ID: 1081351759

View in Genome Browser
Species Human (GRCh38)
Location 11:42062400-42062422
Sequence CTCAGTAATCACAAAAATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081351758_1081351759 14 Left 1081351758 11:42062363-42062385 CCATGACACATGATGAGTTGAAC No data
Right 1081351759 11:42062400-42062422 CTCAGTAATCACAAAAATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081351759 Original CRISPR CTCAGTAATCACAAAAATTC TGG Intergenic
No off target data available for this crispr