGG + Intronic
941431987 2:165424112-165424134 TGGAAGGTGAAGGGAGAAGCAGG + Intergenic
941464968 2:165814655-165814677 AGGAAGGGAAGGAGAGAAGGAGG + Intergenic
942062520 2:172240850-172240872 AGGAAGTGACAGAGAGAAGAGGG - Intergenic
942114050 2:172710665-172710687 AGGCTGGTATAGAGAAAAGAAGG - Intergenic
942198686 2:173549201-173549223 AGGAAGGGAGAGAGAGAAGGAGG - Intergenic
944012359 2:194987636-194987658 AGGAAGGGATAAAGAGAGGTTGG + Intergenic
944489018 2:200238323-200238345 GAGAAGGAAGAGAGAGAAGCTGG + Intergenic
944881445 2:204017052-204017074 AGGAAGGAAGAGAGAGAGGGAGG + Intergenic
945094007 2:206202338-206202360 TGGAGGCTATAGAGAGAAGACGG + Intronic
945699199 2:213150291-213150313 AGGGAGGGAAAGAGAGAAGGGGG - Intronic
945918127 2:215726176-215726198 AGGAAGGTAGAGAGAGAGGGAGG + Intergenic
946214084 2:218170128-218170150 AAGAAAGTACAGAGAGAAGATGG - Intergenic
946235897 2:218324110-218324132 AGGAAGGGGTAGAGGGAGGCAGG - Intronic
946419656 2:219557693-219557715 GGGAAGGTACTGAGAGAAGTGGG + Intronic
946634187 2:221706490-221706512 AGGAAGCTTTAGAGAGCAACTGG + Intergenic
946902725 2:224387978-224388000 AAGAAGGTATATACAGAAACTGG - Intronic
947411268 2:229843085-229843107 AGGGAGGGAGAGAGAGAAGGAGG - Intronic
947628214 2:231634581-231634603 GTGAAGGGATAGAGAGAAACAGG + Intergenic
947885280 2:233564474-233564496 AGAAATATATAGAGAGAAACAGG + Intronic
948323379 2:237090629-237090651 AGGAAGGCATACAGTGAAGGTGG - Intronic
948570877 2:238916468-238916490 AGGAAGGGAAAGAAAGAAGGAGG + Intergenic
948906712 2:240983135-240983157 AGGGAGGCCTAGAGAGATGCTGG + Intronic
948984426 2:241511511-241511533 AGGTAGGAGTGGAGAGAAGCTGG + Intergenic
1168935736 20:1664064-1664086 AGGAAGAGAGAGAGAGAAGAGGG + Intergenic
1168974389 20:1953197-1953219 AGGGAGGGAGAGAGAGAAGGAGG + Intergenic
1168974407 20:1953260-1953282 AGGAAGGAAAAGAGAGAGGGAGG + Intergenic
1169004597 20:2195957-2195979 AGGAAGGAAGAGAGAGAACAGGG - Intergenic
1169248974 20:4045946-4045968 AGAAAGGGATGGAGGGAAGCAGG - Intergenic
1169545418 20:6645255-6645277 AGGAAGGGAGAGAGAGAGGGAGG - Intergenic
1169744864 20:8933421-8933443 AGGAAGCAATAGAGAGCAGGAGG + Intronic
1169971763 20:11276057-11276079 AGGGAGGGAGAGAGAGAAGATGG - Intergenic
1169991076 20:11503098-11503120 AGGAAGGGAGGGAGAGAAGGAGG - Intergenic
1170357369 20:15507323-15507345 AGGAGGGAATTGGGAGAAGCAGG - Intronic
1170370229 20:15640163-15640185 AGGAAGGGAGAGAGAAAAACAGG + Intronic
1171051396 20:21862552-21862574 AGGAAGATATAGAAACAAGCTGG + Intergenic
1171096368 20:22336037-22336059 AGGGAGGGACAGAGAGAGGCAGG - Intergenic
1171307013 20:24115399-24115421 AGGAAGATTTAGACGGAAGCAGG + Intergenic
1171816546 20:29790569-29790591 AGGAAGGGAGAGAGAGAGGGAGG - Intergenic
1171862435 20:30413062-30413084 AGGAAGGCAGAGAGGGAAGGAGG + Intergenic
1172204555 20:33153764-33153786 AGGAAGGGAGGGAGAGAAGGAGG + Intergenic
1172228757 20:33323074-33323096 AGGAAGAAATAAAGAGAAGCAGG + Intergenic
1172458091 20:35093151-35093173 AGTCACGTGTAGAGAGAAGCAGG - Intergenic
1172632260 20:36386361-36386383 AGGAAGGTAGAGAGGGAGGAGGG + Intronic
1172808298 20:37629205-37629227 AGGAAAGGAGAGAGGGAAGCAGG + Intergenic
1172961432 20:38803065-38803087 AGGAAGGCACAGGGAGAAGAAGG - Intergenic
1173044577 20:39497427-39497449 AGGTAGGAATAGAGTGAAGTAGG - Intergenic
1173467209 20:43292767-43292789 AGGAAGGGAGAGAGGGAAACAGG + Intergenic
1174423479 20:50415890-50415912 AGAAAGGGAGAGAGAGAAACAGG + Intergenic
1174438786 20:50531820-50531842 AGGATGGTAAGGAGAGAAGCAGG - Intronic
1174445509 20:50588178-50588200 AGGAAGGTCCAGAAAGCAGCAGG - Intronic
1174560574 20:51428091-51428113 AGGAAGGGAGAGAGGGAAGAAGG + Intronic
1174643549 20:52066263-52066285 AGGAAAGTAAAAAGATAAGCAGG - Intronic
1174655359 20:52167490-52167512 AGGAAGGGAGGGAGAGAAGAAGG - Intronic
1174763523 20:53229881-53229903 AGGAAGGAAAAGAGAGAGGGAGG + Intronic
1175273912 20:57754499-57754521 AGGAAGGGAGGGAGAGAAGAAGG - Intergenic
1175344148 20:58259427-58259449 AGGAAGGGATGGAGAAAGGCAGG + Intergenic
1175486401 20:59349945-59349967 TAGAAGGTACAGAGAGAAACTGG + Intergenic
1176291092 21:5045108-5045130 AGGAAGGTGGAGTGAGAAGATGG - Intergenic
1177003380 21:15640726-15640748 AGGAAGGAAGGGAGAGAAGGAGG - Intergenic
1177273426 21:18877093-18877115 AAGAAGGAATAGAGAGAAAGGGG + Intergenic
