ID: 1081299444

View in Genome Browser
Species Human (GRCh38)
Location 11:41432750-41432772
Sequence CCAGGATTTGATTTTAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 249}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081299444_1081299451 24 Left 1081299444 11:41432750-41432772 CCTTCATTAAAATCAAATCCTGG 0: 1
1: 0
2: 0
3: 19
4: 249
Right 1081299451 11:41432797-41432819 GGCATCATTTTTCCCCCCTGTGG 0: 1
1: 0
2: 1
3: 24
4: 222
1081299444_1081299449 3 Left 1081299444 11:41432750-41432772 CCTTCATTAAAATCAAATCCTGG 0: 1
1: 0
2: 0
3: 19
4: 249
Right 1081299449 11:41432776-41432798 AATGAGACCAAAATCAGGGCTGG 0: 1
1: 0
2: 2
3: 15
4: 229
1081299444_1081299452 27 Left 1081299444 11:41432750-41432772 CCTTCATTAAAATCAAATCCTGG 0: 1
1: 0
2: 0
3: 19
4: 249
Right 1081299452 11:41432800-41432822 ATCATTTTTCCCCCCTGTGGTGG 0: 1
1: 0
2: 0
3: 13
4: 183
1081299444_1081299447 -2 Left 1081299444 11:41432750-41432772 CCTTCATTAAAATCAAATCCTGG 0: 1
1: 0
2: 0
3: 19
4: 249
Right 1081299447 11:41432771-41432793 GGTGTAATGAGACCAAAATCAGG 0: 1
1: 0
2: 1
3: 7
4: 115
1081299444_1081299448 -1 Left 1081299444 11:41432750-41432772 CCTTCATTAAAATCAAATCCTGG 0: 1
1: 0
2: 0
3: 19
4: 249
Right 1081299448 11:41432772-41432794 GTGTAATGAGACCAAAATCAGGG 0: 1
1: 0
2: 0
3: 17
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081299444 Original CRISPR CCAGGATTTGATTTTAATGA AGG (reversed) Intronic
904499634 1:30906793-30906815 CAAGCCTTTGATTTTAAGGATGG + Intronic
910518129 1:88086685-88086707 CCTGGATTTGATTTTTTGGAGGG + Intergenic
911906358 1:103573186-103573208 TCTGGATGGGATTTTAATGATGG + Exonic
911912929 1:103657917-103657939 TCTGGATGGGATTTTAATGATGG + Exonic
911915526 1:103694031-103694053 TCTGGATGGGATTTTAATGATGG - Exonic
911920341 1:103752056-103752078 TCTGGATGGGATTTTAATGATGG + Exonic
912251557 1:108017280-108017302 CCAAAATTTGATTGTAAGGATGG + Intergenic
912342082 1:108926318-108926340 CCAGGAAGTGATTTTAATAATGG + Intronic
916266648 1:162896837-162896859 CCAGGATTTAATTATAAAGGTGG + Intergenic
916637654 1:166690999-166691021 GCAGGTTTTTATTTTAAAGATGG - Intergenic
916841320 1:168604062-168604084 CCATGAGTTGATTTTCATCAAGG - Intergenic
917024161 1:170624050-170624072 CCAAGAGTTCATTATAATGATGG + Intergenic
917921024 1:179750008-179750030 CCAGGATTCTGTTTTAATGCAGG + Intronic
919330982 1:196171239-196171261 CCAGGATTGGATTTTGCTGTTGG + Intergenic
922708795 1:227810331-227810353 CCAGCATCTGCTTTTAGTGAGGG - Intergenic
923721163 1:236468190-236468212 TTTGGATATGATTTTAATGAAGG + Intronic
1063855969 10:10254409-10254431 CAAGGCTTTGATTTTAAACATGG + Intergenic
1064560279 10:16588878-16588900 CCAGGATTTGAAGTAGATGAAGG + Intergenic
1065421357 10:25547797-25547819 CGAGACTTTGATTTTACTGAAGG - Intronic
1066028757 10:31395003-31395025 CCAGTATTTGGACTTAATGAAGG - Intronic
1066285524 10:33962454-33962476 CCAGCTTTTGATTTTAAGCAAGG + Intergenic
