ID: 1081319192

View in Genome Browser
Species Human (GRCh38)
Location 11:41669272-41669294
Sequence CTGTAGCATTTCAGTACTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081319192_1081319194 -7 Left 1081319192 11:41669272-41669294 CCATCAGTACTGAAATGCTACAG No data
Right 1081319194 11:41669288-41669310 GCTACAGTGACCACAGGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081319192 Original CRISPR CTGTAGCATTTCAGTACTGA TGG (reversed) Intergenic
No off target data available for this crispr