1177338270 21:19762135-19762157 AGGAAGGAAGAGAGAGAAGCAGG + Intergenic
1177517464 21:22174400-22174422 AGGAAGCAAGAGAGAGAAGAGGG - Intergenic
1177670208 21:24214735-24214757 AGGAAAGAAAAGAGAGAAGGGGG + Intergenic
1177746380 21:25219504-25219526 AGGAAGGCAGAGAGGGAAGCAGG + Intergenic
1178467818 21:32864610-32864632 AGAAAGGTATAGAAAGAAGAAGG + Intergenic
1178516416 21:33251230-33251252 AGCATGGTAGGGAGAGAAGCAGG + Intronic
1179147630 21:38782354-38782376 AGGAAATTATATAGAGAAGTTGG + Intergenic
1179221228 21:39409205-39409227 ATGAAGACATAGTGAGAAGCGGG + Intronic
1179231647 21:39509208-39509230 AGGGAGGTGGAGAGAGAAACGGG + Intronic
1179866163 21:44218533-44218555 AGGAAGGTGGAGTGAGAAGATGG + Intergenic
1180015767 21:45082413-45082435 GGGAAGGTACAGACAGACGCTGG - Intronic
1180538017 22:16413315-16413337 AGGAAGGGTGGGAGAGAAGCGGG + Intergenic
1180798618 22:18620629-18620651 AGGAAGGAAAAGAGAGAAGAAGG + Intergenic
1181223098 22:21374635-21374657 AGGAAGGAAAAGAGAGAAGAAGG - Intergenic
1181255640 22:21560999-21561021 AGGAAGGAAAAGAGAGAAGAAGG + Intronic
1181678402 22:24473085-24473107 AAAAAGGTATACAGAGAAGTAGG + Intergenic
1181759227 22:25046403-25046425 AGGAAGGGATGGAGAGAGGAAGG - Intronic
1181759231 22:25046419-25046441 AGGAAGGGATGGAGAGAGGAAGG - Intronic
1181764365 22:25080494-25080516 AGGAAGGTGCTGAGAGGAGCTGG - Intronic
1181890482 22:26058700-26058722 AGGAAGAAAGAGAGAGAGGCAGG - Intergenic
1182962169 22:34485487-34485509 CAGAAGGAAGAGAGAGAAGCGGG + Intergenic
1183000019 22:34849041-34849063 AGGAAGGGAGGGAGAGAGGCCGG + Intergenic
1183060996 22:35336360-35336382 AGGCAGGTACAGGGAGGAGCGGG - Intronic
1183682265 22:39339262-39339284 AGGAAAGAAGAGAGAGAAGGAGG - Intergenic
1183698797 22:39438162-39438184 AGGAAGGGATGGAGGGAAGGAGG - Intergenic
1183796827 22:40125584-40125606 AGAAAGGGAGGGAGAGAAGCAGG - Intronic
1184153844 22:42654096-42654118 AGGGAGATAGAGAGAAAAGCAGG - Intergenic
1184269120 22:43368259-43368281 AGTAAGGCATAGAGATAAGTGGG - Intergenic
1184337355 22:43861880-43861902 AGCCAGGTAAAGGGAGAAGCAGG + Intronic
1184816785 22:46878293-46878315 GGGAAGGAAGAGAGAGAAGGAGG + Intronic
1184983410 22:48112824-48112846 AGAAAGGAAGAGAGAGAAGCAGG + Intergenic
1185147994 22:49149728-49149750 GGGAGGGGACAGAGAGAAGCAGG + Intergenic
1185426355 22:50773683-50773705 AGGAAGGTGTGCAGAGGAGCAGG + Intronic
949253299 3:2014257-2014279 AGGAAAGCAGAGAGAGATGCTGG - Intergenic
949339879 3:3017961-3017983 AGGAAGGTAAGGAGGGAAGTAGG - Intronic
949624476 3:5851328-5851350 AGGAAGGAAGAGAGAGGAGAGGG - Intergenic
949682002 3:6524921-6524943 AGGATGTTTTAGAGAGAAGAGGG - Intergenic
949891007 3:8733688-8733710 AGGAGGCTTTAGAGAGAGGCAGG + Intronic
950401591 3:12773220-12773242 AGGAAGGGAGAGAGGGAAGGAGG + Intergenic
950723726 3:14902345-14902367 AGGAAGGCAGAGAGAGAAAAGGG + Intronic
950912952 3:16614049-16614071 AGGAAAATAAAGAGGGAAGCTGG - Intronic
951738082 3:25889771-25889793 AGGAAGGGAGGGAGGGAAGCAGG - Intergenic
952059589 3:29491616-29491638 AGGAAGGAAGAGAGGGAAGGAGG + Intronic
952089304 3:29865055-29865077 AGGAAGGAAGAGAGAGACGAAGG + Intronic
952142757 3:30498242-30498264 AGGATGGTATGGAGAGGAGCTGG - Intergenic
952253899 3:31679262-31679284 AGGAAGGAGGAGAGTGAAGCTGG - Intronic
952506264 3:34009178-34009200 AGGAAGGGAGAGAGAGAAAGAGG - Intergenic
953076397 3:39574573-39574595 AGGAAGTCATAGAGAGAAAATGG - Intergenic
953121854 3:40052164-40052186 AGGAAGGGATGAAGAGAAGTTGG - Intronic
954514688 3:51162505-51162527 AGGAAGGCATATAAACAAGCAGG - Intronic
954758925 3:52860311-52860333 AGGCAGGTGAAGAGAGAAGAGGG + Intronic
955483536 3:59413535-59413557 AGGAAGGAAAAGAGACAGGCAGG - Intergenic
955483651 3:59414363-59414385 AAGAAGGAAGAGAGAGAATCTGG - Intergenic
956188118 3:66581674-66581696 AGGAAGGTAGAGTGAGGAGGAGG + Intergenic
956765687 3:72482545-72482567 AGGAAGGGATTGAGAGGAGAGGG - Intergenic
956847760 3:73198792-73198814 AGGCAGGTCTAAAGAGGAGCTGG - Intergenic
957356002 3:79087494-79087516 AGGAAGGAAGAGAAAGAAGCTGG - Intronic
957397543 3:79661611-79661633 AGAAAGGGATAGAGGGAGGCAGG - Intronic
957432238 3:80125325-80125347 AGGAAGATACAGAGAGTGGCCGG - Intergenic
957544304 3:81616965-81616987 AGGAAGGGAAAGAGAGAAGGAGG + Intronic
957593786 3:82233953-82233975 AGGAAGGGTGAGAGAGAAGAAGG + Intergenic