1067565772 10:47335781-47335803 CCAGGATTTGAGTGTGATGTGGG - Intergenic
1069175922 10:65287792-65287814 CCAGGATGTAATTTCTATGATGG + Intergenic
1069495506 10:68900354-68900376 AAAGGATTTAATTTTAGTGATGG - Intergenic
1069716920 10:70527006-70527028 CCAAGAATTGATTATGATGATGG - Intronic
1070874574 10:79791198-79791220 TTATGATTTGATTTTTATGATGG + Intergenic
1071641498 10:87313362-87313384 TTATGATTTGATTTTTATGATGG + Intergenic
1071757984 10:88567109-88567131 AAAGGATATAATTTTAATGAGGG + Intronic
1071785224 10:88892141-88892163 GCAGGAGTTGATTTTAAATAGGG + Intronic
1072143840 10:92615444-92615466 CAAAGATTTTTTTTTAATGAAGG - Intronic
1072296910 10:94017524-94017546 CCAGAATTTGATGTCATTGATGG + Intronic
1073002229 10:100294299-100294321 TGAGGGTTTGATTTTACTGAGGG + Intronic
1074086937 10:110215339-110215361 CCAGGTTTTGTTTTTAAAGGAGG + Intronic
1078259240 11:9689251-9689273 CCTTGATTTCATTTTCATGATGG + Intronic
1078817304 11:14838646-14838668 GCAGGATTTAAGTTTAATTATGG - Intronic
1078971039 11:16411528-16411550 ACAGGATATTATTTTAATGTTGG + Intronic
1080102272 11:28473357-28473379 CCAGGATTTGTTTTACATGCAGG - Intergenic
1081174369 11:39909006-39909028 CCATGATATGTTTTGAATGATGG - Intergenic
1081299444 11:41432750-41432772 CCAGGATTTGATTTTAATGAAGG - Intronic
1085926310 11:81026957-81026979 CCAACATTTGTTTTTAAAGAAGG - Intergenic
1086003658 11:82010570-82010592 CCAGTTTGTTATTTTAATGACGG - Intergenic
1086927548 11:92656785-92656807 CTTGGATTTCATTTTATTGATGG + Intronic
1087349772 11:97017101-97017123 AAAGGAGGTGATTTTAATGAAGG + Intergenic
1088933415 11:114375378-114375400 ACAGAATTTGCTTTAAATGAAGG + Intergenic
1090511366 11:127378889-127378911 ACAGTATTTGAGTCTAATGAAGG + Intergenic
1090957545 11:131526777-131526799 TCAGCATTTGATTTGAATCAGGG + Intronic
1091085411 11:132717277-132717299 CCAGAATTTTTTTTTAATAATGG + Intronic
1098119507 12:67221223-67221245 CCTGGATCTGATTTTAAGGGTGG - Intergenic
1099611100 12:84871637-84871659 CAAGGTTTTTATATTAATGATGG + Intronic
1101668310 12:106841185-106841207 GCAGTATTTGGTTTTAGTGAGGG + Intronic
1102131281 12:110530748-110530770 CCAGGACTTCCTTTTAATGGAGG + Intronic
1102919289 12:116779724-116779746 CCAGGAGTTCATTTTATAGAGGG + Intronic
1103031216 12:117614928-117614950 ACTGAATTTGATTATAATGATGG + Intronic
1103031697 12:117619876-117619898 CTAGAATTGGATTTTGATGATGG - Intronic
1104298521 12:127541351-127541373 CCATGATTACATTTAAATGATGG - Intergenic
1104717720 12:131027061-131027083 CTAGGATTTGCTGTGAATGAGGG + Intronic
1105564446 13:21530464-21530486 CCAGGATTTTTTTTTTTTGAAGG - Intronic
1108127273 13:47258131-47258153 CCAGGAGTCCATTTGAATGAGGG + Intergenic
1108724134 13:53162439-53162461 CCTGGAGTTGATTTAGATGAGGG + Intergenic
1109513216 13:63406115-63406137 CCAGCATCTGCTTTTGATGAGGG + Intergenic
1110874749 13:80494626-80494648 CCAGCATTTGCTTCTGATGAGGG - Intergenic
1111014324 13:82357378-82357400 CAAGAATTTGTTATTAATGAAGG - Intergenic
