ID: 1081305773

View in Genome Browser
Species Human (GRCh38)
Location 11:41510278-41510300
Sequence CCTAGGGACCCTCGCGGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081305766_1081305773 -5 Left 1081305766 11:41510260-41510282 CCTTGCTTGCCAAGGAGTCCTAG No data
Right 1081305773 11:41510278-41510300 CCTAGGGACCCTCGCGGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081305773 Original CRISPR CCTAGGGACCCTCGCGGGAG TGG Intergenic
No off target data available for this crispr