ID: 1081334266

View in Genome Browser
Species Human (GRCh38)
Location 11:41844332-41844354
Sequence TGCCCAGCAAAATTCAGCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081334265_1081334266 -8 Left 1081334265 11:41844317-41844339 CCTTAAATATAATATTGCCCAGC No data
Right 1081334266 11:41844332-41844354 TGCCCAGCAAAATTCAGCTATGG No data
1081334264_1081334266 3 Left 1081334264 11:41844306-41844328 CCAACGTGAAACCTTAAATATAA No data
Right 1081334266 11:41844332-41844354 TGCCCAGCAAAATTCAGCTATGG No data
1081334263_1081334266 7 Left 1081334263 11:41844302-41844324 CCAGCCAACGTGAAACCTTAAAT No data
Right 1081334266 11:41844332-41844354 TGCCCAGCAAAATTCAGCTATGG No data
1081334262_1081334266 8 Left 1081334262 11:41844301-41844323 CCCAGCCAACGTGAAACCTTAAA No data
Right 1081334266 11:41844332-41844354 TGCCCAGCAAAATTCAGCTATGG No data
1081334261_1081334266 16 Left 1081334261 11:41844293-41844315 CCACTGCACCCAGCCAACGTGAA No data
Right 1081334266 11:41844332-41844354 TGCCCAGCAAAATTCAGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081334266 Original CRISPR TGCCCAGCAAAATTCAGCTA TGG Intergenic
No off target data available for this crispr