958454441 3:94312068-94312090 AATAAGGGACAGAGAGAAGCAGG + Intergenic
959187585 3:103065726-103065748 AGGAACGTATCCAGGGAAGCAGG + Intergenic
959515465 3:107261625-107261647 CGGTAGCTACAGAGAGAAGCAGG + Intergenic
959555291 3:107710422-107710444 AGGAAGAGAGAGAGAGAAACAGG - Intronic
959822090 3:110747743-110747765 AGAAAGGCATTGAGAAAAGCAGG + Intergenic
959882254 3:111457294-111457316 AGGAAGGTTTAGAAGGAAACTGG - Intronic
959965982 3:112355425-112355447 AGGTAGGAATAGGGAGAAGCAGG - Intronic
960496552 3:118382643-118382665 AGGAAGGAAAAGAGAGAAGAAGG + Intergenic
960644189 3:119860304-119860326 AGGAAGAAATAGAAAGAAGGGGG + Intronic
962349221 3:134644552-134644574 AGGAAGCTATAGAGAGAAGATGG - Intronic
962611962 3:137085231-137085253 AAGAAAGAGTAGAGAGAAGCAGG + Intergenic
963357529 3:144228511-144228533 AGGAGGGAATAGAGAGAGACTGG + Intergenic
963776001 3:149441147-149441169 AGGAAGGAAGGGAGAGAAGGAGG + Intergenic
964665773 3:159170306-159170328 AGGAAGGGAGAGAGAGAGGAAGG + Intronic
965368176 3:167825086-167825108 AGGAAGGAAGAGAGAGAGGAAGG + Intronic
966093626 3:176171630-176171652 AGGAAGGAAAGGAGAGAAGGAGG + Intergenic
966158888 3:176947585-176947607 AGAAAGAGATAGAGAGAGGCAGG + Intergenic
966942341 3:184754907-184754929 AAGAAGGTATTGGGAGAAGAAGG + Intergenic
968157668 3:196396096-196396118 AGGAAGGTAGAGAGCGACACAGG - Intronic
968366875 3:198192345-198192367 AGGAAGGGAAAGAGAGAAAGAGG - Intergenic
968483585 4:848294-848316 AGGAAGGTGTGGAGTGCAGCAGG - Intergenic
968713991 4:2141067-2141089 AGGAAAGGGCAGAGAGAAGCTGG + Intronic
968957443 4:3726472-3726494 AGGAAGGGAGAGAGAGAGGAAGG + Intergenic
969507057 4:7594606-7594628 AGGAAGGGAGGGAGAGAAGGAGG - Intronic
970032167 4:11688427-11688449 AGGGAGGTATGAAGAGAAGGTGG + Intergenic
970171103 4:13291222-13291244 AGGAAGGCATTGAGAGTAGATGG - Intergenic
970370918 4:15405734-15405756 AGGAAGGTCTTGAAGGAAGCCGG - Intronic
970573485 4:17405248-17405270 AGGAAGGGAGGGAGAGAAGGAGG + Intergenic
970715454 4:18916736-18916758 AGCAAGTTAGAGAGAGAAGGGGG - Intergenic
971033788 4:22670304-22670326 AGGAAGGGAGTGAGGGAAGCAGG - Intergenic
971280302 4:25237674-25237696 AAGAAAGTATAGGGAGAGGCTGG + Intronic
971393784 4:26209860-26209882 AGGAAGGGAGAGAGGGAAGGAGG - Intronic
971493166 4:27235983-27236005 GTGAAGGAATAGAGATAAGCAGG + Intergenic
971760622 4:30760231-30760253 AGGAAGAAGTAGAGAGGAGCAGG + Intronic
972388399 4:38589832-38589854 AGCAAGGGACAGAGAGAAGATGG + Intergenic
972389470 4:38601174-38601196 AAGCAGGTATAGAGAAAAGGAGG + Intergenic
972525444 4:39905787-39905809 AGGAAGATAGGGAGAGAGGCAGG + Intronic
972727848 4:41761179-41761201 AGGAAGGAAGGGAGAGAAGGAGG + Intergenic
972855629 4:43103003-43103025 AGTAAGTTCTAGAGAGAAGCGGG - Intergenic
973047902 4:45558014-45558036 AGGAAGCAAGAGAGAGAAGGTGG + Intergenic
973843981 4:54892242-54892264 AGGAAGGAAGAGAGAGAGGGAGG - Intergenic
973848339 4:54935709-54935731 AGGAAGGTAGAAAGGGAAGGAGG - Intergenic
973877579 4:55235400-55235422 AAGTAGGTAAAGAAAGAAGCTGG + Intergenic
974404529 4:61448757-61448779 AGGAAGGAAGAGAGGGAAGGAGG + Intronic
974522186 4:62996058-62996080 AGGAAGGAAGGGAGAGAAGAAGG + Intergenic
975612728 4:76217508-76217530 AGGAAGCTAGAGAGAGAAGGAGG - Intronic
976018123 4:80585186-80585208 AGGAAGGGATAGAAAGAAAGAGG + Intronic
976331304 4:83833779-83833801 AGGAAGGTAGAGAAAGGAGCGGG + Intergenic
976336323 4:83892165-83892187 AGGAAGGAATAAAGAGAGGGAGG - Intergenic
976848114 4:89513120-89513142 AGGAAGGTAGAGAAAGGAGAGGG - Intergenic
977420178 4:96789651-96789673 AGGGAGGGAGAGAGAGAGGCAGG - Intergenic
977531606 4:98207133-98207155 AGGAGGGTTTTGAGAGAAGATGG + Intergenic
978026182 4:103877719-103877741 AGAAAGGTAGAGAGACAGGCAGG - Intergenic
978142478 4:105333340-105333362 AGGAAGGGATGAAGAGAAGTTGG + Intergenic
978228679 4:106370394-106370416 AGGAAGTGAGAGAGAGATGCAGG + Intergenic
978277335 4:106967831-106967853 AGGAAGGCAAAGAAAGAAGAGGG + Intronic
978471107 4:109068414-109068436 AGGAAGGGAGGGAGGGAAGCAGG + Intronic
978688430 4:111478072-111478094 ATAAAGGAAAAGAGAGAAGCAGG - Intergenic
978818975 4:112943344-112943366 AAGAAGGGATGGAGAGAGGCAGG - Intronic
979255289 4:118601954-118601976 AGGAAGGGAAAGAGAGAAAGAGG - Intergenic
979333046 4:119438554-119438576 AGGAAGGGAAAGAGAGAAAGAGG + Intergenic
