ID: 1081365537

View in Genome Browser
Species Human (GRCh38)
Location 11:42230538-42230560
Sequence TAATTTATGGAGAGAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081365532_1081365537 0 Left 1081365532 11:42230515-42230537 CCATGTTGTTTTGTCGGTGGTGG No data
Right 1081365537 11:42230538-42230560 TAATTTATGGAGAGAGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081365537 Original CRISPR TAATTTATGGAGAGAGAGGA GGG Intergenic
No off target data available for this crispr