1112237794 13:97651880-97651902 CCAGCATCTGCTTTTGATGAGGG + Intergenic
1113047642 13:106173109-106173131 GAAGGATTTGATTTAAATAAGGG + Intergenic
1115435755 14:33371148-33371170 ACAGGATTTGATTTTGGTGGAGG + Intronic
1116303344 14:43215824-43215846 CCAGCATCTGATTCTGATGAAGG - Intergenic
1116581372 14:46646432-46646454 CCAGAATTTTTTTTTAATGTCGG - Intergenic
1117169208 14:53074418-53074440 CTAGGATTTGCTTTTAAATATGG - Intronic
1120312610 14:82850060-82850082 CCAGGATTTTATTTTTTTAATGG - Intergenic
1121614933 14:95307386-95307408 CTTGGATTTGTTGTTAATGATGG - Intronic
1124590119 15:31046637-31046659 ACAGGATTTGATTTTGGTGCAGG + Intronic
1126860884 15:52881820-52881842 CAAGGATTTGATTTTCATGGAGG - Intergenic
1127225837 15:56927795-56927817 CCAGGGATTGATGTTAATGGTGG + Intronic
1127924886 15:63529805-63529827 CCAGGATATTTTTTTAATTATGG - Intronic
1128524576 15:68403540-68403562 CCAGCATCTGCTTCTAATGAGGG - Intronic
1129121584 15:73400464-73400486 CCAGGATTAGATTGTGGTGATGG - Intergenic
1131928084 15:97408162-97408184 CCATGATTTGATTGTGGTGATGG + Intergenic
1133487692 16:6236229-6236251 CCAGGATTTGAATTCAATCAGGG - Intronic
1133652329 16:7824215-7824237 TCAATATTGGATTTTAATGAGGG + Intergenic
1133895977 16:9929197-9929219 ACAGGATTTGAGCTTATTGATGG - Intronic
1134824614 16:17274598-17274620 TCAGGATTTGAATTTCATCAAGG + Intronic
1135159342 16:20079718-20079740 CCAGGAGGTGATCTTAATGCAGG - Intergenic
1137474664 16:48797308-48797330 GCAGGATCTGATTCTAGTGAGGG + Intergenic
1139317286 16:66084187-66084209 GAAGGATTTCATTTTAATGCAGG + Intergenic
1139334261 16:66220116-66220138 CCTGGATTTGTTTTGGATGACGG - Intergenic
1139638503 16:68274058-68274080 CCAGGTGTGTATTTTAATGAGGG + Intronic
1140676304 16:77335150-77335172 ACAGGATTTCATTTTTATAATGG - Intronic
1141253049 16:82376176-82376198 CCAGGCTTTGAATTTAGTGTTGG + Intergenic
1141846873 16:86616003-86616025 CCAGGTTTTGCTTATATTGAGGG + Intergenic
1149282260 17:55120592-55120614 CCAGGCTCTGTTTGTAATGATGG - Intronic
1151959066 17:77395798-77395820 CAAAAATGTGATTTTAATGATGG + Intronic
1152627710 17:81395938-81395960 CGAGTATTTGTTTTTAATGCTGG - Intronic
1153440239 18:5109110-5109132 CCAGGATTAAATTTAAATTATGG + Intergenic
1153485132 18:5590327-5590349 CCAGGATTGGATTTTAAAGGAGG - Intronic
1153534287 18:6084129-6084151 CTAGGATTTGAATTTAATTCAGG + Intronic
1156599056 18:38582707-38582729 CAAGTCTTTTATTTTAATGATGG - Intergenic
1156732751 18:40215207-40215229 TCAGAATTTCATTTTAATGATGG - Intergenic
1156834241 18:41533305-41533327 CCTGGATTAGATTTTGATAAAGG - Intergenic
1157067661 18:44370906-44370928 TCAGTATTTTATTTTATTGAGGG + Intergenic
1157505672 18:48224555-48224577 CCATGGTTTGCTGTTAATGAAGG - Intronic
1159420170 18:68208364-68208386 CCAGCATTTGCTTCTGATGATGG + Intergenic
1164194021 19:22937885-22937907 CCAAGATTTGTTTTTAATCATGG - Intergenic
1165124795 19:33586318-33586340 CCAGGGTTTGCTTGTAATGGGGG + Intergenic