980078605 4:128320469-128320491 AGGGAGGGAGAGAGAGAAGGAGG - Intergenic
980223572 4:129951133-129951155 AGGAAGGAAAAGACAGAAGGAGG + Intergenic
980577291 4:134699479-134699501 AGGAAGGAATCCAGAGAAGAAGG + Intergenic
981013578 4:139951111-139951133 AGGGAGGGAGAGAGAGAAGGAGG - Intronic
981015458 4:139969282-139969304 AGGTAGGTAGATAGAGAGGCAGG + Intronic
981190856 4:141860932-141860954 AGGAAGTTAAATAGAGAATCAGG + Intergenic
981227895 4:142318309-142318331 AGGGAGGAAGAGAGAGAAGGAGG + Intronic
982122276 4:152154720-152154742 AGAAAGGGAGAGAGAGAAGAAGG + Intergenic
982351170 4:154416810-154416832 AGGAAGGTGCAGCGAGGAGCTGG - Intronic
982441581 4:155442099-155442121 AGGAAGGGAGAGAGGGAAGGAGG - Intergenic
982710253 4:158750768-158750790 AGGAAGGAAGAGAGAGAGGGAGG + Intergenic
983910609 4:173234835-173234857 AGCAAGATACAGAGAGAAGGAGG - Intronic
984486686 4:180379134-180379156 AGGAAGGTAGGGAGAGGAGAAGG - Intergenic
984529755 4:180901923-180901945 AGTAGGGTAGAGAAAGAAGCAGG - Intergenic
985003826 4:185512906-185512928 GGGAACACATAGAGAGAAGCAGG + Intronic
985070424 4:186162376-186162398 AGGAAGGCAGAGAGAGAACTGGG - Intronic
985188452 4:187345050-187345072 AGGAAGGTCTAAAGAAAAGAAGG - Intergenic
985273582 4:188216732-188216754 AGGGAGGGAGAGAGAGAAGGAGG - Intergenic
985806318 5:2046398-2046420 AGTAAAATATAGAGAGAATCTGG + Intergenic
986296606 5:6444620-6444642 AGGAAGGGAGAGAGGGATGCTGG - Intergenic
986313350 5:6571064-6571086 AGGAAGGGAAAGAGGGAAGAGGG + Intergenic
987879531 5:23725030-23725052 AGGAAGAAATGGAGAGAAGGGGG - Intergenic
988720733 5:33876584-33876606 AGGAAGGAAGAGAGAAAAGGAGG + Intronic
988815914 5:34834900-34834922 AGTAAGGGATGGAAAGAAGCAGG + Intergenic
989288553 5:39733185-39733207 AGAAAGCTATACAGAGAGGCTGG - Intergenic
989481706 5:41938420-41938442 AGGTAGGCAAAGAGAGAAGAAGG + Intronic
989992455 5:50783167-50783189 AGGAGGGAAAAGAGAGAAGAGGG + Intronic
990755422 5:59064104-59064126 AGGAAAGGAAAGAGAGAAGGAGG + Intronic
991558471 5:67923041-67923063 AAGAAGGTATGGAGAGAGGGAGG + Intergenic
992658635 5:78935952-78935974 AGGAAGGGAAGGAGAGAAGGGGG - Intronic
993080901 5:83299489-83299511 AGGAAGGGACAGAGAGAATGAGG - Intronic
993131142 5:83899771-83899793 AGGAAGGTATTAACAGAAGCTGG + Intergenic
993249711 5:85504319-85504341 AAGTAGGTCTAGAGAGATGCAGG + Intergenic
993827609 5:92711072-92711094 TGGAAGGTATAGAAAGATGAAGG + Intergenic
993984534 5:94582176-94582198 AGGAACATAAAGAGAGATGCCGG + Intronic
994356947 5:98803356-98803378 AGGAAGGGAGGGAGAGAAGGAGG + Intergenic
994466756 5:100144354-100144376 AGCAATATATAGAGAGAAGATGG - Intergenic
994688500 5:102987163-102987185 ATGAATGGATAGAGAGAAGGTGG + Intronic
995091684 5:108185389-108185411 AGGAAGGAAAAGAGTGAAGTGGG - Intronic
995133368 5:108654355-108654377 AGAAGGGAATAGAGAGAAGTTGG + Intergenic
995295780 5:110519993-110520015 AGGGAGGGATAAAGAGAAGAGGG + Intronic
995441972 5:112202326-112202348 AGGAATGCAAAGAGAGAAGTGGG - Intronic
995484383 5:112625101-112625123 AGTAAGGTAAAGAGAAAAGTTGG - Intergenic
995837071 5:116409624-116409646 ATGAAGGCATAGGGAGAAGATGG + Intronic
996266994 5:121553458-121553480 AGGAAGGGAGGGAGGGAAGCAGG + Intergenic
996464321 5:123782075-123782097 AAAAAGGAAGAGAGAGAAGCGGG - Intergenic
996764705 5:127024119-127024141 AGGAAGGTAGTGAGAGGAGGAGG + Intronic
997110111 5:131065589-131065611 AAGAAGGAAGAGAGAGAAGCAGG - Intergenic
997425322 5:133799041-133799063 AGGAAGGTAGAGAGGAAAGGAGG + Intergenic
997552399 5:134764834-134764856 AGGAAGGAAGAGAGAGATGGAGG - Intronic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
998469308 5:142371024-142371046 AATAAGATATAGAGAGAGGCTGG + Intergenic
998507857 5:142686400-142686422 AGGGAGGTAGAGACAGAAGACGG + Intronic
999439575 5:151591045-151591067 TGGAAGGTAGAGAAGGAAGCAGG - Intergenic
999659349 5:153842716-153842738 AGAAAGGAAGAGAGAGAAGAGGG - Intergenic
999661306 5:153866131-153866153 AGTCAGGTATAGAGAGGAGCAGG - Intergenic
999822340 5:155240431-155240453 AGGAGGGTGTAGACAGGAGCAGG - Intergenic
999872305 5:155765337-155765359 AGGAAGGGAAAGAGAGAGGGAGG + Intergenic
1000340674 5:160274946-160274968 AGGAAGGAAGAGAGGGAATCTGG + Intronic
1000520999 5:162294170-162294192 AGGAAGGGATGGAGGGAAGGAGG + Intergenic
1001275471 5:170347740-170347762 GGAAAGGTATAAAGAGAATCTGG - Intergenic
