ID: 1081299447

View in Genome Browser
Species Human (GRCh38)
Location 11:41432771-41432793
Sequence GGTGTAATGAGACCAAAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081299444_1081299447 -2 Left 1081299444 11:41432750-41432772 CCTTCATTAAAATCAAATCCTGG 0: 1
1: 0
2: 0
3: 19
4: 249
Right 1081299447 11:41432771-41432793 GGTGTAATGAGACCAAAATCAGG 0: 1
1: 0
2: 1
3: 7
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081299447 Original CRISPR GGTGTAATGAGACCAAAATC AGG Intronic
902094633 1:13932780-13932802 GCTGGAATGATTCCAAAATCTGG + Intergenic
905684449 1:39898778-39898800 GGTGTTATGAGCCCCATATCTGG - Intronic
907966322 1:59333402-59333424 GGTGTGATGAGCTCAACATCTGG - Intronic
908825591 1:68129986-68130008 TGTGAAATGAGACCAATCTCTGG + Intronic
909359736 1:74746371-74746393 GGTATAATGAGACTAAAATAAGG - Intronic
911679605 1:100699851-100699873 CCTGTCTTGAGACCAAAATCTGG - Intergenic
913543769 1:119846541-119846563 AGTGTACTGGGACCAAAATTCGG + Intergenic
917620271 1:176788436-176788458 GGTGTAATGAGACTAGAAAATGG + Intronic
917707710 1:177651014-177651036 AGTTTAATGATGCCAAAATCTGG - Intergenic
918212227 1:182361388-182361410 AGTTTAAGGAGTCCAAAATCTGG + Intergenic
920649133 1:207823731-207823753 GGTTTGATGGGACCAAATTCTGG - Intergenic
920783456 1:209017261-209017283 GGTGTTTAGAAACCAAAATCTGG + Intergenic
921223097 1:212988223-212988245 GCTATAATGTGACCAAAGTCAGG + Intronic
922308311 1:224363978-224364000 AGTGTACTGAGAACAAATTCGGG + Intronic
923208819 1:231784574-231784596 AGAGTAATCTGACCAAAATCAGG - Intronic
1068444111 10:57097896-57097918 GCTGTGATGAGAACAAAAACTGG - Intergenic
1069969948 10:72158579-72158601 GATGCTATGAGACCAAAAACAGG - Intronic
1073544500 10:104337355-104337377 TGTGAAATGAGACCAGTATCTGG + Intronic
1073818854 10:107237178-107237200 GGTGTCAAGAGACAAAAATGTGG - Intergenic
1074012139 10:109492988-109493010 GGTGTAATGAAACTCAATTCTGG - Intergenic
1075661322 10:124198698-124198720 GTTGTAAACAGACTAAAATCAGG - Intergenic
1079154370 11:17930771-17930793 GGTGAAATGAGACCTGAATAAGG - Intronic
1080619420 11:33974616-33974638 GATGTAATGGGTCCAAATTCTGG - Intergenic
1081299447 11:41432771-41432793 GGTGTAATGAGACCAAAATCAGG + Intronic
1083150621 11:60789701-60789723 GTTGGAATGAGGACAAAATCAGG + Intronic
1083839176 11:65293750-65293772 GGTGTAATGAGTCCAAGCTGTGG + Intronic
1086386806 11:86317450-86317472 GGCTCAATGAAACCAAAATCTGG + Intronic
1087424677 11:97971505-97971527 ATGGTATTGAGACCAAAATCTGG + Intergenic
1101229480 12:102725266-102725288 CCTGTAATAAGTCCAAAATCAGG - Intergenic
1102934141 12:116882602-116882624 GGTGAAATGACAACAAAGTCAGG + Intergenic
1103176103 12:118864833-118864855 GGGCTGATGAGACCAATATCAGG + Intergenic
1104149644 12:126070405-126070427 TCTGTACTCAGACCAAAATCTGG - Intergenic
1108011443 13:46017085-46017107 CGTGTAGTGACTCCAAAATCTGG - Intronic
1110613390 13:77514122-77514144 GGTGTGATTAGAACAAAAGCAGG - Intergenic
1111141310 13:84122821-84122843 GATATAATGAGAGCAAACTCTGG - Intergenic
1114315942 14:21510194-21510216 GGTCTAATTAGACAAAAATAAGG - Intronic
