ID: 1081300285

View in Genome Browser
Species Human (GRCh38)
Location 11:41443130-41443152
Sequence CAGTGTTAATATGATGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 176}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081300285_1081300287 13 Left 1081300285 11:41443130-41443152 CCAACCTCATCATATTAACACTG 0: 1
1: 0
2: 1
3: 10
4: 176
Right 1081300287 11:41443166-41443188 ATCCCAAAAAGAATTAACGAAGG 0: 1
1: 0
2: 0
3: 10
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081300285 Original CRISPR CAGTGTTAATATGATGAGGT TGG (reversed) Intronic
903633200 1:24793033-24793055 CAGTGTTAAAATCATTAAGTTGG - Intronic
909544580 1:76831640-76831662 CAATGTTAACATGATGTTGTTGG - Intergenic
909847314 1:80411435-80411457 CAGTTTTAATATAAAGTGGTAGG - Intergenic
911665904 1:100551344-100551366 CAGTGTTAACATCATGTGGTAGG + Intergenic
912740449 1:112190096-112190118 CAGTGCTAAAATGTTGATGTAGG + Intergenic
914457961 1:147854668-147854690 CAGTCTTAATAAGATGAGCTGGG - Intergenic
915467035 1:156103977-156103999 GAGTGTGGATATGATGAGGGAGG - Intronic
916294839 1:163206560-163206582 ATGTGTTAATATTAAGAGGTGGG + Intronic
917155086 1:171988405-171988427 CATTGTTTATATGGAGAGGTTGG + Intronic
917724550 1:177816305-177816327 CAGTGATGATATTAGGAGGTGGG + Intergenic
918715427 1:187780260-187780282 CAGGGTTAATTTGGTGAGGAAGG - Intergenic
919410614 1:197237475-197237497 CAGTAATAATATTAAGAGGTGGG - Intergenic
1064572273 10:16706247-16706269 AAGTATTAAAAAGATGAGGTTGG - Intronic
1065364188 10:24918800-24918822 CATTTGTAAAATGATGAGGTTGG - Intronic
1068073391 10:52223909-52223931 CAGTGTTAATGCCAAGAGGTTGG - Intronic
1068395615 10:56457246-56457268 CAGTTGTAATACGATTAGGTGGG - Intergenic
1069669622 10:70190672-70190694 GAGTGTTACTATGATGAACTTGG - Intergenic
1070273544 10:74982127-74982149 AAATGTTAATGTGATGAAGTAGG - Intronic
1071270540 10:84002732-84002754 CAGTTTTAAGCTGCTGAGGTTGG + Intergenic
1071487300 10:86110725-86110747 AAGAGTTAATCAGATGAGGTGGG + Intronic
1073606525 10:104901134-104901156 CATTATTAATATGATGATGATGG - Intronic
1075440190 10:122474219-122474241 CAGTGGTAAGATGAGGGGGTAGG - Intronic
1078710738 11:13788567-13788589 CAATCTGAAAATGATGAGGTGGG - Intergenic
1081300285 11:41443130-41443152 CAGTGTTAATATGATGAGGTTGG - Intronic
1082214079 11:49545944-49545966 CAGTGATAATATGATCTGATGGG - Intergenic
1082723581 11:56708313-56708335 CAGTGTTAATATTGAGATGTGGG - Intergenic
1082899709 11:58234090-58234112 CATTGTTAATATTTTGAAGTAGG - Intergenic
1083192059 11:61059258-61059280 CGAGGTTAATCTGATGAGGTTGG - Intergenic
1085794255 11:79522807-79522829 CAGTGTTTATATGATCCGGGGGG + Intergenic
1086151328 11:83614045-83614067 CAGTGTGAACTTGATGAAGTAGG + Intronic
1086635521 11:89078548-89078570 CAGTGGTAATATGATCTGATGGG + Intergenic
