ID: 1081319987

View in Genome Browser
Species Human (GRCh38)
Location 11:41680073-41680095
Sequence CTTAAAATGCAGAATGGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081319983_1081319987 29 Left 1081319983 11:41680021-41680043 CCAGAAGAAAAGAGGAACTGATT No data
Right 1081319987 11:41680073-41680095 CTTAAAATGCAGAATGGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081319987 Original CRISPR CTTAAAATGCAGAATGGTGA AGG Intergenic
No off target data available for this crispr