1001774722 5:174320544-174320566 AGGAAGGGAGGGAGAGAAGGAGG - Intergenic
1001774743 5:174320604-174320626 AGGAAGGGAGGGAGAGAAGGAGG - Intergenic
1001774766 5:174320668-174320690 AGGAAGGGAGGGAGAGAAGGAGG - Intergenic
1001774811 5:174320798-174320820 AGGAAGGGAGGGAGAGAAGGAGG - Intergenic
1001824890 5:174736453-174736475 TGGAAGGTATAGAGTGAAAACGG - Intergenic
1002414135 5:179109965-179109987 CAGCAGGTATAGGGAGAAGCAGG - Intergenic
1002639625 5:180624644-180624666 AGGAAGGGGCACAGAGAAGCGGG - Intronic
1002726098 5:181297543-181297565 AGGAAGGGAAAGAGAGAAAGAGG - Intergenic
1003254599 6:4463858-4463880 AGGAAGGGATGGAGGGCAGCTGG + Intergenic
1003399876 6:5782646-5782668 AGGAAGGGAGAGAGGGAAGGAGG - Intergenic
1003673446 6:8181278-8181300 AGGAAGGGAGGGAGGGAAGCAGG - Intergenic
1003754384 6:9100421-9100443 AGGAAGGAAGAGAGAGAGGAAGG - Intergenic
1003754387 6:9100441-9100463 AGGAAGGAAGAGAGAGAGGAAGG - Intergenic
1003754394 6:9100474-9100496 AGGAAGGAAGAGAGAGAGGAAGG - Intergenic
1003754405 6:9100532-9100554 AGGAAGGAAGAGAGAGAGGAAGG - Intergenic
1003754433 6:9100662-9100684 AGGAAGGAAGAGAGAGAGGAAGG - Intergenic
1003942115 6:11039900-11039922 AGGAAGGAATGGAGAGAATGTGG + Intronic
1004040266 6:11968267-11968289 AGCAAGGTACTGAGAGGAGCAGG + Intergenic
1004904183 6:20221021-20221043 ATGGAGGGAAAGAGAGAAGCAGG - Intergenic
1005088744 6:22034303-22034325 AGGAGGGAGAAGAGAGAAGCTGG - Intergenic
1005091999 6:22066952-22066974 AGGAAAGGATGGAGAGAAGAAGG - Intergenic
1005441898 6:25878959-25878981 AGGAAGGAAAGGAGAGAAGGAGG - Intronic
1005863425 6:29918698-29918720 AGGAAGGGAGAGAAAGAAGGAGG - Intergenic
1006034873 6:31203108-31203130 AGGAAAGTGAAAAGAGAAGCAGG + Exonic
1006202427 6:32306733-32306755 AGGAAGGGAAGGAGAGAAGGAGG - Intronic
1006762378 6:36474424-36474446 GGGAAGGTATAGGGAATAGCAGG + Intronic
1006782790 6:36643464-36643486 GGGACGGTGTGGAGAGAAGCAGG - Intergenic
1007019735 6:38507487-38507509 TGGATGGTATGGAGAGAAGAGGG - Intronic
1007292302 6:40797044-40797066 AGGAGGGGAGGGAGAGAAGCTGG - Intergenic
1007377438 6:41466531-41466553 AGGAAGGAAGAGAGGGAAGAAGG + Intergenic
1008184962 6:48377361-48377383 AGAAAGGAAGAGAGAGAGGCTGG + Intergenic
1008288412 6:49682815-49682837 AGGAAGGGATGGAGGGAAGGAGG - Intergenic
1008293451 6:49748078-49748100 AGAAAGGAAAAGAGTGAAGCAGG + Intergenic
1009676783 6:66834752-66834774 AGGAATGTATAGACAGATTCAGG + Intergenic
1009757179 6:67955370-67955392 AGGAAAGTGTAGAGTGAAGGGGG - Intergenic
1010130076 6:72481644-72481666 AGGGAGGTATGAAGAGAAACTGG + Intergenic
1010896383 6:81370067-81370089 AGGAATGGATAGAGAAAAACAGG + Intergenic
1011176609 6:84568363-84568385 AGGAAGGAATGGGGAGATGCTGG + Intergenic
1011280295 6:85670795-85670817 AGGAAGGAAGAGAGGGAAGGAGG - Intergenic
1011349598 6:86407995-86408017 AGGAAGGAGTATAAAGAAGCAGG - Intergenic
1011822795 6:91272647-91272669 AGGAAGGGAAAGAGGGAAGGAGG - Intergenic
1011935078 6:92766834-92766856 AGGAAGGTATAAAAATAGGCAGG + Intergenic
1012421699 6:99072575-99072597 AGGAGGGTGGAGAGAGCAGCAGG - Intergenic
1012671302 6:102051236-102051258 AGGAAGGGAGGGAGGGAAGCAGG - Intronic
1012916191 6:105173650-105173672 AGCATGGTATAAACAGAAGCAGG - Intronic
1014041905 6:116837620-116837642 AGGAAAGTATAGAGAGAACTTGG + Intergenic
1014062183 6:117084279-117084301 AGGAAGGTATATAGATAGGTTGG - Intergenic
1014910386 6:127085484-127085506 AGGAAGGGAGAAAGAGAAGGAGG + Intergenic
1014921822 6:127222454-127222476 AGGAAGGAAGGGAGGGAAGCGGG + Intergenic
1015450374 6:133360734-133360756 AGGAAGGTGTAGAGGAAAGCTGG - Intronic
1015556780 6:134470725-134470747 AGGAAGAGAGAGAGAGAAGAAGG - Intergenic
1015653293 6:135487795-135487817 AGGAAGGGATGAAGAGAAGTTGG - Intronic
1015823187 6:137284350-137284372 AGGAAGGTAAATAGGGAGGCAGG + Intergenic
1016413798 6:143812169-143812191 AGGAAGCTATATACAGAAGTGGG - Intronic
1016717367 6:147250097-147250119 AGGAAGCTGTAGCCAGAAGCAGG + Intronic
1016804967 6:148203373-148203395 AGGAAGGGAGGGAGAGAAGACGG - Intergenic
1016897424 6:149066995-149067017 AGAAAGGTATAGAAAAAAGCTGG - Intronic
1017098550 6:150826937-150826959 AGAAAGATAGAGAGAGAATCAGG - Intronic
1017269578 6:152490909-152490931 TGAAAGGTAGCGAGAGAAGCTGG - Intronic
1017790279 6:157792095-157792117 AGGAAGGGATGGAGGGAAGGAGG - Intronic