1165877231 19:39016873-39016895 CCAGCATTTGATTTTAACAAGGG + Intronic
1167329673 19:48847429-48847451 CCAGGATTTTTTTTTTAAGATGG - Intronic
925490930 2:4391992-4392014 CCAGCATTTGCTTTTGATGAAGG + Intergenic
928479515 2:31667774-31667796 CCAGGATCTGTCTTTAAGGATGG - Intergenic
930685734 2:54306326-54306348 CCAAAATTTCATTTTAAAGAGGG + Intergenic
930827468 2:55708920-55708942 AAAGCTTTTGATTTTAATGAGGG - Intergenic
932547157 2:72725314-72725336 CAAGGATTTTTTTTAAATGAAGG + Intronic
932861205 2:75293348-75293370 TCAGGATCTGATTTTTAAGATGG + Intergenic
932980254 2:76655122-76655144 GCAGTTTTTTATTTTAATGAAGG + Intergenic
936961906 2:118084766-118084788 CCAGGCTGTGAATTTATTGATGG + Intergenic
939564200 2:143767279-143767301 CTAGGATTTGGTTTTATTAATGG - Intronic
940811057 2:158243335-158243357 CCAAAATTTGATTATAGTGATGG - Intronic
942346751 2:175011222-175011244 CCAGATTGTGATTTTAATCATGG - Intergenic
943431624 2:187809959-187809981 CCAAAATATGATTTTAATGATGG - Intergenic
944417508 2:199493406-199493428 CCATGATTTAATTTTTAAGAAGG + Intergenic
944958389 2:204839088-204839110 TTAGGATTTGATTTTAAGAAGGG + Intronic
945181536 2:207096703-207096725 CCAGGATGTGAATTTTGTGAGGG + Intronic
946653971 2:221924918-221924940 CCAGCAGTTGCTTTCAATGAGGG - Intergenic
948431222 2:237920348-237920370 CCAGGATTTGGTTTCAACTAAGG - Intergenic
948558118 2:238831538-238831560 CCAGGATTTGTTTTAATTGGGGG + Intergenic
1170096127 20:12647863-12647885 CCATGTTTAGATTTTAGTGAAGG - Intergenic
1170159362 20:13296371-13296393 TCCGGATTTGTTTTTATTGATGG - Intronic
1170693281 20:18634424-18634446 CCAGCATTTCAATTTAATGAGGG - Intronic
1172500809 20:35425724-35425746 ACATGATATGATTTTAAGGATGG + Intergenic
1172959124 20:38785192-38785214 GAAGGAGTGGATTTTAATGAGGG - Intergenic
1177343805 21:19841840-19841862 CAAGGAATTAATTTTGATGAAGG - Intergenic
1179201314 21:39224148-39224170 CCAGGAGTTAAGTTTAATGCAGG + Intronic
1179805750 21:43835885-43835907 CCAGAGTTTGATTTTATTAAGGG + Intergenic
1182852004 22:33483331-33483353 CCAAGATTTCATTTTATTAATGG + Intronic
1183686666 22:39364935-39364957 TCGGGATTGGATTTTAAAGAGGG + Intronic
1184637258 22:45843049-45843071 CCAAGATTTGATTGCAAAGATGG + Exonic
949666695 3:6347199-6347221 CCAGGATTTGACTTTATTCCAGG - Intergenic
949707656 3:6837548-6837570 CCAGCATCTGCTTTTAGTGAAGG + Intronic
951237086 3:20249388-20249410 CCAATATTTGCTTTTGATGAGGG + Intergenic
951517108 3:23572144-23572166 CCATTATTTGATTTAAATCATGG + Intronic
953018023 3:39097031-39097053 CAAGGGTTTGCTTTAAATGAAGG + Exonic
953222262 3:40983090-40983112 TCAGCTTTTAATTTTAATGATGG - Intergenic
954024108 3:47768350-47768372 CCAGGAATTGTTTTTAATTACGG + Intronic
954382902 3:50229060-50229082 CCTGGAATTTAATTTAATGAAGG - Intronic
954542909 3:51407191-51407213 TCAGGATCAGATTTGAATGACGG - Intronic
954775437 3:53013117-53013139 ACTGGATTTGATTATAATGTTGG + Intronic
955537912 3:59943733-59943755 CCAGGATGTGAGTATGATGAAGG - Intronic