1086867031 11:91992082-91992104 CAGTGCTAATGTCCTGAGGTGGG - Intergenic
1090025629 11:123165439-123165461 GAGTATTAATATTATGCGGTAGG - Intronic
1094301841 12:28973198-28973220 CATTGGTAAAATGATGGGGTTGG - Intergenic
1095894773 12:47269047-47269069 CAGTGTTAATATGACCAACTTGG + Intergenic
1098544273 12:71694143-71694165 CAGTGTTAAGAGGATTAGGCAGG + Intronic
1099947877 12:89265688-89265710 CACTGTTAACAAGATGAGTTAGG - Intergenic
1100918238 12:99452919-99452941 AAGTGTGAATACCATGAGGTGGG - Intronic
1104273006 12:127299520-127299542 CAGTTTTAAGATGATGTGTTTGG + Intergenic
1107537273 13:41348078-41348100 CTGTGTTAAGATGATTATGTAGG + Intronic
1108290769 13:48958802-48958824 AAGTATTTAAATGATGAGGTAGG + Intergenic
1110832850 13:80051577-80051599 CAGTGTGAACATGATGATGGAGG - Intergenic
1111763969 13:92502576-92502598 CTGTGTTAATTAGATGAAGTGGG + Intronic
1112380424 13:98883540-98883562 TAGTCTTAATAAGATGAGGCTGG - Intronic
1117060627 14:51958810-51958832 CAATCTTAAAATGATTAGGTAGG - Intronic
1117740330 14:58812134-58812156 CAGTGTGAAAATGATGAGTTAGG - Intergenic
1118349240 14:64961599-64961621 GACTGTTAAGATGATGAGGCTGG - Intronic
1128192412 15:65714977-65714999 CAGTCCTAATATCATTAGGTAGG - Intronic
1130568632 15:85020884-85020906 CAATGTTAATTTGATGATCTTGG - Intronic
1133413835 16:5590506-5590528 CGGTGTCATTATGATGAGCTTGG + Intergenic
1133664375 16:7951655-7951677 CAGTGTTAAAATGATGAAATTGG + Intergenic
1137660766 16:50204103-50204125 CAGTGTTACCATAAGGAGGTTGG + Intronic
1138192761 16:55029935-55029957 CAGAGTTAATATGCAGAGTTTGG + Intergenic
1144031325 17:11325786-11325808 CAGTGGTACAATGAAGAGGTTGG + Intronic
1145785381 17:27590587-27590609 CATTGTCAATATGCTGAAGTTGG - Intronic
1146460296 17:33040932-33040954 AAGTCTTTATATGATTAGGTTGG - Intronic
1147898467 17:43767952-43767974 CAGTGTTAATATGCCAAGGTAGG - Exonic
1148086040 17:44994395-44994417 CAGTGTTAAGAGGTTGATGTTGG - Intergenic
1148414567 17:47496421-47496443 CAGTTGAAATATGATGAGGCAGG + Intergenic
1151099171 17:71536123-71536145 GAGTGTGAATATTAGGAGGTGGG - Intergenic
1153037262 18:775406-775428 CAGGGTTAATAGCATGAGATGGG - Intronic
1153512478 18:5870492-5870514 CAGTGTTGATCTGAAAAGGTAGG - Intergenic
1153827913 18:8893767-8893789 AAGTGTTTAAATGAAGAGGTTGG + Intergenic
1155747746 18:29381612-29381634 CAGAGTTAATATGATAATGGTGG + Intergenic
1159702408 18:71645329-71645351 AAGTGATAATATTATGGGGTGGG + Intergenic
1159840938 18:73398496-73398518 CAGCGTGAAGATGATGAGGATGG - Intergenic
1164431235 19:28190644-28190666 CAGTGCTAAAATAATAAGGTAGG + Intergenic
1164540865 19:29120645-29120667 CATTATTAATATGATGGTGTTGG + Intergenic
1166599690 19:44083101-44083123 CAGTTTTAATATCATGAGAAAGG + Intronic
1168498656 19:56875284-56875306 CAGTGTTAATCAGATGTGCTCGG + Intergenic
