ID: 1081305197

View in Genome Browser
Species Human (GRCh38)
Location 11:41503239-41503261
Sequence ATTCACATGAAGCAAATAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081305197_1081305199 16 Left 1081305197 11:41503239-41503261 CCTACTATTTGCTTCATGTGAAT No data
Right 1081305199 11:41503278-41503300 ATTGCACGGTAAGCAACTTGAGG No data
1081305197_1081305200 17 Left 1081305197 11:41503239-41503261 CCTACTATTTGCTTCATGTGAAT No data
Right 1081305200 11:41503279-41503301 TTGCACGGTAAGCAACTTGAGGG No data
1081305197_1081305198 2 Left 1081305197 11:41503239-41503261 CCTACTATTTGCTTCATGTGAAT No data
Right 1081305198 11:41503264-41503286 GTCATAGCTCATCAATTGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081305197 Original CRISPR ATTCACATGAAGCAAATAGT AGG (reversed) Intergenic
No off target data available for this crispr