956313316 3:67906227-67906249 ACAGGATTTTATTTTAAAGGTGG + Intergenic
957386131 3:79499784-79499806 CCAGTCATTGATCTTAATGAAGG - Intronic
959795974 3:110428781-110428803 CTAGGATTTGATTTTGATCAGGG - Intergenic
960080348 3:113533861-113533883 CCAGGTTTTGATTTTAAATAAGG + Intronic
960436714 3:117635221-117635243 CCAGGAATTGATTTTAGGGAAGG + Intergenic
960770483 3:121188465-121188487 CCAGGCTTTGGTATGAATGAAGG - Intronic
960855225 3:122095618-122095640 CCAGGTGATGGTTTTAATGAGGG - Intronic
960958291 3:123050650-123050672 CCAGGATGTGAGCTGAATGAAGG + Intergenic
962432778 3:135335547-135335569 CCTGTGTTTGCTTTTAATGAGGG - Intergenic
963034751 3:141016101-141016123 CCAGGAATTGAATATGATGAGGG + Intergenic
963559854 3:146850291-146850313 ACAGAATTATATTTTAATGAAGG + Intergenic
964205170 3:154166348-154166370 CCAGTATTTATTTTTAATGTGGG + Intronic
964283765 3:155095768-155095790 CCAGGTTTTCATTTTCCTGACGG - Intronic
965280476 3:166745668-166745690 TCAGCATTTGATTGTAATAAAGG + Intergenic
966276113 3:178172139-178172161 ACAGTATTTGATTTTAAATAGGG + Intergenic
967256171 3:187594286-187594308 CCCAAATTTGATTTTAATCATGG - Intergenic
970058119 4:11998937-11998959 CCAGGATCTGCTTCTAGTGAGGG + Intergenic
970258303 4:14193748-14193770 CCAGGATTTCATTTTTCAGAAGG - Intergenic
970407001 4:15773545-15773567 CAAGGATGGGATTTTAATAATGG - Intergenic
971764174 4:30807919-30807941 CCAGGTTTCGTTTTTCATGAAGG + Intronic
974123306 4:57665636-57665658 CTAGAATTTTATTTTAAAGAGGG + Intergenic
974668522 4:64997300-64997322 CCAAAATTTGATTTTTATAATGG - Intergenic
977104161 4:92858854-92858876 CCAGGAGCTGGTTTTTATGAAGG + Intronic
978470279 4:109058664-109058686 CTAGGATTTGTTTTTATTAATGG + Intronic
979648306 4:123098689-123098711 ACAGGATTTCCTTTTAATAAAGG + Intronic
981303625 4:143220887-143220909 CAAGGACTTGAATTTAATAATGG - Exonic
981908707 4:149953448-149953470 TCAGGATTTGTTTTGAATGTGGG - Intergenic
982192278 4:152868270-152868292 CCAGGGTTTTGTTTTAATGGGGG + Intronic
982697400 4:158618177-158618199 CCAAAATTCAATTTTAATGAGGG - Intronic
982772456 4:159409808-159409830 CCAGGATTTCAATTCAATAAGGG + Intergenic
982940718 4:161550476-161550498 GCAGCATTTTATTTTATTGAAGG + Intronic
983194775 4:164795108-164795130 ACAAAATTTAATTTTAATGAAGG + Intergenic
984204516 4:176769816-176769838 ACTGGATTTGAATTTAGTGATGG - Intronic
984461476 4:180042036-180042058 CCAGGCTTTGCTTGTTATGAGGG - Intergenic
986858392 5:11899105-11899127 CAAGGACTTGATTTTAATTGGGG + Intronic
987062497 5:14256117-14256139 CCAGGATCTGCTTTTGGTGAGGG + Intronic
987064654 5:14277308-14277330 CCAGTTTTTGTTTATAATGATGG - Intronic
987419693 5:17704677-17704699 CCATGGAATGATTTTAATGAGGG - Intergenic
988383614 5:30532497-30532519 TCAAGATTAGATTTTAATAAAGG - Intergenic
989078422 5:37589426-37589448 ACAGGATTTTAATTTAATGTTGG + Intronic
989225304 5:39020945-39020967 CAAGAATTTGTATTTAATGATGG + Intronic