926441839 2:12897260-12897282 CAGAGTTAAAATTATTAGGTAGG + Intergenic
926697935 2:15783809-15783831 CACTGTTATAATGAGGAGGTTGG - Intergenic
927324752 2:21791414-21791436 CAAAGTGAAAATGATGAGGTGGG - Intergenic
928332566 2:30368830-30368852 CATTGTTAAAATGAAGAGGTTGG + Intergenic
929336511 2:40754016-40754038 CAGTGCAAATATTCTGAGGTAGG - Intergenic
930403354 2:50920987-50921009 CAGTGTTAATCTGGTGAATTGGG - Intronic
931213611 2:60221133-60221155 CAGTTTTATTTTGTTGAGGTAGG - Intergenic
936941156 2:117885828-117885850 CAGGGTGAATATAATGATGTAGG - Intergenic
938804096 2:134789853-134789875 CAGTGTTAATCTGATGTTGAGGG + Intergenic
944890983 2:204117215-204117237 CAGTGCTAGCATGGTGAGGTTGG + Intergenic
945509554 2:210683798-210683820 TAATGTTGATGTGATGAGGTGGG + Intergenic
945874443 2:215263693-215263715 CAGTGTTAAGAGGCAGAGGTGGG - Intergenic
1169089693 20:2851306-2851328 CAGTGTCAATATGGCAAGGTAGG + Intronic
1169203901 20:3729672-3729694 CAGTGCTAACAGGCTGAGGTGGG + Intergenic
1169348636 20:4850369-4850391 CACTGTTAATATGCTGTGGTCGG + Intergenic
1171510000 20:25674491-25674513 CAGTGTAAGTATTAGGAGGTGGG - Exonic
1175528022 20:59648954-59648976 CTGTGTTTACATGATGAGGCTGG + Intronic
1176698027 21:10004498-10004520 CTGTGTTAGTTTGATGAGGATGG - Intergenic
1179357578 21:40674998-40675020 GTGTGTTTATATAATGAGGTGGG - Intronic
1182718340 22:32377755-32377777 CAGTGTTCATGTCAGGAGGTTGG + Intronic
949818440 3:8088064-8088086 CAGTGCTAATAAAATGAGATAGG + Intergenic
952914587 3:38224115-38224137 CAGTTTTAAAATGAAGAGTTTGG - Intronic
956929821 3:74030213-74030235 CAGTTTCAAAATGATGAGTTAGG + Intergenic
957389538 3:79546024-79546046 CAGTATGAATATCATGAGGATGG + Intronic
959086125 3:101852279-101852301 CAGGGTTATTATGATGACCTAGG + Intronic
961804362 3:129478286-129478308 CAGTTTTAAAACCATGAGGTGGG - Intronic
961951884 3:130758140-130758162 GAGTGTTAATATTATAAGGCAGG - Intergenic
962016669 3:131448047-131448069 AAGTGATAATATTAAGAGGTGGG - Intergenic
962488854 3:135871141-135871163 CAGAGTGAATATGATCACGTTGG + Intergenic
963908358 3:150793008-150793030 CTGTGATAATATTAGGAGGTGGG - Intergenic
965677794 3:171216909-171216931 CAATGCTAAAATGAAGAGGTAGG - Intronic
967012995 3:185456336-185456358 CAGAGGAAATAAGATGAGGTAGG + Intronic
967030885 3:185605415-185605437 CAGTGTTAATTTCCTGATGTTGG - Intronic
972627870 4:40818870-40818892 AAATGTTAAAAGGATGAGGTGGG - Intronic
973152084 4:46900646-46900668 CAGTGATGATATTAAGAGGTGGG + Intronic
973326330 4:48866118-48866140 CATTGGTAACTTGATGAGGTTGG + Intergenic
973745813 4:53962485-53962507 CAGTCTTAAAAAGATGAGGGAGG + Intronic
973862707 4:55080898-55080920 CAGTTTTAACATGAAGAAGTTGG - Intronic
974112633 4:57543261-57543283 AATTGTTAACATAATGAGGTGGG - Intergenic
