ID: 1081351317

View in Genome Browser
Species Human (GRCh38)
Location 11:42055980-42056002
Sequence TTTTATGTAAGATAAAATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081351317_1081351318 0 Left 1081351317 11:42055980-42056002 CCTTTATTTTATCTTACATAAAA No data
Right 1081351318 11:42056003-42056025 TAAAATAAACCTTAGATTTGAGG No data
1081351317_1081351320 10 Left 1081351317 11:42055980-42056002 CCTTTATTTTATCTTACATAAAA No data
Right 1081351320 11:42056013-42056035 CTTAGATTTGAGGTTTCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081351317 Original CRISPR TTTTATGTAAGATAAAATAA AGG (reversed) Intergenic
No off target data available for this crispr