989265976 5:39474756-39474778 CGAGGTTATAATTTTAATGAGGG + Intergenic
989444011 5:41507764-41507786 CCAGGAGTGGTTTTAAATGATGG + Intronic
989678124 5:43996995-43997017 CCAGCATTTGCTTCTGATGAGGG + Intergenic
990235661 5:53764931-53764953 CCAGCATTTGCTTTTGGTGAGGG + Intergenic
991564984 5:67996149-67996171 CCTGGTTTTGATTTTGAGGAGGG - Intergenic
992527346 5:77625249-77625271 CCATCTTTTGATTTTGATGATGG - Intergenic
992563658 5:77976545-77976567 GTAGGATTTGATTCTCATGAAGG + Intergenic
992903817 5:81325507-81325529 CCAGGGAGTGATTATAATGATGG + Intergenic
993630887 5:90284675-90284697 CCAGGTTTTGACTTGAATAATGG + Intergenic
993988114 5:94621448-94621470 GCAGGATTTAATTTTTATGGAGG - Intronic
994541666 5:101107506-101107528 GCATGATTAGATTCTAATGAAGG + Intergenic
994980668 5:106872602-106872624 CAAAGATTTGAATTTAATCAAGG - Intergenic
1001046121 5:168373218-168373240 CCACCATGAGATTTTAATGAGGG - Intronic
1001145455 5:169180151-169180173 CCAGGACTTGAATTTCAGGAAGG + Intronic
1005586213 6:27278988-27279010 CCAGGATATAGTTTTCATGAAGG + Intergenic
1008526239 6:52410064-52410086 CAGGGATTTTATTTTACTGATGG - Intergenic
1009615211 6:65995871-65995893 CCATGATTTGATGATGATGATGG + Intergenic
1010225398 6:73484078-73484100 CCAAGTTTTTATTTTCATGAGGG + Intronic
1011894567 6:92209130-92209152 AAAGCATTTGATATTAATGATGG - Intergenic
1011910766 6:92434391-92434413 CCAGCATCTGCTTTTGATGAGGG - Intergenic
1011959166 6:93065617-93065639 TAAGGATTTGATTCTAATTAAGG - Intergenic
1013277756 6:108602010-108602032 CAATGACTTCATTTTAATGATGG + Intronic
1013659857 6:112284123-112284145 CCAGGTTTTGGGTTGAATGAAGG + Intergenic
1015033480 6:128624878-128624900 GCAGGATTATATTTAAATGAGGG + Intergenic
1017963319 6:159241295-159241317 TTTGGATTTGATTTTAATTACGG + Intronic
1020807672 7:12810508-12810530 CTAAGATTTGATTATGATGATGG - Intergenic
1024504098 7:50146740-50146762 CCAGGCTTGGACTTTAAGGAGGG - Intronic
1024894528 7:54242517-54242539 CCTGGATTTATTTTGAATGATGG + Intergenic
1025744897 7:64234026-64234048 GCAGCAGTTGATTCTAATGAGGG - Intronic
1026480231 7:70772297-70772319 ACAGAATTTGATTTTTATAAAGG - Intronic
1028046359 7:86125409-86125431 CCAATATTAGGTTTTAATGAAGG - Intergenic
1028353543 7:89879189-89879211 CCTGACTTTGATTTTTATGAAGG + Intergenic
1028392081 7:90328130-90328152 CCTGGGATTGATTTTTATGATGG - Intergenic
1028529311 7:91820785-91820807 TCTGGATTTGATTTTCAGGATGG + Intronic
1031014751 7:116561046-116561068 CCAGTAATTGATTTGCATGAGGG - Exonic
1031452384 7:121937677-121937699 CCAGAATCTGATTTTGTTGAAGG - Intronic
1031634952 7:124091346-124091368 CCTGGACTAGATTTTAAGGAAGG - Intergenic
1031713455 7:125077661-125077683 CCAGGACTTAATTCTAAAGATGG - Intergenic
1033225351 7:139558123-139558145 CCAGCATTTGGCTTTAAAGAAGG - Intergenic
1033409604 7:141105199-141105221 CCAAGATTTTATTTAAAAGAGGG + Intronic
1038162849 8:25056545-25056567 TCAGGATTTGATTATCATTAAGG - Intergenic
1038343898 8:26714229-26714251 CCAGGATTTTACTTTTGTGATGG + Intergenic
