ID: 1081302626

View in Genome Browser
Species Human (GRCh38)
Location 11:41471293-41471315
Sequence GGAGTCTTTAGAATTAGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081302626_1081302630 30 Left 1081302626 11:41471293-41471315 CCTCAGCTAATTCTAAAGACTCC No data
Right 1081302630 11:41471346-41471368 TGACAAAACCTTTTCTTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081302626 Original CRISPR GGAGTCTTTAGAATTAGCTG AGG (reversed) Intergenic
No off target data available for this crispr