1117918911 14:60707251-60707273 GTTGTAATGTGGCCAAAATCAGG + Intergenic
1118858548 14:69643544-69643566 GGTTTAATGGGACCATGATCAGG - Intronic
1123462367 15:20485019-20485041 GGTTCTAAGAGACCAAAATCTGG - Intergenic
1123655693 15:22515386-22515408 GGTTCTAAGAGACCAAAATCTGG + Intergenic
1125356564 15:38822715-38822737 GTTGGAATGAAACCAAAATAAGG - Intergenic
1129278565 15:74464812-74464834 GGTATATTAAGACCACAATCTGG + Intergenic
1130365251 15:83232188-83232210 GGTATATAGAGACCACAATCTGG + Intergenic
1132194858 15:99906663-99906685 GTTGTAATGGAACAAAAATCAGG + Intergenic
1135210171 16:20519091-20519113 GGTTAATTAAGACCAAAATCTGG - Intergenic
1137354093 16:47742328-47742350 GGTGTAGTAAGTCCAAAGTCTGG + Intergenic
1137457771 16:48631275-48631297 GGTCTAAAGAGTCTAAAATCTGG - Intergenic
1149823570 17:59804744-59804766 AGTGTAATGAAAACAAAACCAGG - Intronic
1151006608 17:70445017-70445039 GGTGTTTAGGGACCAAAATCTGG - Intergenic
1154248871 18:12726070-12726092 GGTCTGACGAGACTAAAATCAGG + Intergenic
1155097760 18:22575754-22575776 GTAGTAATGATGCCAAAATCAGG - Intergenic
1155142022 18:23052464-23052486 GATGTAATAAGACTAAATTCAGG + Intergenic
1156999373 18:43506407-43506429 GTTGTCATGATACCAAAATCTGG - Intergenic
1158183636 18:54746287-54746309 GGTCGGATGAGACAAAAATCAGG + Intronic
1158800523 18:60903098-60903120 GGTGTAATGAGCCCAAACATAGG + Intergenic
1160366954 18:78334748-78334770 GGGAAAATGACACCAAAATCTGG - Intergenic
1162362026 19:10226340-10226362 GGTGGAATGGGAGCAAATTCTGG - Intronic
1163970518 19:20789301-20789323 GGTATAGTCAGACCAAAATAAGG - Intronic
1166763330 19:45238194-45238216 GGAGAGATGGGACCAAAATCAGG + Intronic
1168468127 19:56620317-56620339 AGTGAAATGAGAGAAAAATCGGG - Intronic
926444128 2:12923235-12923257 TGTGTAATGAATTCAAAATCTGG + Intergenic
930901932 2:56517730-56517752 GGTGTTATGAGAATAAAATGAGG - Intergenic
931652713 2:64482983-64483005 GGTGTGATGACTCCAACATCAGG - Intergenic
932111611 2:69006768-69006790 GTGGCAATGAGACCAAGATCTGG - Intergenic
933625663 2:84595843-84595865 ATGCTAATGAGACCAAAATCAGG + Intronic
934125373 2:88883419-88883441 GGTGTAAAGAGCACAAAATTAGG + Intergenic
940476143 2:154165767-154165789 AGTGAAATTAGACCAAGATCTGG + Intronic
942831451 2:180241091-180241113 GGTGTCATGAGATGAAAAGCTGG - Intergenic
944193223 2:197025682-197025704 GCTGTAATGAGAATAAAATACGG + Intronic
944620941 2:201515521-201515543 GGTGTAATAACACCATAGTCAGG + Intronic
945206084 2:207334057-207334079 GTTCTAATGAGACCAATATCAGG + Intergenic
947045102 2:225972934-225972956 CATGTAACAAGACCAAAATCTGG + Intergenic
1172339658 20:34146151-34146173 CGTGTCATGTGATCAAAATCTGG + Intergenic
1177654968 21:24004951-24004973 GCTGTAAAGATACCAAAATGTGG - Intergenic
1181658474 22:24321187-24321209 GGTGTAATGAGATGAAATCCAGG - Intronic
1182453143 22:30432997-30433019 GGTGGAATGAAACCAAGATGGGG - Intergenic
1184308071 22:43622182-43622204 AGTGCCATGATACCAAAATCAGG + Intronic
1184847021 22:47094512-47094534 GGCTTGATGAGAACAAAATCTGG - Intronic
1184848706 22:47105307-47105329 GGTGTATTCATACCAAAAACAGG - Intronic
952422295 3:33143201-33143223 GGAGAAAGGAGACTAAAATCTGG - Exonic