1017880077 6:158556482-158556504 AGGGAGGTATAGAAAGATGAAGG + Intronic
1017929305 6:158938510-158938532 AGGAAGGTAGGGAGAGCAGCAGG + Intergenic
1018475640 6:164138166-164138188 AGGGAGGAATGCAGAGAAGCAGG - Intergenic
1019127044 6:169847525-169847547 AGGAAGAGAGAGAGAGAAGGGGG - Intergenic
1020523625 7:9228207-9228229 AGGAAGGGATAGGGAGAGGTGGG + Intergenic
1020923354 7:14293315-14293337 AGGCAGGTACAAATAGAAGCTGG - Intronic
1020949399 7:14655887-14655909 AGAAAGGCAAAGAGAGAAGTTGG + Intronic
1021719499 7:23491765-23491787 AGGAAGGCAGGGAGAGAAGGAGG - Intergenic
1021782876 7:24122859-24122881 AGGAAGGTAGAAAGGCAAGCAGG + Intergenic
1022332316 7:29391403-29391425 AGGAAGGGAGAGAGGGAAGGAGG + Intronic
1022525334 7:31033543-31033565 GGGAAGGTCTAGGGAGAATCAGG + Intergenic
1022655448 7:32315376-32315398 AGGAAGGTAGAGAGGAAAGGAGG + Intergenic
1022974237 7:35543201-35543223 AGGAAGAGATAGAGAAAAGGAGG + Intergenic
1023114904 7:36853208-36853230 AGGAGGGTCTAGGGAGGAGCTGG + Intergenic
1023239265 7:38126158-38126180 AGCCAGCTATTGAGAGAAGCTGG + Intergenic
1023485752 7:40684699-40684721 GGGAAGGGAGAGAGAGAAGCAGG - Intronic
1024004564 7:45216011-45216033 AGGGAGGGAGAGAGAGAAGGGGG + Intergenic
1024356826 7:48422113-48422135 AGGAAGGAAGAGAAGGAAGCAGG + Intronic
1024496970 7:50059968-50059990 AGGAAGGCATTGAGAGTAGTCGG + Intronic
1024777728 7:52807165-52807187 AGGAAGGGAAATAGGGAAGCTGG + Intergenic
1025073700 7:55924393-55924415 AGGGAGATACAGAGAGAGGCTGG - Intronic
1026305288 7:69134970-69134992 AGGGAGGTAGAGAGTGAAGGAGG - Intergenic
1026319268 7:69254798-69254820 AAGAAGGGAGAGAGAGAAGAAGG + Intergenic
1026422241 7:70251561-70251583 AGGAAGGGAAAGAGAGAATGAGG - Intronic
1026494132 7:70888117-70888139 AGGAAGGGAAAGAGAGAAGGAGG + Intergenic
1026589032 7:71680307-71680329 AGGAAGGGATAGAGGGAGGAAGG - Intronic
1026904070 7:74052726-74052748 AGGGAGGGAGAGAGAGAGGCAGG + Intronic
1028201658 7:87968938-87968960 AGGAAGAGAGAGAGAGAAGGGGG + Intronic
1028247455 7:88498380-88498402 AGAAAGGTATACAGAGAATGGGG - Intergenic
1028435645 7:90800130-90800152 AGAAAGGAAGAGAGAGAAGGTGG - Intronic
1029121311 7:98270260-98270282 AGGATGGTTTGGGGAGAAGCTGG - Intronic
1029162034 7:98559411-98559433 AGGAAGGAAAAGAAAGAAGAAGG - Intergenic
1029164052 7:98573583-98573605 AGGAAGGAAGGGAGGGAAGCAGG + Intergenic
1030174352 7:106636034-106636056 AGGAAGGGAGAGAGGGAGGCGGG + Intergenic
1030607684 7:111655362-111655384 AGGGAGGAAGAGAGAGAAGAGGG + Intergenic
1030762132 7:113364972-113364994 AAGGAGGAAGAGAGAGAAGCGGG - Intergenic
1030789974 7:113712488-113712510 AGAAAGATACAGAGAGAAGAGGG - Intergenic
1030927822 7:115479528-115479550 AGGAAGGAAGAGAGGGAAGGAGG - Intergenic
1031138005 7:117906961-117906983 AGGAAGGTATTTATGGAAGCAGG - Intergenic
1031168467 7:118260682-118260704 AGGAAGGGAGGGAGAGAAGGAGG - Intergenic
1031630162 7:124034282-124034304 AGGAAGGGAGAGAGAGAGGGAGG - Intergenic
1032164336 7:129533741-129533763 AGCTAGGGAAAGAGAGAAGCCGG - Intergenic
1032713368 7:134482644-134482666 GGGAAGATATAGTGAGAAGGTGG - Intergenic
1032746942 7:134795586-134795608 AGGAAGGGAAAGAGAGAGGAAGG - Intronic
1033176475 7:139128517-139128539 AAGGAGGGATAGAGAGAAGGGGG - Intergenic
1034344482 7:150378267-150378289 AGGTAGATACAGACAGAAGCTGG - Intronic
1034487570 7:151375591-151375613 AGGAAGGGATGGAGAGCAGGTGG - Intronic
1035188027 7:157140946-157140968 AGGAAGGGCGAGAGGGAAGCTGG + Intronic
1035353940 7:158265920-158265942 AGCATGCTAGAGAGAGAAGCTGG - Intronic
1035470556 7:159106471-159106493 AGGAAGGGGCAGAGAGAGGCCGG + Intronic
1035470654 7:159106776-159106798 GGGGAGGTAGAGAGAGAGGCCGG + Intronic
1035470660 7:159106797-159106819 GGGGAGGTACAGAGAGAGGCCGG + Intronic
1036282858 8:7416603-7416625 AGGGAAGAAGAGAGAGAAGCAGG + Intronic
1036338611 8:7894915-7894937 AGGGAAGAAGAGAGAGAAGCAGG - Intronic
1036523187 8:9511369-9511391 AGGGAGTTAAAGAGATAAGCAGG + Intergenic
1036648863 8:10629405-10629427 GGGAAGGAATAGGGAGAAGCTGG + Intronic
1036746418 8:11413132-11413154 AGGAAGGGAGAGAGAGAAATGGG - Intronic
1037291957 8:17360625-17360647 AGGAAGGAATATGGAGAGGCAGG - Intronic
1037396527 8:18449562-18449584 AGGAAGGTAGTGAGAGGAGAAGG + Intergenic
1037634729 8:20691562-20691584 AGGATGCTATAGAAAGAAGGAGG + Intergenic
