ID: 1081345497

View in Genome Browser
Species Human (GRCh38)
Location 11:41980875-41980897
Sequence CTAGTTCAGCACCACTCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081345497_1081345502 25 Left 1081345497 11:41980875-41980897 CCTTTGGAGTGGTGCTGAACTAG No data
Right 1081345502 11:41980923-41980945 ACTTGGGTAGGTGTATATTCAGG No data
1081345497_1081345500 13 Left 1081345497 11:41980875-41980897 CCTTTGGAGTGGTGCTGAACTAG No data
Right 1081345500 11:41980911-41980933 ATGTCATTTCCTACTTGGGTAGG No data
1081345497_1081345498 8 Left 1081345497 11:41980875-41980897 CCTTTGGAGTGGTGCTGAACTAG No data
Right 1081345498 11:41980906-41980928 TGTGTATGTCATTTCCTACTTGG No data
1081345497_1081345499 9 Left 1081345497 11:41980875-41980897 CCTTTGGAGTGGTGCTGAACTAG No data
Right 1081345499 11:41980907-41980929 GTGTATGTCATTTCCTACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081345497 Original CRISPR CTAGTTCAGCACCACTCCAA AGG (reversed) Intergenic
No off target data available for this crispr