ID: 1081311606

View in Genome Browser
Species Human (GRCh38)
Location 11:41581185-41581207
Sequence CTGCAGAAACAAAATTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081311606_1081311610 1 Left 1081311606 11:41581185-41581207 CCCAGCTAATTTTGTTTCTGCAG No data
Right 1081311610 11:41581209-41581231 AGAGACCATGTTGGTCAGGCTGG 0: 12
1: 61
2: 131
3: 582
4: 23485
1081311606_1081311611 5 Left 1081311606 11:41581185-41581207 CCCAGCTAATTTTGTTTCTGCAG No data
Right 1081311611 11:41581213-41581235 ACCATGTTGGTCAGGCTGGTTGG No data
1081311606_1081311613 26 Left 1081311606 11:41581185-41581207 CCCAGCTAATTTTGTTTCTGCAG No data
Right 1081311613 11:41581234-41581256 GGTCTTGAACTCCCGACCTCAGG 0: 2794
1: 34894
2: 71094
3: 76191
4: 44228
1081311606_1081311608 -8 Left 1081311606 11:41581185-41581207 CCCAGCTAATTTTGTTTCTGCAG No data
Right 1081311608 11:41581200-41581222 TTCTGCAGTAGAGACCATGTTGG No data
1081311606_1081311609 -3 Left 1081311606 11:41581185-41581207 CCCAGCTAATTTTGTTTCTGCAG No data
Right 1081311609 11:41581205-41581227 CAGTAGAGACCATGTTGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081311606 Original CRISPR CTGCAGAAACAAAATTAGCT GGG (reversed) Intergenic
No off target data available for this crispr