ID: 1081363140

View in Genome Browser
Species Human (GRCh38)
Location 11:42204558-42204580
Sequence AGAGGTACACACTTTGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081363140_1081363146 28 Left 1081363140 11:42204558-42204580 CCCAGCTCAAAGTGTGTACCTCT No data
Right 1081363146 11:42204609-42204631 ACTGTCAACTGGGTTCATTTAGG No data
1081363140_1081363144 17 Left 1081363140 11:42204558-42204580 CCCAGCTCAAAGTGTGTACCTCT No data
Right 1081363144 11:42204598-42204620 TTACATTTTGTACTGTCAACTGG No data
1081363140_1081363145 18 Left 1081363140 11:42204558-42204580 CCCAGCTCAAAGTGTGTACCTCT No data
Right 1081363145 11:42204599-42204621 TACATTTTGTACTGTCAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081363140 Original CRISPR AGAGGTACACACTTTGAGCT GGG (reversed) Intergenic
No off target data available for this crispr