954145705 3:48633326-48633348 GGGGTAACCAGACCAAAACCGGG + Exonic
958149943 3:89678577-89678599 GGTGTAATGAGAGGAACACCAGG - Intergenic
959374267 3:105568689-105568711 GGTCTAAGTAGACCAAAAGCTGG - Intronic
966325066 3:178744793-178744815 TGTGTAAGAAGAGCAAAATCAGG - Intronic
967019819 3:185512910-185512932 GGTGTTAAGAAAACAAAATCTGG - Intronic
970044447 4:11835133-11835155 GGTAAACTGAGACCTAAATCAGG + Intergenic
971071568 4:23098857-23098879 GGCTTAGTGAGTCCAAAATCTGG - Intergenic
973101350 4:46275150-46275172 GGTTTAATGAGACCAGAAATAGG - Intronic
976749492 4:88439718-88439740 GTTGTATTGTGACCAAAACCTGG - Intronic
984188773 4:176579367-176579389 GGTGTAAACAGACCAACAGCAGG - Intergenic
986345565 5:6831968-6831990 GATTTGATGAGTCCAAAATCTGG - Intergenic
987506053 5:18774397-18774419 AATGTAATCAGACCAAAATAGGG - Intergenic
988511321 5:31867066-31867088 GGTGTAACCAGAGCAAAATGAGG - Intronic
991457773 5:66822860-66822882 GGTGTTAGGAGCCCAAACTCTGG + Intronic
993454584 5:88112978-88113000 GGTGTCATGAGTACAAAATAAGG + Intergenic
993935749 5:93999848-93999870 GCTGTAGTGAGAGTAAAATCAGG - Intronic
994229300 5:97295542-97295564 AGTGTGATGATACCAAAGTCGGG + Intergenic
994721819 5:103389446-103389468 TGTGAAATGACACCAGAATCTGG - Intergenic
995153088 5:108874276-108874298 GGTATAATGAGACCAAAATTAGG + Intronic
1001746276 5:174095004-174095026 AGTGTAATGAGAGCAAAACTAGG + Intronic
1006409480 6:33864008-33864030 GCTGTAATGAGCACAAAACCAGG + Intergenic
1010162862 6:72878575-72878597 GGAATATAGAGACCAAAATCTGG + Intronic
1015798817 6:137040404-137040426 GGTGTTTAGAAACCAAAATCTGG - Intronic
1020435563 7:8158712-8158734 GGTGAAATGAGACCAACAGCAGG + Intronic
1022779636 7:33566990-33567012 GGGGTAATGAGACCAATAAAAGG + Intronic
1027789258 7:82618905-82618927 AGTGTAAAGAGTCCAAAATTAGG + Intergenic
1032520853 7:132543824-132543846 AGGGGCATGAGACCAAAATCAGG + Intronic
1038322195 8:26537801-26537823 GGTGAAATTTGAACAAAATCTGG - Intronic
1038703670 8:29874462-29874484 GTTGTAATGATCCCAGAATCTGG + Intergenic
1042150804 8:65781449-65781471 GGTGTGATGAGAACAGAGTCAGG + Intronic
1046895929 8:119473374-119473396 GGTATTTTGAAACCAAAATCTGG - Intergenic
1048464005 8:134648094-134648116 TGTGAAATGATACCACAATCAGG - Intronic
1052746154 9:32443167-32443189 GGTGTTATGAGGCAAAAATAAGG + Intronic
1054847109 9:69809236-69809258 AGTGTAATGAGATCAGCATCTGG - Intergenic
1055589684 9:77798919-77798941 TGTGTAATAACACCACAATCAGG + Intronic
1056028379 9:82525058-82525080 GGTGTAATTAAGCCAAAATCAGG - Intergenic
1056051699 9:82776076-82776098 GGTGGAATGAGACTCAAATGAGG + Intergenic
1059010101 9:110448563-110448585 GTTGTAATGACACCAAACACAGG - Intronic
1061653713 9:132071116-132071138 GGTGTTATGAGGACAAAATGAGG - Intronic
1187990989 X:24872097-24872119 GTTGTAATTAGACCAAAAAAAGG + Intronic
1189173139 X:38928757-38928779 GGTGAAATGACACCAAAAAGTGG - Intergenic
1190519380 X:51261869-51261891 TGTCTAATGAGACCAACATCTGG - Intergenic
1191135059 X:57055232-57055254 GGCATCATGATACCAAAATCTGG - Intergenic
1194748782 X:97660598-97660620 GGTGTAATAAGACCAAGTACGGG - Intergenic