ID: 1081341894

View in Genome Browser
Species Human (GRCh38)
Location 11:41938116-41938138
Sequence CCTCACATGGTCATGGAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081341883_1081341894 23 Left 1081341883 11:41938070-41938092 CCCAGCTCATTGAATGTGGGCCA No data
Right 1081341894 11:41938116-41938138 CCTCACATGGTCATGGAGTCTGG No data
1081341885_1081341894 3 Left 1081341885 11:41938090-41938112 CCACCCAGAAGCTACCACCCTAA No data
Right 1081341894 11:41938116-41938138 CCTCACATGGTCATGGAGTCTGG No data
1081341887_1081341894 -1 Left 1081341887 11:41938094-41938116 CCAGAAGCTACCACCCTAACTAC No data
Right 1081341894 11:41938116-41938138 CCTCACATGGTCATGGAGTCTGG No data
1081341884_1081341894 22 Left 1081341884 11:41938071-41938093 CCAGCTCATTGAATGTGGGCCAC No data
Right 1081341894 11:41938116-41938138 CCTCACATGGTCATGGAGTCTGG No data
1081341886_1081341894 0 Left 1081341886 11:41938093-41938115 CCCAGAAGCTACCACCCTAACTA No data
Right 1081341894 11:41938116-41938138 CCTCACATGGTCATGGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081341894 Original CRISPR CCTCACATGGTCATGGAGTC TGG Intergenic
No off target data available for this crispr