975039558 4:69728368-69728390 CAATGTTATTATTATGAGGGTGG - Intronic
975066385 4:70070002-70070024 CATTTTTAATATGAACAGGTTGG + Intergenic
975236849 4:72008669-72008691 CATTTTTAGTATGAGGAGGTTGG + Intergenic
975871184 4:78780303-78780325 TAGTGTGAATATGGTGATGTGGG + Intronic
976920585 4:90437412-90437434 CAGAGATAATATGATGAGATAGG + Intronic
978092690 4:104737265-104737287 CAGTGTTAATAAATTGAGGGTGG + Intergenic
979588753 4:122452430-122452452 CATTGATACTATGATGGGGTAGG - Intronic
980370572 4:131864348-131864370 CTGTGTTAGTTTGATGAGGATGG - Intergenic
981411164 4:144434730-144434752 CAGTCCCAATATGATGAGCTAGG - Intergenic
981741810 4:148010193-148010215 CTGTGTTAATAACATGATGTTGG + Intronic
985303642 4:188515368-188515390 TAATGTTAATATGAAGAGGTTGG + Intergenic
989723301 5:44554726-44554748 CAATGTCAATATAATGTGGTAGG - Intergenic
992948146 5:81829968-81829990 AGATGTTAATATGATGAGGGAGG - Intergenic
994233626 5:97336729-97336751 CAGTCTCAATGTGATGAGCTGGG + Intergenic
998242433 5:140460049-140460071 CTCTGTTAATAAGAGGAGGTGGG + Intronic
998247529 5:140521047-140521069 CAGTGTTGATATACTGAGTTTGG + Intronic
998950801 5:147391443-147391465 CAGAGGCAATATGAGGAGGTTGG + Exonic
999631839 5:153579406-153579428 CAGAGATAATATGATGAGTGAGG + Intronic
1000529682 5:162404104-162404126 TAGTGTTAATTTCCTGAGGTTGG - Intergenic
1003086669 6:3065677-3065699 AAGTGTGAATATGAGGGGGTAGG - Intronic
1005093819 6:22088695-22088717 CACTGATAAAATGAGGAGGTTGG - Intergenic
1005706710 6:28461938-28461960 CTGTGTTAATATGTGGAGCTTGG - Intergenic
1008487445 6:52051479-52051501 CAGGGTTAATGTGATAAAGTGGG + Intronic
1009782696 6:68290934-68290956 CAGTGTGAAAATGAGGTGGTGGG - Intergenic
1009855077 6:69251950-69251972 CATACATAATATGATGAGGTTGG + Intronic
1010221524 6:73452426-73452448 CTGTCTTAAGAAGATGAGGTAGG + Intergenic
1013967757 6:115975158-115975180 TAGTGTTTATATCCTGAGGTTGG - Intronic
1015026320 6:128537379-128537401 CAATGTTAACATGATTAGATTGG - Intergenic
1015264393 6:131276029-131276051 CAGTGTAAAAATGATGAGGGTGG + Intronic
1015957860 6:138616760-138616782 CAGTCTTGATAGGAGGAGGTAGG - Intronic
1016095748 6:140034424-140034446 CAGAGAAAATATCATGAGGTAGG + Intergenic
1016263736 6:142207219-142207241 CAGTGTAGAAATTATGAGGTGGG - Intronic
1016323104 6:142869794-142869816 CTGTGTTAATAAAATGAAGTTGG - Intronic
1016503690 6:144752008-144752030 GAGTGGTAATATAGTGAGGTAGG - Intronic
1017570033 6:155734395-155734417 CACAGTTTATATGATGGGGTTGG + Intergenic
1021241763 7:18210809-18210831 AAGTGTTAAAATGATGAACTTGG - Intronic
1023089460 7:36604170-36604192 CACTGTTAATATGAAGAGGTGGG - Intronic
1023988855 7:45115877-45115899 AAGTGTTGATATTAAGAGGTGGG + Intergenic
1024915136 7:54490621-54490643 CAGTGATAGTATTAGGAGGTGGG - Intergenic
1026637207 7:72094645-72094667 CAGTGTTAATAAGATGGAGATGG + Intronic
