ID: 1081329736

View in Genome Browser
Species Human (GRCh38)
Location 11:41788542-41788564
Sequence CGCCCACCTGGAGCCCCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081329731_1081329736 -10 Left 1081329731 11:41788529-41788551 CCTGCCAAGCCCACGCCCACCTG 0: 44
1: 451
2: 515
3: 433
4: 647
Right 1081329736 11:41788542-41788564 CGCCCACCTGGAGCCCCAGCTGG No data
1081329723_1081329736 30 Left 1081329723 11:41788489-41788511 CCAGGGCCGGCAGGGCCGGCCAG 0: 12
1: 132
2: 246
3: 336
4: 721
Right 1081329736 11:41788542-41788564 CGCCCACCTGGAGCCCCAGCTGG No data
1081329730_1081329736 2 Left 1081329730 11:41788517-41788539 CCGAGTGTGGGGCCTGCCAAGCC 0: 16
1: 97
2: 376
3: 435
4: 468
Right 1081329736 11:41788542-41788564 CGCCCACCTGGAGCCCCAGCTGG No data
1081329724_1081329736 24 Left 1081329724 11:41788495-41788517 CCGGCAGGGCCGGCCAGCTGCTC 0: 13
1: 193
2: 285
3: 291
4: 499
Right 1081329736 11:41788542-41788564 CGCCCACCTGGAGCCCCAGCTGG No data
1081329725_1081329736 15 Left 1081329725 11:41788504-41788526 CCGGCCAGCTGCTCCGAGTGTGG 0: 10
1: 61
2: 234
3: 380
4: 522
Right 1081329736 11:41788542-41788564 CGCCCACCTGGAGCCCCAGCTGG No data
1081329729_1081329736 11 Left 1081329729 11:41788508-41788530 CCAGCTGCTCCGAGTGTGGGGCC 0: 46
1: 263
2: 359
3: 415
4: 442
Right 1081329736 11:41788542-41788564 CGCCCACCTGGAGCCCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081329736 Original CRISPR CGCCCACCTGGAGCCCCAGC TGG Intergenic
No off target data available for this crispr