ID: 1081299192

View in Genome Browser
Species Human (GRCh38)
Location 11:41429328-41429350
Sequence CTTTATTAGCAGCATGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5829
Summary {0: 6, 1: 402, 2: 665, 3: 2357, 4: 2399}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081299190_1081299192 -7 Left 1081299190 11:41429312-41429334 CCAGTATTGGGTATGTCTTTATT 0: 15
1: 955
2: 3139
3: 5562
4: 8022
Right 1081299192 11:41429328-41429350 CTTTATTAGCAGCATGAGGACGG 0: 6
1: 402
2: 665
3: 2357
4: 2399
1081299187_1081299192 7 Left 1081299187 11:41429298-41429320 CCTTTATAAATTATCCAGTATTG 0: 1
1: 141
2: 1791
3: 2909
4: 4711
Right 1081299192 11:41429328-41429350 CTTTATTAGCAGCATGAGGACGG 0: 6
1: 402
2: 665
3: 2357
4: 2399
1081299186_1081299192 14 Left 1081299186 11:41429291-41429313 CCTCTTTCCTTTATAAATTATCC 0: 277
1: 4268
2: 8719
3: 9110
4: 8100
Right 1081299192 11:41429328-41429350 CTTTATTAGCAGCATGAGGACGG 0: 6
1: 402
2: 665
3: 2357
4: 2399

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081299192 Original CRISPR CTTTATTAGCAGCATGAGGA CGG Intronic
Too many off-targets to display for this crispr