ID: 1081337086

View in Genome Browser
Species Human (GRCh38)
Location 11:41880082-41880104
Sequence GTGAACACTATGTCCTCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081337086_1081337093 23 Left 1081337086 11:41880082-41880104 CCATGTGAGGACATAGTGTTCAC No data
Right 1081337093 11:41880128-41880150 AGAAGGCCCTCAGCAGATAATGG No data
1081337086_1081337087 -5 Left 1081337086 11:41880082-41880104 CCATGTGAGGACATAGTGTTCAC No data
Right 1081337087 11:41880100-41880122 TTCACCCCTTTTGCCACGTGAGG No data
1081337086_1081337091 6 Left 1081337086 11:41880082-41880104 CCATGTGAGGACATAGTGTTCAC No data
Right 1081337091 11:41880111-41880133 TGCCACGTGAGGACGCAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081337086 Original CRISPR GTGAACACTATGTCCTCACA TGG (reversed) Intergenic
No off target data available for this crispr