1030648172 7:112087779-112087801 CAATGTTAATATGATGGTCTAGG - Intronic
1034990358 7:155544126-155544148 CAGTGTGAATTTGAGGAGGGTGG + Intergenic
1035640014 8:1177848-1177870 CAGTGGTGGTATTATGAGGTGGG - Intergenic
1035960448 8:4130867-4130889 GAGTGTTCATATGCTGAGATAGG + Intronic
1036175098 8:6530135-6530157 CAGTGTTAGTATCAAAAGGTGGG + Intronic
1037708787 8:21338741-21338763 CAGTGTAAAAATGATCAAGTGGG - Intergenic
1037908835 8:22731322-22731344 CAATGTGAAGATGATGAGGATGG + Intronic
1041790784 8:61694099-61694121 CAGTTTGAGTATGAGGAGGTAGG - Intronic
1041814404 8:61951830-61951852 CAATGTAAATCTGATGAGGAGGG - Intergenic
1042907655 8:73788851-73788873 CAGTTTTAATATGGTGAGTGAGG - Intronic
1050576072 9:6996886-6996908 GAGTGTCAATATGATGGAGTGGG + Intronic
1050638270 9:7637348-7637370 CTCTATTAATATGATGAGGCGGG + Intergenic
1052485644 9:29096076-29096098 TACTGTTGATAGGATGAGGTTGG + Intergenic
1053635159 9:39990844-39990866 CTGTGTTAGTTTGATGAGGATGG - Intergenic
1053770772 9:41473467-41473489 CTGTGTTAGTTTGATGAGGATGG + Intergenic
1054208728 9:62259854-62259876 CTGTGTTAGTTTGATGAGGATGG + Intergenic
1054316077 9:63588286-63588308 CTGTGTTAGTTTGATGAGGATGG - Intergenic
1054549504 9:66385291-66385313 CTGTGTTAGTTTGATGAGGATGG + Intergenic
1055824835 9:80311526-80311548 CAGTGATAGTATTAAGAGGTGGG + Intergenic
1055898632 9:81209354-81209376 AACTGTTAATATAATGACGTTGG + Intergenic
1185686248 X:1931177-1931199 CAGTGTTTAGATGAAGAGTTTGG - Intergenic
1185955185 X:4481482-4481504 AGGTGTTAATATGATGAGAAAGG + Intergenic
1186655448 X:11607006-11607028 CAGTATTAATTTGATTAAGTAGG + Intronic
1188040892 X:25369172-25369194 CAGTGTTAATAGGCCTAGGTGGG + Intergenic
1190150317 X:47941238-47941260 GAGAGTGAATATGAGGAGGTGGG - Intronic
1191752730 X:64560727-64560749 CAGAGATAATATGATGAGAAAGG - Intergenic
1192631543 X:72781529-72781551 CAGTGTTTATATGCAGAGGCGGG - Intronic
1192650166 X:72939272-72939294 CAGTGTTTATATGCAGAGGCGGG + Intronic
1192674494 X:73182183-73182205 CAGTGTCAATGAGATGAGCTGGG - Intergenic
1193949244 X:87778210-87778232 CAGTTTCAATAAGATGAGCTGGG - Intergenic
1196267552 X:113668677-113668699 AAATGTTAATATTATGAGCTTGG - Intergenic
1196634255 X:117982831-117982853 CAGTGTTCATATGCTAAGGCAGG - Intronic
1196760507 X:119196821-119196843 ATGTGATAATATTATGAGGTGGG - Intergenic
1196775902 X:119337206-119337228 CATTGTCCATATGATGAGCTAGG + Intergenic
1196803561 X:119564674-119564696 TACGGTTAAGATGATGAGGTGGG + Intronic
1197266912 X:124384149-124384171 CAGTATTACTATGATGGGCTTGG - Exonic
1198858286 X:141042259-141042281 CAAAGTTAATGAGATGAGGTGGG + Intergenic
1198904409 X:141545111-141545133 CAAAGTTAATGAGATGAGGTGGG - Intergenic
1200768926 Y:7105786-7105808 CACTGCTAACATGAGGAGGTGGG + Intergenic