ID: 1081350503

View in Genome Browser
Species Human (GRCh38)
Location 11:42046077-42046099
Sequence ATTAGGACGTTGACATCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081350503_1081350505 -10 Left 1081350503 11:42046077-42046099 CCCAAAGATGTCAACGTCCTAAT No data
Right 1081350505 11:42046090-42046112 ACGTCCTAATTCCCAAACTGTGG No data
1081350503_1081350509 6 Left 1081350503 11:42046077-42046099 CCCAAAGATGTCAACGTCCTAAT No data
Right 1081350509 11:42046106-42046128 ACTGTGGATGTGACCGTATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081350503 Original CRISPR ATTAGGACGTTGACATCTTT GGG (reversed) Intergenic
No off target data available for this crispr