1037681701 8:21103002-21103024 ATGAAGGGATAGAGAGAAAATGG + Intergenic
1037796554 8:22000254-22000276 ATGAAGCTTTAGAGATAAGCAGG + Intronic
1037927270 8:22853567-22853589 AGGTAGGAATAGAGGGAACCAGG + Intronic
1037931333 8:22882118-22882140 GGGAAAGGATAGGGAGAAGCAGG - Intronic
1038319261 8:26513319-26513341 AGGAATATAGAGAGAGACGCAGG - Intronic
1038927291 8:32154523-32154545 AGGAAAATAAAGAGAGAAGGAGG - Intronic
1039042852 8:33424555-33424577 CGAAAGGCCTAGAGAGAAGCAGG + Intronic
1039097791 8:33905134-33905156 GGAAAGGTAGAGAGAGAAGGAGG - Intergenic
1039407571 8:37326390-37326412 AGGAAGGAAGTGAGACAAGCTGG - Intergenic
1039906296 8:41788880-41788902 ATGAAGAGATAGAGAGGAGCTGG - Intronic
1040442989 8:47464464-47464486 TGGAAGGAATAAACAGAAGCTGG + Intronic
1040824645 8:51607976-51607998 AGGAAGGAAGAGAGAGAGGAAGG + Intronic
1040875612 8:52148675-52148697 AGGAAGGGAGAGAGGGAAGGAGG + Intronic
1040903569 8:52441698-52441720 AGGAAGGAAGGGAGAGAAGGAGG + Intronic
1041097114 8:54361355-54361377 AGGAAGGAAAAGAGGGAAGGAGG - Intergenic
1041144967 8:54865362-54865384 AAGAAGGGAGAGAGAGAAGGAGG - Intergenic
1041447695 8:57970775-57970797 AGGAAGGGACAGAGGGAAGAAGG - Intergenic
1043115488 8:76248131-76248153 GGGCAGGCATAGAGGGAAGCTGG - Intergenic
1044398539 8:91742901-91742923 AGGAAACTAGAGAGAAAAGCAGG - Intergenic
1044953164 8:97452956-97452978 AGGAAGGGATAGAGGGAAGGAGG + Intergenic
1045322563 8:101092825-101092847 AGGAAGGAAGAGAGAGAGGAAGG - Intergenic
1045338370 8:101229957-101229979 AGGAAGGCATAGGGAAAGGCAGG + Intergenic
1046023910 8:108699220-108699242 AGGAAGGGAGGGAGAGAAGGAGG - Intronic
1046130987 8:109968634-109968656 GGGAAGGAAGAGAGAGAAGAGGG - Intronic
1046893856 8:119451620-119451642 AGGATGGTATAAAGAGGAGCTGG - Intergenic
1047163176 8:122404803-122404825 AGGAAGGGAGAGAGGGAGGCAGG - Intergenic
1047356326 8:124125578-124125600 AGAAAGGCACAGAGAGATGCTGG - Intergenic
1047770533 8:128026964-128026986 AGGAAGGCAAAGAGAGGGGCTGG - Intergenic
1047778729 8:128094684-128094706 AGGGAGGAATAGAGAGTAGAAGG - Intergenic
1048002246 8:130388247-130388269 AGGAGGGTACAGAGATAGGCAGG + Intronic
1048278841 8:133089760-133089782 AGGGAGTTATAGACAGGAGCTGG - Intronic
1048281997 8:133112506-133112528 AGGAAGGAACAGAGAGAGGGGGG + Intronic
1048416566 8:134233614-134233636 AGGAAGGTAAAGAGACATACAGG + Intergenic
1048522153 8:135166415-135166437 AGGGAGGGAGAGAGGGAAGCTGG - Intergenic
1048591553 8:135825286-135825308 AGGAAGAGAGAGAGAGAGGCAGG - Intergenic
1049361128 8:142213016-142213038 AGGAAGGATTAGAGAGAGGGAGG - Intronic
1049361164 8:142213115-142213137 AGGAAGGATTGGAGAGAAGGTGG - Intronic
1049501523 8:142970269-142970291 AGGAAGGGATGGAGAAAAGAGGG + Intergenic
1049701303 8:144014362-144014384 AGGAAGGAAAAGAGAGGAGGAGG + Intronic
1049945067 9:586456-586478 AAGAAGGGGTAGAGAGCAGCTGG + Intronic
1050686037 9:8170347-8170369 AGGAAGGGAGAGAGAGAGGAAGG - Intergenic
1050771901 9:9212398-9212420 AGGAATGTGTAGAGAGTAGCTGG - Intronic
1050785645 9:9398110-9398132 AGGAAGGGAGAAAGAGAAGCAGG - Intronic
1050861897 9:10445351-10445373 AGGCAGGTACAGAGAGAAGCTGG + Intronic
1050871297 9:10573584-10573606 AGGAAGGCATTGAGAGCAGATGG + Intronic
1051164748 9:14249663-14249685 AGGAAGGAAGAGAGAGAGGGAGG + Intronic
1051533782 9:18133969-18133991 TGGAATGTATTGAGAGAAGATGG + Intergenic
1051675991 9:19558751-19558773 AGGGAGGTAGGAAGAGAAGCAGG - Intronic
1051721152 9:20039096-20039118 AGGAAAATATAGACAGAAGGGGG + Intergenic
1051834275 9:21317446-21317468 AGAAAGGAAGAGAGAGAACCAGG + Intergenic
1052418667 9:28211841-28211863 AGGAAGGGAGAGAGAGAAAAAGG - Intronic
1052779933 9:32771011-32771033 GGGAAGGGATAAAGAGAAGTTGG + Intergenic
1052866697 9:33468425-33468447 TGGGGGGTGTAGAGAGAAGCAGG + Intronic
1053860408 9:42381114-42381136 AGGATGGCATAGAGAGAGACTGG + Intergenic
1055845912 9:80563453-80563475 AGGAAGGAAGAGAGGGAAGGAGG + Intergenic
1056521247 9:87403603-87403625 ATGAAGGTATAGAGATAATCTGG + Intergenic
1057042885 9:91860082-91860104 AGGAAGGCACAGGGAGAAACAGG + Intronic
1057496281 9:95563910-95563932 AGGAAGGAAGGGAGAGAAGAAGG - Intergenic
1058022699 9:100106203-100106225 AGGAAGATGAAGAGAGAAGATGG - Intronic
1058040109 9:100293834-100293856 ATGAATGTCCAGAGAGAAGCTGG + Intronic
1058410329 9:104724612-104724634 AGGAGGGTAGACAGAGAAGCAGG + Intergenic