1039301970 8:36219574-36219596 CTAATATTTTATTTTAATGATGG + Intergenic
1041752975 8:61281515-61281537 GCAGGATTGGTTTCTAATGAGGG - Intronic
1042791027 8:72606647-72606669 CCAGCATGTGATTTACATGAAGG + Intronic
1043064586 8:75551792-75551814 GCAGTATTTTATTTTATTGATGG + Intronic
1044158118 8:88875996-88876018 GCAGCATTTGATTTTATTGTAGG - Intergenic
1045289212 8:100817522-100817544 CCAAGATATAATTTTCATGATGG + Intergenic
1045910494 8:107402007-107402029 CCAGGATTTAAAAATAATGATGG + Intronic
1046060878 8:109138256-109138278 CCAGCAATTGATTTTCGTGAGGG - Intergenic
1047232990 8:123013184-123013206 CTGGGTTTTCATTTTAATGAAGG - Exonic
1047957322 8:129985587-129985609 CAAATATTTGATTTTAATTAAGG - Intronic
1049118796 8:140714990-140715012 GCAGAATTTGATTCTAACGATGG + Intronic
1050257249 9:3807986-3808008 CATGGATTTGATTTTGAAGAGGG + Intergenic
1050693279 9:8252324-8252346 CCAGGATTTTAATTTAAAGAGGG - Intergenic
1050736849 9:8773659-8773681 CTTGGAATTTATTTTAATGATGG - Intronic
1050834117 9:10054358-10054380 GCAAGATTTGTTTTTAAAGATGG + Intronic
1051282602 9:15457184-15457206 TCAGAATTAGATTTTAATAAAGG + Intronic
1051638683 9:19204364-19204386 CCAGCATTTTTTTTTAAAGAGGG + Intergenic
1052270873 9:26626715-26626737 CCAGGATGTGATCTTAAGGTAGG - Intergenic
1052691737 9:31823874-31823896 CCAGCATTCGATATTAATGTAGG + Intergenic
1052920823 9:33966775-33966797 CCATAATTATATTTTAATGATGG + Intronic
1054341469 9:63866896-63866918 CTAGGATTTTCGTTTAATGAAGG + Intergenic
1054798356 9:69323925-69323947 CCAGAATTTGAATTTATTCATGG + Intergenic
1055108849 9:72539909-72539931 CCAGGATTTGCTTTTGGTGAAGG + Intronic
1058123849 9:101169265-101169287 TCAGCCTTTGATTTTATTGAAGG + Intronic
1058381988 9:104387255-104387277 CCAAGATTTCATTTAAATGATGG - Intergenic
1059739334 9:117134485-117134507 CCAGGGTCTGATTTTGATGGAGG + Intronic
1062369363 9:136229681-136229703 CCAGGATTTGGTTTTCACGGTGG + Intronic
1188863965 X:35291403-35291425 CCAGATTTTGTTTTTAATGATGG + Intergenic
1190938390 X:55017008-55017030 CCAGTGTTTGGTTTTTATGAAGG - Intronic
1190973182 X:55372480-55372502 CCAGGATTTTATTTTTCTTATGG + Intergenic
1192286749 X:69746460-69746482 CCTGGGTATGATTTTATTGAGGG + Intronic
1193793913 X:85850109-85850131 CCAAGATTTCATTTTCAAGATGG - Intergenic
1194163907 X:90489988-90490010 CCAGCATTTGCTTTTGGTGATGG + Intergenic
1194746998 X:97639275-97639297 CAAGTATTTTATTTTAATAATGG + Intergenic
1194819380 X:98487526-98487548 GCAGGATTTGGTTTTTGTGAGGG + Intergenic
1196306674 X:114111137-114111159 CCCAGATTTAATTTGAATGACGG + Intergenic
1196347170 X:114676948-114676970 TCAGGATTTGAATTCAATTAAGG - Intronic
1196881523 X:120202745-120202767 CCAAGATTTCATTTTCAAGATGG - Intergenic
1197343463 X:125302625-125302647 AAAGGCTTTGATTTTCATGAAGG + Intergenic
1199641029 X:149861678-149861700 CCTGGATTTGATTTTTTTAATGG - Intergenic
1200510166 Y:4067797-4067819 CCAGCATTTGCTTTTGATGATGG + Intergenic