ID: 1081320829

View in Genome Browser
Species Human (GRCh38)
Location 11:41689743-41689765
Sequence TCTGCAGCACGATCCAGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081320824_1081320829 22 Left 1081320824 11:41689698-41689720 CCCTCTCAGAGTCAACGAAGGCA No data
Right 1081320829 11:41689743-41689765 TCTGCAGCACGATCCAGAAGAGG No data
1081320825_1081320829 21 Left 1081320825 11:41689699-41689721 CCTCTCAGAGTCAACGAAGGCAG No data
Right 1081320829 11:41689743-41689765 TCTGCAGCACGATCCAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081320829 Original CRISPR TCTGCAGCACGATCCAGAAG AGG Intergenic
No off target data available for this crispr