1058980919 9:110169572-110169594 AGGAAGGTAGAGAGAGAAAAAGG + Exonic
1059154348 9:111976678-111976700 AGGAAGGAATGGAGAGAAGGAGG + Intergenic
1059344297 9:113617501-113617523 AGGAAGGTAGAGAGGGTATCAGG - Intergenic
1059521813 9:114949810-114949832 AGGAAGAGAGAGAGAGAAGGAGG - Intergenic
1059675827 9:116538201-116538223 AGGAAGGGAAAGAGGGAAGAAGG + Intronic
1059723687 9:116985866-116985888 AGGAAGGCATGGAGAGCAGAGGG + Intronic
1060585661 9:124783893-124783915 ATGAAGGGATAGAGAGTAACAGG + Intronic
1061260581 9:129478699-129478721 AGGAAGGGAGAGAGGGAAGGAGG + Intergenic
1062520993 9:136957857-136957879 AGGAAGGTTGAGAGTGAAGGTGG + Intergenic
1062668417 9:137691911-137691933 AGGAAGGAAATGAGAGAACCAGG - Intronic
1062751232 9:138255189-138255211 AGGAAGGGAAAGAGAGAAAGAGG - Intergenic
1185637188 X:1561384-1561406 AGGAAGGAACAGAGAGACGGAGG - Intergenic
1185695191 X:2188765-2188787 AGGGAGGGAAAGAGAGGAGCAGG + Intergenic
1185857198 X:3546899-3546921 AGGAAGGAAAAGAGGGAGGCAGG + Intergenic
1185857213 X:3546952-3546974 AGGAAGGAAAAGAGGGATGCAGG + Intergenic
1186058823 X:5681518-5681540 AGGAAGGAAGAAAGGGAAGCAGG + Intergenic
1186072145 X:5833470-5833492 AGGAAAGAATAATGAGAAGCAGG - Intergenic
1186246596 X:7622406-7622428 AGGAAGGAAGGGAGAGAAGGAGG - Intergenic
1186246681 X:7622687-7622709 AGGAAGGAAGAGAGGGAAGGAGG - Intergenic
1186270088 X:7877552-7877574 AGCAAGGTAGGGAGAGAAGGAGG + Intergenic
1186490700 X:9970154-9970176 AGGAAGGGAGAGAGGGAAGAAGG - Intergenic
1186749457 X:12606741-12606763 AGGAAGGGAGAGAGGGAAGAAGG - Intronic
1188027018 X:25220644-25220666 AGCAGGGGAAAGAGAGAAGCTGG + Intergenic
1188617699 X:32179010-32179032 AGGAAGGGAGAGAGAGATGTAGG - Intronic
1188833649 X:34931438-34931460 AGGAAGGCATTGAGAGTAGATGG + Intergenic
1189131380 X:38501403-38501425 AGGAAGGAAGTGAGGGAAGCAGG - Intronic
1189224188 X:39398731-39398753 AGAAAGGAAGAGAGAGAAGAAGG - Intergenic
1189246764 X:39569278-39569300 AGGAAGGAAAAGAGAGAGGAGGG - Intergenic
1189343549 X:40222769-40222791 AGGAAGGAAAAGAGAGAGGAGGG + Intergenic
1190909236 X:54756982-54757004 AGGAAGGTATAGAAAGCTGGTGG + Exonic
1190927498 X:54922440-54922462 AGGAAGGAATAGAGTCAGGCAGG - Intronic
1191901605 X:66046430-66046452 AGGAAAGTGCAGAAAGAAGCAGG + Intergenic
1192101723 X:68271677-68271699 GAGAAGGTATAAAGAGAAGGTGG + Intronic
1192156397 X:68749971-68749993 AGGTAGGTTTAGGGAGCAGCTGG + Intergenic
1192234197 X:69285682-69285704 AGGAGGGGGGAGAGAGAAGCGGG + Intergenic
1192390937 X:70727785-70727807 ATGAAGATATAGAAAGAAGGTGG + Intronic
1193101213 X:77614853-77614875 AGGGAGGGATAGAGAGAGGTTGG - Intronic
1193953394 X:87827869-87827891 AGGAGGGGATAAAGAGAGGCTGG - Intergenic
1194207853 X:91033043-91033065 AGGAAGGGGCAGAGAGGAGCAGG - Intergenic
1195374185 X:104210242-104210264 AGGAAGGCAAAGATAAAAGCAGG + Intergenic
1195764644 X:108283179-108283201 AGAAAGGTATAGAGGCAAGAAGG + Intronic
1195887157 X:109650710-109650732 AAGAAGGTATAGAGAGACAAAGG - Intronic
1196015642 X:110937580-110937602 AGGAAGCAAGAGAGAGAAGTGGG - Intergenic
1196261126 X:113582960-113582982 AGGAAGTAAGAGAGAGAAGGAGG + Intergenic
1196301298 X:114052191-114052213 AGCTAGGGAAAGAGAGAAGCTGG - Intergenic
1197562529 X:128041232-128041254 AGAAAGGAATAGAACGAAGCAGG - Intergenic
1198116494 X:133549748-133549770 AGGAAGGTAAAGAGAGAGAGAGG - Intronic
1198421407 X:136473212-136473234 AGGGAGGGAGAGAGAGAGGCAGG + Intergenic
1198631349 X:138642186-138642208 GGGGAGGTATAGAGAAAAGGGGG + Intronic
1199295535 X:146153615-146153637 AGTAAGGTAGAGAAGGAAGCAGG - Intergenic
1199295731 X:146156130-146156152 AGGAAGATACAGAGAGAGTCTGG - Intergenic
1199316543 X:146385336-146385358 AAGTAGGAATAGAGAGAAGATGG + Intergenic
1199420931 X:147643927-147643949 TGGAAGGTGGAAAGAGAAGCAGG - Intergenic
1201650509 Y:16279852-16279874 AGGAAGGAAGAGAGAGAGGGAGG - Intergenic
1202282755 Y:23207426-23207448 AGGAAGATAAAGAAGGAAGCTGG - Intergenic
1202283136 Y:23211093-23211115 AGGAAGATAAAGAAGGAAGCTGG + Intergenic
1202386962 Y:24335519-24335541 AGGAAGGGAGAGAGAGAGGGAGG - Intergenic
1202434429 Y:24821811-24821833 AGGAAGATAAAGAAGGAAGCTGG - Intergenic
1202434810 Y:24825479-24825501 AGGAAGATAAAGAAGGAAGCTGG + Intergenic
1202483824 Y:25334609-25334631 AGGAAGGGAGAGAGAGAGGGAGG + Intergenic